Application of SNP (Single Nucleotide Polymorphism) molecular marker related to nitrogen apparent digestibility on porcine chromosome 5

Abstract

The invention discloses application of an SNP (Single Nucleotide Polymorphism) molecular marker located on a pig chromosome 5 and related to nitrogen apparent digestibility, the site of the SNP molecular marker is rs81386809 and corresponds to T gt at the 101069976bp position on a chromosome 5 of an international pig reference genome version 11.1; c mutation; the genotype of the gene is TT, TC or CC. The SNP molecular marker provided by the invention is remarkably related to the nitrogen apparent digestibility of pigs, and the nitrogen apparent digestibility of pigs with the genotype of CC of the SNP molecular marker is lower than that of pigs with the genotype of CT or TT. In the breeding process, by breeding pigs with the SNP molecular marker genotype being TT, the nitrogen apparent digestibility of offspring pigs can be improved, the breeding process of the pigs is accelerated, and genetic improvement of the pigs is achieved.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology, and relates to application of a SNP molecular marker related to apparent nitrogen digestibility of pigs. BACKGROUND

[0002] Protein is an indispensable core nutrient for growth and development of pigs, and its digestion and absorption efficiency directly affects feed cost, animal production performance and breeding environment. Improving apparent nitrogen digestibility of pigs is an important way to improve feed conversion efficiency, reduce nitrogen emission and realize sustainable development of animal husbandry. However, the trait is a complex quantitative trait, and is regulated by multiple genes. Traditional breeding methods rely on tedious and high-cost phenotype determination, and it is difficult to carry out large-scale selection, resulting in slow and low-efficient genetic improvement process. SUMMARY

[0003] The application aims to provide application of a SNP molecular marker related to apparent nitrogen digestibility of pigs on chromosome 5 of pigs.

[0004] According to one aspect of the application, application of a product for detecting a SNP molecular marker related to apparent nitrogen digestibility on chromosome 5 of pigs is provided, the SNP molecular marker is located at rs81386809, corresponding to T>C mutation at position 101069976 bp on chromosome 5 of the international pig reference genome 11.1 version; and the genotype of the SNP molecular marker is TT, TC or CC.

[0005] The SNP molecular marker provided by the application is significantly related to apparent nitrogen digestibility of pigs, wherein the apparent nitrogen digestibility of pigs with the genotype TT of the SNP molecular marker is higher than that of pigs with the genotypes TC and CC. By identifying the single nucleotide polymorphism of the SNP molecular marker and / or the genotype of the SNP molecular marker, apparent nitrogen digestibility of pigs can be identified. In the breeding process, by breeding pigs with the genotype TT of the SNP molecular marker, apparent nitrogen digestibility of offspring pigs can be improved, the breeding process of pigs can be accelerated, and genetic improvement of pigs can be realized.

[0006] Apparent nitrogen digestibility of pigs is a direct or indirect manifestation of the ability of pigs to digest and utilize protein, feed conversion efficiency and other production traits. The higher the apparent nitrogen digestibility of pigs is, the stronger the ability of pigs to digest and utilize protein is, and the higher the feed conversion efficiency is. Therefore, by identifying the apparent nitrogen digestibility of pigs, the ability of pigs to digest and utilize protein and the feed conversion efficiency of pigs can be evaluated. Thus, the SNP molecular marker related to apparent nitrogen digestibility provided by the application can also be applied to assisting in evaluating the ability of pigs to digest and utilize protein and / or the feed conversion efficiency of pigs, and to preparing a product for assisting in evaluating the ability of pigs to digest and utilize protein and / or the feed conversion efficiency of pigs.

[0007] Thus, the product for detecting the SNP molecular marker of the present application can be applied to at least one of the following (1) to (8): (1) identifying the nitrogen apparent digestibility trait of a pig; (2) preparing a product for identifying the nitrogen apparent digestibility trait of a pig; (3) assisting in evaluating the feed conversion efficiency of a pig, and the evaluation of the feed conversion efficiency of a pig is based on the identification of the nitrogen apparent digestibility trait of a pig; (4) preparing a product for assisting in evaluating the feed conversion efficiency of a pig, and the evaluation of the feed conversion efficiency of a pig is based on the identification of the nitrogen apparent digestibility trait of a pig; (5) assisting in evaluating the protein digestion and utilization ability of a pig, and the evaluation of the protein digestion and utilization ability of a pig is based on the identification of the nitrogen apparent digestibility trait of a pig; (6) preparing a product for assisting in evaluating the protein digestion and utilization ability of a pig, and the evaluation of the protein digestion and utilization ability of a pig is based on the identification of the nitrogen apparent digestibility trait of a pig; (7) pig genetic improvement, and the pig genetic improvement is based on breeding pigs with the SNP molecular marker genotype of TT to improve the nitrogen apparent digestibility of pigs; (8) preparing a product for assisting in pig genetic improvement, and the pig genetic improvement is based on the identification of the genotype of the SNP molecular marker.

[0008] In some embodiments, the product for detecting the SNP molecular marker of the present application can include at least one of the following: a reagent, a kit, a chip and an apparatus for detecting the SNP molecular marker of the present application.

[0009] In some embodiments, the reagent for detecting the SNP molecular marker of the present application can include at least one of the following: a primer and a probe for detecting the SNP molecular marker of the present application.

[0010] In some embodiments, the primer for detecting the SNP molecular marker of the present application includes an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 3. The primer pair can specifically amplify an amplification fragment containing the single nucleotide polymorphism at the 49th nucleotide from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, and can be applied to detect whether the single nucleotide at the 49th nucleotide from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1, corresponding to the position 101069976 on chromosome 5 of the international pig reference genome version 11.1, is T or C.

[0011] In some embodiments, the kit for detecting the SNP molecular marker of the present application can comprise a primer pair with nucleotide sequences as shown in SEQ ID NO: 2 and SEQ ID NO: 3, and dNTPs, DNA polymerase, Mg 2+ and other components of a conventional PCR reaction system.

[0012] In some embodiments, the pig is a Duroc pig.

[0013] In some embodiments, the nitrogen apparent digestibility trait of the pig refers to the nitrogen apparent digestibility of the pig at about 140 days of age.

[0014] According to a second aspect of the present application, a method for improving a pig is provided, comprising the following steps: (1) determining the genotype of the SNP molecular marker rs81386809 on chromosome 5 of the pig, which is related to nitrogen apparent digestibility; (2) breeding individuals with the genotype of TT of the SNP molecular marker, eliminating individuals with the genotypes of CC and TC, and increasing the frequency of allele T at the locus generation by generation; thereby improving the nitrogen apparent digestibility trait of the offspring pig and increasing the feed conversion efficiency of the offspring.

[0015] In some embodiments, in step (1), the pig is a breeding pig in a core group of breeding pigs.

[0016] In some embodiments, in step (1), the pig is a Duroc pig.

[0017] In some embodiments, in step (1), the method for determining the genotype of the SNP molecular marker on chromosome 5 of the pig, which is related to nitrogen apparent digestibility, comprises the following steps: extracting the whole genome DNA of the pig, performing PCR amplification using a primer pair with nucleotide sequences as shown in SEQ ID NO: 2 and SEQ ID NO: 3, sequencing the amplification product, and determining whether the single nucleotide at the SNP molecular marker site is T or C based on the sequencing result, thereby determining the genotype of the SNP molecular marker.

[0018] Compared with the prior art, the present application has the following beneficial effects: (1) The present application verifies the effect of the SNP molecular marker rs81386809 on chromosome 5 of the pig, which is related to nitrogen apparent digestibility, on the nitrogen apparent digestibility trait of the pig, which is helpful to establish a molecular marker assisted selection breeding technique for rapidly improving the nitrogen apparent digestibility trait of the pig, to rapidly and accurately breed the trait, to improve the nitrogen apparent digestibility of the pig and the ability of the pig to digest and utilize protein and the feed conversion efficiency of the pig, and to speed up the breeding process of Duroc and its synthetic lines.

[0019] (2) The application provides a method for genetic improvement of pigs, which can accelerate the genetic progress of Duroc pigs, shorten the time for Duroc improvement, and thus effectively improve the economic benefits of breeding pigs. By selecting individuals with SNP molecular marker genotypes of TT, the apparent nitrogen digestibility of pigs can be effectively improved. The improvement of apparent nitrogen digestibility not only reduces feed costs and improves feed conversion efficiency, but also reduces the emission of pig manure nitrogen and the pollution of breeding to the environment. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 A whole genome association (GWAS) analysis diagram for the nitrogen apparent digestibility of 5th chromosome of Duroc pigs at about 140 days of age.

[0021] Figure 2 A result analysis diagram of the nitrogen apparent digestibility of pigs with different genotypes. DETAILED DESCRIPTION

[0022] The application will be further described in detail below in combination with embodiments. The embodiments are only used for explanation and do not limit the application in any way. If no special description is made, the raw materials and reagents used in the embodiments are conventional products that can be obtained by marketing; and the experimental methods not specified in the embodiments are usually carried out according to the conventional conditions in the field or according to the conditions recommended by the manufacturer.

[0023] Example 1: Identification and verification of SNP molecular markers related to nitrogen apparent digestibility (1) Experimental pig population The experimental pig population used in the application is a purebred Duroc of the Guangdong Wen's Food Group Co., Ltd. Pig Breeding Branch, which is the core population of the Pig Breeding Branch, and the pedigree record is detailed. A total of 737 Duroc pigs were selected from the resource population, and the pigs were fed under the same feeding standard, free feeding and drinking water, and fed to about 140 days of age. The feeding method, feeding condition and the like are conventional methods.

[0024] (2) Phenotype measurement In the application, the phenotype determination of the apparent nitrogen digestibility of pigs adopts the endogenous indicator method (acid-insoluble ash method). The fecal samples of pigs for 2-3 days are collected, 10% hydrochloric acid solution is added at a ratio of 25 mL / kg for nitrogen fixation treatment, and the feed samples eaten by the corresponding pig population are collected. The fecal samples are mixed at the same ratio, dried, ground and sieved, and the feed samples are ground and sieved. The treated fecal samples and feed samples are determined for dry matter content (GB / T 6435-2014), acid-insoluble ash content (GB / T 23742-2009), crude protein content (GB / T 6432-2018) and nitrogen content (GB / T 6432-1994) according to the Kjeldahl method.

[0025] The formula for calculating apparent nitrogen digestibility is as follows: Apparent nitrogen digestibility (%) = 100% (A1 / A2 × F2 / F1) × 100% In the formula: A1 is the acid-insoluble ash content (%) in the feed sample; A2 is the acid-insoluble ash content (%) in the fecal sample; F1 is the nitrogen content (%) in the feed sample; F2 is the nitrogen content (%) in the fecal sample.

[0026] (3) Extraction of porcine genomic DNA Whole-genome DNA was extracted from ear tissue samples of American Duroc breed pigs using the standard phenol-chloroform method. The DNA quality and concentration were determined using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. For acceptable DNA samples, the DNA concentration was determined using a Matrix Arrayer instrument, and the concentration of all samples was normalized to 20 nanograms per microliter.

[0027] (4) Detection of 50K SNP genotypes in the whole pig genome Genotyping was performed using the PorcineWENS 55K chip independently developed by Wens Foodstuff Group. The scan data after the scan was processed using the Axiom best practices workflow (referencing the SNPolisher™ Package User Guide). Furthermore, PLINK v1.9 was used to rigorously quality control the obtained genotyping data, removing data with a deletion rate higher than 10%, a minor allelic frequency (MAF) lower than 1%, or deviations from the Hardy-Weinberg Equilibrium (HWE) test. P Value less than 1×10 -6 The SNPs were identified by excluding those located at unknown sites, on sex chromosomes, and in individuals with a missing genotype rate higher than 10%. Ultimately, 43,389 valid SNP genotypes were obtained.

[0028] (5) Genome-wide association analysis (GWAS) The BLINK model of the GAPIT software was used to perform association analysis on the nitrogen apparent digestibility trait. The first five principal components, gender, and age were used as covariates. The Bonferroni method was used to correct the results and determine the whole genome and chromosome level significance thresholds. The whole genome level significance threshold was 0.05 / N, and the chromosome level significance threshold was 1 / N. N represents the number of SNPs after quality control. Finally, the genome and chromosome significant thresholds were set to 1.15E-06 (0.05 / 43389) and 2.30E-05 (1 / 43389), respectively.

[0029] The results of the GWAS analysis are shown in Table 1. Figure 1

[0030] As can be seen from Table 1, Figure 1 there is a SNP site on chromosome 5 of Duroc pigs that significantly affects nitrogen apparent digestibility, which is g. 101069976 T>C (rs81386809, P =1.11×10 -10 ), i.e., the 49th nucleotide from the 5' end in the nucleotide sequence shown in SEQ ID NO: 1, corresponding to the T>C mutation at position 101069976 on chromosome 5 of the international pig reference genome version 11.1.

[0031] (6) Analysis of the association between different genotypes and the nitrogen apparent digestibility phenotype of breeding pigs at about 140 days of age to verify the effect of the SNP molecular marker rs81386809 on the nitrogen apparent digestibility trait of pigs The results are shown in Table 1. Figure 2

[0032] As can be seen from Table 1, Figure 2 the SNP site g. 101069976 T>C of the molecular marker is extremely significantly related to the nitrogen apparent digestibility trait ( P <0.001), indicating that this molecular marker significantly affects the nitrogen apparent digestibility of pigs. Pigs of CC and TC types have lower nitrogen apparent digestibility than pigs of TT type, indicating that homozygote TT is most beneficial to the nitrogen apparent digestibility of breeding pigs. The greater the nitrogen apparent digestibility, the better the ability of pigs to digest and utilize nutrients. Therefore, during breeding, CC and TC type breeding pigs need to be gradually eliminated, and TT type breeding pigs need to be retained to gradually increase the frequency of allele T at this site from generation to generation.

[0033] Table 1 Correlation analysis of SNP molecular markers and traits

[0034] (7) Effect analysis ​​The present application provides a SNP molecular marker significantly related to the nitrogen apparent digestibility trait of Duroc pigs, and the use of the SNP molecular marker for marker-assisted selection can accelerate the breeding process of the nitrogen apparent digestibility of Duroc pigs. If the CC type and TC type individuals of the molecular marker affecting the nitrogen apparent digestibility trait of pigs are all selected into TT type individuals, the nitrogen apparent digestibility of each pig can be increased by 2.74% at about 140 days of age. Since the nitrogen apparent digestibility is positively correlated with the feed conversion efficiency, the breeder can improve the feed conversion efficiency by increasing the nitrogen apparent digestibility of the pig, and the improvement of the nitrogen apparent digestibility can reduce the emission of pig manure nitrogen, and can reduce the pollution of breeding to the environment. The improvement can not only bring higher economic benefits to the pig breeding enterprise, but also meet the needs of green development and sustainable development of the breeding industry. The SNP molecular marker provided by the present application can ultimately improve the economic benefits of commercial pigs by selecting the advantageous allele (T) in Duroc pigs, thereby increasing the profits of the enterprise.

[0035] Example 2 Genetic improvement method of pigs The target fragment containing the SNP molecular marker site significantly related to the nitrogen apparent digestibility trait of Duroc pigs is a 190 bp nucleotide sequence in chromosome 5, and the specific nucleotide sequence is shown as SEQ ID NO: 1, and the primer pair for PCR amplification is shown as SEQ ID NO: 2 and SEQ ID NO: 3.

[0036] SEQ ID NO: 1 CACCCACCCACCGAATTCTAGAAAACAAGCTATTCAATGCACCACTGA Y TGGGAATTGCGGTAATTCTATTTTACGCGACAGTTGCATTTCCACTGAATTTTATTCCTAATTCTCTCCTCTAAGTCCCTTACAGTCCAGGATGCACGTTCACTCATCCTCTGCTATTAGTACCTCCCAAAAAGTCAGCGC In the sequence, Y marked in the sequence is a mutation site, which is T or C, and is an allelic mutation; the primer sequence binding position is shown in bold at the beginning and end of the sequence.

[0037] The upstream primer primer-F is 5'-CACCCACCCACCGAATTCTA-3' (SEQ ID NO: 2); The downstream primer primer-R is 5'-GCGCTGACTTTTTGGGAGGT-3' (SEQ ID NO: 3).

[0038] The genetic improvement method of pigs comprises the following steps: S1, determining the genotype of SNP molecular marker rs81386809 (1) Taking the ear tissue or tail tissue of piglets of pigs, referring to the standard phenol-chloroform method to extract the whole genome DNA of pigs, and then performing quality detection and concentration determination on the extracted DNA.

[0039] (2) PCR amplification Prepare 10 μL system, which comprises: DNA sample 1 μL, upstream primer 0.3 μL, downstream primer 0.3 μL, PCR mix 5 μL, ddH2O 3.4 μL; the PCR mix comprises dNTPs, DNA polymerase, Mg 2+ and the composition of the conventional PCR reaction system such as PCR reaction buffer.

[0040] PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, a total of 35 cycles, and finally extension for 72℃ for 5 min.

[0041] (3) DNA sequence determination Sequencing the PCR amplification product, the gene fragment is measured for two reactions, according to the sequencing result, judging whether the single nucleotide at the 49th position from the 5' end in the nucleotide sequence shown in SEQ ID NO: 1, corresponding to the 101069976 bp on the chromosome 5 of the international pig reference genome 11.1 version, is T or C, to determine the genotype of the SNP molecular marker rs81386809 of the pig to be tested.

[0042] S2, selecting the pig with SNP site genotype TT as the parent for breeding, and increasing the frequency of allele T of the SNP molecular marker site generation by generation.

[0043] The above only describes some embodiments of the present application. For those skilled in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are all within the protection scope of the present application.

Claims

1. The application of products for detecting SNP molecular markers on porcine chromosome 5 that are associated with apparent nitrogen digestibility, characterized in that, The SNP molecular marker site is rs81386809, and the application includes at least one of the following items (1) to (8): (1) Identify the apparent nitrogen digestibility trait in pigs; (2) Prepare products for identifying the apparent nitrogen digestibility traits of pigs; (3) To assist in evaluating the feed conversion efficiency of pigs, the feed conversion efficiency of pigs is evaluated based on the identification of the apparent nitrogen digestibility trait of pigs. (4) Prepare a product to assist in evaluating the feed conversion efficiency of pigs, wherein the product is based on the identification of the apparent nitrogen digestibility trait of pigs to assist in evaluating the feed conversion efficiency of pigs; (5) To assist in the evaluation of pigs' ability to digest and utilize protein, and to achieve an auxiliary evaluation of pigs' ability to digest and utilize protein based on the identification of the apparent nitrogen digestibility trait of pigs. (6) Prepare a product to assist in evaluating the digestibility and utilization of protein in pigs, wherein the product is based on the identification of the apparent nitrogen digestibility trait of pigs to assist in evaluating the digestibility and utilization of protein in pigs. (7) Pig genetic improvement, based on breeding pigs with the SNP molecular marker genotype TT to improve the apparent nitrogen digestibility of pigs; (8) Prepare a product for assisting in the genetic improvement of pigs, said product being based on the identification of the genotype of the SNP molecular marker to assist in the genetic improvement of pigs.

2. The application according to claim 1, characterized in that, The products for detecting SNP molecular markers on porcine chromosome 5 that are associated with apparent nitrogen digestibility include at least one of the following: reagents, kits, chips, and devices for detecting the SNP molecular markers.

3. The application according to claim 2, characterized in that, The reagents used to detect the SNP molecular marker include at least one of the following: primers or probes for detecting the SNP molecular marker.

4. The application according to claim 3, characterized in that, The primers used to detect the SNP molecular marker include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

5. The application according to any one of claims 1 to 4, characterized in that, The pig in question is a Duroc pig.

6. The application according to claim 5, characterized in that, The apparent nitrogen digestibility trait of the pigs refers to the apparent nitrogen digestibility of pigs at approximately 140 days of age.

7. A method for genetic improvement of pigs, characterized in that, Includes the following steps: (1) Determine the genotype of SNP molecular markers on chromosome 5 of pigs that are associated with apparent nitrogen digestibility; (2) Select individuals with the SNP molecular marker genotype TT; The site of the SNP molecular marker is rs81386809.

8. The method for genetic improvement of pigs according to claim 7, characterized in that, In step (1), the method for determining the genotype of the SNP molecular markers related to apparent nitrogen digestibility on chromosome 5 of pigs includes the following steps: Whole-genome DNA was extracted from pigs and amplified by PCR using primers with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The amplified products were sequenced, and the genotypes of SNP molecular markers related to apparent nitrogen digestibility on chromosome 5 of pigs were determined based on the sequencing results.

9. The method for genetic improvement of pigs according to claim 7 or 8, characterized in that, The pig in question is a Duroc pig.

Images