SNP (Single Nucleotide Polymorphism) molecular marker primer combination for identifying Yunlin black duck variety and application of SNP molecular marker primer combination
By combining five SNP molecular marker sites with Bayes' theorem, the problem of identifying the Yulin Black Duck breed in existing technologies has been solved, enabling rapid and accurate identification of the Yulin Black Duck breed and supporting the protection and utilization of its genetic resources.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-13
- Publication Date
- 2026-03-27
AI Technical Summary
The lack of effective methods for accurately identifying Yulin Black Duck breeds in current technology has led to insufficient protection and utilization of its high-quality germplasm resources.
By using five SNP molecular marker sites (SNP1-5) combined with PCR amplification and Bayes' theorem, the specific SNP site combinations of Yulin Black Duck were identified to determine whether the duck being tested was of the Yulin Black Duck breed.
This has enabled the rapid and accurate identification of the Yulin Black Duck breed, providing a scientific basis to support the protection and rational utilization of its genetic resources.
Smart Images

Figure CN121737318A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a combination of SNP molecular marker primers for identifying Yulin Black Duck breeds and its application, belonging to the field of biotechnology. Background Technology
[0002] The Yulin Black Duck, also known as the Black Field Duck or Yulin Silky Duck, is a local duck breed bred and raised in the Yulin region of Guangxi Province. It is mainly distributed in Beiliu District, Fumian District, and Xingye County of Yulin City, and is a unique local breed. The main characteristics of the Yulin Black Duck are its black beak, shanks, webbed feet, and feathers. It has a compact body, relatively small weight, and very few individuals possess a crest. The Yulin Black Duck is low in fat and has delicious meat. Currently, Yulin Black Ducks are mainly raised by local farmers in rural areas, with an annual breeding volume of over 100,000, and a core breeding population of approximately 8,000. Therefore, the protection and utilization of the high-quality germplasm resources of the Yulin Black Duck is particularly necessary, and an effective and accurate method for identifying the Yulin Black Duck breed is urgently needed. Summary of the Invention
[0003] The purpose of this invention is to address the shortcomings of existing technologies by providing a combination of SNP molecular marker primers for identifying Yulin Black Duck breeds and their application, enabling rapid and accurate identification of Yulin Black Duck breeds.
[0004] The present invention achieves its objective through the following technical solutions: A molecular marker combination for identifying the Yulin Black Duck breed includes the SNP sites shown in Table 1: It contains 5 SNP sites, named SNP sites 1-5. The physical locations of these 5 SNP sites were determined based on sequence alignment of the duck reference genome GCF_047663525.1. The locations and variation information of the 5 SNP sites are shown below: SNP1 is located at position 51148602 on chromosome 4. The mutation type is G / T, and the genotype is GG, GT, or TT. The nucleotide sequences of the SNP1 primers are shown in SEQ ID NO:1 and SEQ ID NO:2. SNP2 is located at position 51648174 on chromosome 4. The mutation type is T / C, and the genotype is TT, TC, or CC. The nucleotide sequences of the SNP2 primers are shown in SEQ ID NO:3 and SEQ ID NO:4. SNP3 is located at position 24672692 on chromosome 9. The mutation type is A / T, and the genotype is AA, AT, or TT. The nucleotide sequences of the SNP4 primers are shown in SEQ ID NO:5 and SEQ ID NO:6. SNP4 is located at position 12572031 on chromosome 14. The mutation type is T / G, and the genotype is TT, TG, or GG. The nucleotide sequences of the SNP4 primers are shown in SEQ ID NO:7 and SEQ ID NO:8. SNP5 is located at position 5919153 on chromosome 16, with a mutation type of C / T and a genotype of CC, CT, or TT. The nucleotide sequences of the SNP5 primers are shown in SEQ ID NO:9 and SEQ ID NO:10.
[0005] The primer combinations mentioned above for identifying Yulin Black Duck include primer pairs as shown in Table 1: Table 1
[0006] This invention also provides the application of the aforementioned SNP site combination, molecular marker combination, or primer pair combination in the identification of Yulin Black Duck breeds.
[0007] This invention also provides a method for identifying the Yulin Black Duck breed, comprising the following steps: Using the duck genomic DNA as a template, the genotype of each SNP site in the SNP site combination was determined; Based on the determined genotype results, it was determined whether the duck to be tested was a Yulin Black Duck.
[0008] Furthermore, the probability of whether the duck being tested is a Yulin Black Duck breed is calculated using the following formula:
[0009] Where pi represents the frequency of the genotype corresponding to the Yulin Black Duck breed in the i-th SNP of the SNP combination, and qi represents the frequency of the genotype corresponding to other duck breeds in the i-th SNP of the SNP combination.
[0010] The p i and q i The frequency values are derived from Table 2: Table 2
[0011] When the probability score is greater than or equal to 0.95, the duck to be tested is determined to be of the Yulin Black Duck breed.
[0012] Furthermore, the probability that the duck breed being tested is not the Yulin Black Duck breed is calculated using the following formula:
[0013] When the probability score is greater than or equal to 0.95, the duck to be tested is determined to be a non-Yulin Black Duck breed.
[0014] Furthermore, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min.
[0015] This invention also provides the application of the primer pair combination described above in the preparation of a kit for identifying the Yulin Black Duck breed.
[0016] The present invention also provides a reagent or kit for identifying the Yulin Black Duck breed, comprising the aforementioned primer pair combination.
[0017] This invention provides five specific SNP loci for identifying Yulin Black Duck. Combining existing methods for detecting specific SNP loci with Bayes' theorem, the probability of an individual being a Yulin Black Duck is determined by analyzing the combined genotype of these five SNPs, thus identifying the duck. This identification method is simple to operate, highly accurate, and can effectively identify whether an individual is a purebred Yulin Black Duck, providing a scientific basis for the protection and rational utilization of Yulin Black Duck genetic resources. Attached Figure Description
[0018] Figure 1 These are Manhattan plots and QQ plots of the GWAS analysis results of Yulin Black Duck in this invention.
[0019] Figure 2 These are Manhattan plots and QQ plots of the iterative GWAS analysis results of the Yulin Black Duck of this invention.
[0020] Figure 3 This is a Manhattan plot of the selection signal analysis results of Yulin Black Duck in this invention.
[0021] Figure 4 This is a graph showing the verification results of the SNP site combinations disclosed in this invention and principal component analysis of other varieties. Detailed Implementation
[0022] Example 1 Screening of SNP loci specific to Yulin Black Duck breed A total of 131 ducks from six local duck breeds in Guangxi were selected as the research subjects. 2 mL of venous blood was collected from each duck, and DNA was extracted using the conventional phenol-formaldehyde method. Whole-genome sequencing was then performed on the qualified DNA samples. Based on this, duck resequencing data (6x or higher) downloaded from the online public databases NCBI (https: / / www.ncbi.nlm.nih.gov / ) and GSA (https: / / ngdc.cncb.ac.cn / gsa / ) were combined and analyzed. Detailed sample information for the genome resequencing analysis is shown in Table 3.
[0023] Table 3 Information on all samples from the whole-genome resequencing in this embodiment
[0024] (1) Genotype data processing. Indels were removed using vcftools software, leaving only SNPs for subsequent analysis. Plink software was then used to perform quality control on the genotype data of each population using standard methods, removing SNPs with a detection rate below 90% (command: geno 0.1), as well as loci with a minimum allele frequency below 5% and sex chromosome loci, retaining autosomal loci 1-39 (command: maf 0.1 –chr 1 39). Finally, 14,479,889 high-quality SNP loci from 344 individuals were used for subsequent analysis.
[0025] (2) Genome-wide association analysis (GWAS) was used to screen for Yulin Black Duck-specific loci. Based on step 1, the rMVP package was used in R to conduct a genome-wide association analysis based on a mixed linear model. Specifically, Yulin Black Duck was used as the experimental group, and other breeds were uniformly set as the control group. The significance threshold was set at 3.45e-9. For example... Figure 1 As shown, 306 significant SNP sites above the threshold line were selected as group A of Yulin Black Duck variety-specific SNP sites.
[0026] (3) Iterative genome-wide association analysis (GWAS) was used to screen for independent genetic signals. Based on step 2, the SNP loci with the most significant P-values from group A loci were selected as covariates to control for the influence of this major-effect locus on the GWAS. Subsequently, the association analysis was re-performed based on a mixed linear model, with the significance threshold still set at 3.45e⁹. Figure 2 As shown, the eight significant SNP sites above the threshold line were selected as Group B of Yulin Black Duck variety-specific SNP sites.
[0027] (4) Select signal analysis to screen for Yulin Black Duck-specific loci. Based on step 3, use Plink software to convert the quality-controlled genotype data into VCF format (command: recode vcf iid), and use VCFtools software to calculate the genetic differentiation index (Fst). The specific method is as follows: use Yulin Black Duck as the experimental group and other varieties as the control group, calculate the Fst value of each locus (--fst-window-size 1--fst--window step 1), and sort the Fst values of the analysis results from largest to smallest. Figure 3 As shown, 842,990 sites with Fst values greater than 0.2 were identified as the C group of SNP sites specific to the Yulin Black Duck breed.
[0028] (5) Screening of common specific SNP sites. The overlap of SNP sites in groups A, B and C was analyzed. Common sites that appeared in all three groups were retained. At the same time, one SNP in the polyT structure was removed and the SNP site with the most significant P value in group A (P<1.18e-17) was added to form a set of 6 candidate sites in group D.
[0029] (6) Population-specific frequency screening. Based on the D group loci, the distribution characteristics of the loci in the Yulin Black Duck population and 23 other varieties were calculated, and the following criteria were used for screening: ① high homozygosity in Yulin Black Duck; ② fixed opposite alleles in other varieties. Finally, a set of 4 F group candidate loci that met the population-specific pattern was obtained.
[0030] (7) Functional annotation and identification of key sites. SnpEff software was used to jointly annotate sites in groups A and C. The selection criteria were: ① the variant type was a missense mutation; ② the functional impact level was greater than "MODERATE". Through this analysis, a non-synonymous mutation was identified in the KIT gene on chromosome 4, which simultaneously met the following criteria: a) it reached genome-wide significance in GWAS (P=9.75e-15); b) the Fst value reached 0.91; c) it showed high fixation in Yulin Black Duck (frequency=0.77). This site was merged with group F to finally establish a molecular marker set containing characteristic SNPs of 5 Yulin Black Duck breeds (Table 4).
[0031] This invention determines the mean allele frequency of each locus in 344 different duck breeds, and then compares this mean with the allele frequency of each locus in Yulin Black Duck to screen out SNP loci with large differences in allele frequency. Prioritize selecting loci in Yulin Black Duck where the allele frequency is 0 or 1, and loci in non-Yulin Black Duck populations where the allele frequency is close to 1 or close to 0. Thus, specific SNP locus combinations for Yulin Black Duck breed identification are screened as shown in Table 4.
[0032] Table 4 Information on 5 SNP sites
[0033] Using Plink software and following standard methods, the genotype data of the 24 duck breeds in Example 1 (data from the 344 individuals merged in step 2) were used to extract the genotype data of the corresponding 5 specific SNP loci according to Table 4, and PCA analysis was performed on the above genotype data. The results are as follows: Figure 4As shown in Table 3, the 75 Yulin Black Ducks clustered together, exhibiting relatively close genetic distances, while showing greater genetic distances from the other 23 duck breeds. This indicates that the five specific SNP loci in Table 4 can be used for precise identification of Yulin Black Ducks. Therefore, the combination of five specific SNP loci provided by this invention can be used to identify the breed of Yulin Black Duck. A method for identifying the Yulin Black Duck breed is thus established, comprising the following steps: Total DNA was extracted from the genomic genome of the duck to be tested; Based on the five SNP site combinations (Table 4), PCR amplification was performed using the corresponding primer pairs (Table 5); After sequencing the PCR amplification products, the genotype was determined; Based on the genotype results, determine whether an individual belongs to the Yulin Black Duck breed.
[0034] The five SNP locus combinations used to identify the Yulin Black Duck breed are shown in Table 4.
[0035] A primer set for identifying the Yulin Black Duck breed, the primer set comprising primers for amplifying SNP1 to SNP5 sites; The sequences of primers for each SNP site are shown in Table 5: Table 5 Primer information for the 5 SNP sites
[0036] The final concentration of the reaction system (25 μl) is: 50 ng of duck DNA to be tested 2 x Accurate Taq Master Mix 12.5μl 1 μl of upstream primer 1 μl of downstream primer Sterilized water replenished to 25 μl The PCR program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min.
[0037] The amplified products were subjected to sequence polymorphism detection and genotype determination.
[0038] The sequences of the amplification products are shown below: CTAAAACGTTCTCCTGTGACATTGCTTGGACGGTCTGTTCACTCTCTGTTCTCCCATCAGGTATAAAAATACTGTCATGGGAGAAAGCTCGACTGCCCATATAATAATGGGAAGACCTGGAAAAAACAGGTAATAAGTACAACAATTAATTTATGAGAGTGGCCCTTCATATCATAGCTGCACTGCTATATGGATTTTCCCTCCCTTCTGTCCGTAC G AGAGCTTTGAACATTCTCATAACAGAGATATCCAAACATTTTCTGTTATCAGATCAGTGATTCCTTTGCGTGTAGTCTTCCTCCTTGGAAGAACACTAAGTGAGAAGTTTTTAATAAGAAGGTTGAAAAAGTTCAATTAATTTTCCTTAGAAGCCCCAAGGCTAAGCATTACTTTTAGAATACAGGGTAGATGATGATGATGCACATGTTACCAGATGTCACATTTAAAAAATATACTGTAATTAAAATTATATAAAATAACTGCTTA;(SEQ ID NO:11); CTAAAACGTTCTCCTGTGACATTGCTTGGACGGTCTGTTCACTCTCTGTTCTCCCATCAGGTATAAAAATACTGTCATGGGAGAAAGCTCGACTGCCCATATAATAATGGGAAGACCTGGAAAAAACAGGTAATAAGTACAACAATTAATTTATGAGAGTGGCCCTTCATATCATAGCTGCACTGCTATATGGATTTTCCCTCCCTTCTGTCCGTAC TAGAGCTTTGAACATTCTCATAACAGAGATATCCAAACATTTTCTGTTATCAGATCAGTGATTCCTTTGCGTGTAGTCTTCCTCCTTGGAAGAACACTAAGTGAGAAGTTTTTAATAAGAAGGTTGAAAAAGTTCAATTAATTTTCCTTAGAAGCCCCAAGGCTAAGCATTACTTTTAGAATACAGGGTAGATGATGATGATGCACATGTTACCAGATGTCACATTTAAAAAATATACTGTAATTAAAATTATATAAAATAACTGCTTA; (SEQ ID NO: 12) Note: The underlined ones in the sequence are single nucleotide polymorphism mutation sites, and G is the G / T mutation.
[0039] CCTGCACATCTTTTTGACAAAACCATGCTGTGTTTAACCGAAGTCTCATATGAGACTTGAAGGTTTCACCTTGCAGATGAAGTTAAATAAATATAAACTAACCAAAACTCAACCGGTTTCTAGGAAATTCCCATTTGTGATCATAAGGAAGCTGTGTTGGGTCTATGTAAACATAGTTGTTTCCATTTATTTCTTCAACAACTTTCCACTGAACTTCA T ATTTGGGTTTCTGAAAAGGAAAGAGAACGGCTGTCACTCCTGAAGCTTCCCCAGGCAGCTCCCACACTTTAACAACTCAGGCAGAGGAGCTGCTGATTTTACCTGCAAATATATGTACACCAGGATCATGACTATGATGCACATCAGTCCAGCAGCAACTCCAAATGCGATTAGTAAAGGTGTGAAAAGGGTATGGGTACGGATTTGCTCTGGAAAGAAACAGAGAAAATTCTGCTTGAATACCAAGCATAAGAAACTAAATTTAA; (SEQ ID NO: 13); CCTGCACATCTTTTTGACAAAACCATGCTGTGTTTAACCGAAGTCTCATATGAGACTTGAAGGTTTCACCTTGCAGATGAAGTTAAATAAATATAAACTAACCAAAACTCAACCGGTTTCTAGGAAATTCCCATTTGTGATCATAAGGAAGCTGTGTTGGGTCTATGTAAACATAGTTGTTTCCATTTATTTCTTCAACAACTTTCCACTGAACTTCA C ATTTGGGTTTCTGAAAAGGAAAGAGAACGGCTGTCACTCCTGAAGCTTCCCCAGGCAGCTCCCACACTTTAACAACTCAGGCAGAGGAGCTGCTGATTTTACCTGCAAATATATGTACACCAGGATCATGACTATGATGCACATCAGTCCAGCAGCAACTCCAAATGCGATTAGTAAAGGTGTGAAAAGGGTATGGGTACGGATTTGCTCTGGAAAGAAACAGAGAAAATTCTGCTTGAATACCAAGCATAAGAAACTAAATTTAA; (SEQ ID NO: 14) Note: The underlined sequences in the sequence are single nucleotide polymorphism mutation sites, and T is a T / C mutation.
[0040] CAGCTTCTACTGCTCTGTGCAATGACATGTGGTGTGGAATCTCCCTCTGGTAGGTTTAGGTCAGCTTTCCTGGTGAGGTTCCCTCCCCACCACTTGCCTAGTGCCAGCCCACGTGCTGTGGGGGTTTGGAGAGCTGGCCTTGGTGCTGTGCCAGAGCTGTTGAGCAATGGCCAAAGCACTTCTGGGACAGCAGTGCTGCTCTGGCTACCCGTGCAC AGCACAGCTCTGTATGGGCTGCTGCAGGGAAAGTTAACTCCATCCCAGCCAGATGCAGTAGAGTCTGGGATTATTTATCTGTGGATAAATAAAAACGAAATATTATCTGTGGAGTGTTTGCCAAAAACTGAAGTGTTGTCAGGCTTAGTTGGAATCTGAATCCTGGTGCTTGTTAGCACTTGCTGGCAACAACAGTTACAAATTGCTAGAAATTGCCAGCAAGCAATTATACAGCTAAATCTACAATTCTGTGAACCAAGTGTGTTTTG; (SEQ ID NO: 15); CAGCTTCTACTGCTCTGTGCAATGACATGTGGTGTGGAATCTCCCTCTGGTAGGTTTAGGTCAGCTTTCCTGGTGAGGTTCCCTCCCCACCACTTGCCTAGTGCCAGCCCACGTGCTGTGGGGGTTTGGAGAGCTGGCCTTGGTGCTGTGCCAGAGCTGTTGAGCAATGGCCAAAGCACTTCTGGGACAGCAGTGCTGCTCTGGCTACCCGTGCAC T GCACAGCTCTGTATGGGCTGCTGCAGGGAAAGTTAACTCCATCCCAGCCAGATGCAGTAGAGTCTGGGATTATTTATCTGTGGATAAATAAAAACGAAATATTATCTGTGGAGTGTTTGCCAAAAACTGAAGTGTTGTCAGGCTTAGTTGGAATCTGAATCCTGGTGCTTGTTAGCACTTGCTGGCAACAACAGTTACAAATTGCTAGAAATTGCCAGCAAGCAATTATACAGCTAAATCTACAATTCTGTGAACCAAGTGTGTTTTG; (SEQ ID NO: 16) Note: The underlined nucleotides in the sequence are single nucleotide polymorphism mutation sites, and the mutation is T to A / T.
[0041] TGATCCATACCCCTGCTTTGATTTGAGATTTTTTCTGCTCCCTTCCTTCTTTTCTCCAGATTTTTCCATGTCCTTTTCAATGATTGAACCCAATTTTCCCTTTGATAATGACCACTATGATTTTTTTCTTACTGATGCTACACTGACAAGCTCCTCCTAAGTTCCCTTCAGGATGGATACTACATACATTTCCCTTTCTTTACCCTCCTTAATCAGCTTTGGCATCCAAGCAGGT T CATACTTGTTTTCTCTTGGGCTCTCTTTCATGGCATCTTTCCCTCTTCTAACCATCGCTATCTCTCCTTCTCCTTTCCCTTTCTTTTCTTCACTTCCAAATCTGCTTCTCATTTCAAGCTCTCCTTCTCAGTTGACCAGCTAGAATTTCAAAATTAGTCTTTCCCAGTCCAATCTCTCCCCAAGTCCTTTCATTCCTGTTTTGTGCATTGAAAAATGCACACAGGAAATTTCTGTGTCCAAAACAGCAT;(SEQ ID NO:17); TGATCCATACCCCTGCTTTGATTTGAGATTTTTTCTGCTCCCTTCCTTCTTTTCTCCAGATTTTTCCATGTCCTTTTCAATGATTGAACCCAATTTTCCCTTTGATAATGACCACTATGATTTTTTTCTTACTGATGCTACACTGACAAGCTCCTCCTAAGTTCCCTTCAGGATGGATACTACATACATTTCCCTTTCTTTACCCTCCTTAATCAGCTTTGGCATCCAAGCAGGT GCATACTTGTTTTCTCTTGGGCTCTCTTTCATGGCATCTTTCCCTCTTCTAACCATCGCTATCTCTCCTTCTCCTTTCCCTTTCTTTTCTTCACTTCCAAATCTGCTTCTCATTTCAAGCTCTCCTTCTCAGTTGACCAGCTAGAATTTCAAAATTAGTCTTTCCCAGTCCAATCTCTCCCCAAGTCCTTTCATTCCTGTTTTGTGCATTGAAAAATGCACACAGGAAATTTCTGTGTCCAAAACAGCAT; (SEQ ID NO: 18); Note: The underlined ones in the sequence are single nucleotide polymorphism mutation sites, and the T is mutated to T / G.
[0042] ACATGAGCCACAGTGCAAGTCATCCTCTGTATCAAGATTGTAGTTTATCTCTCTGTAGTAGTTACAGTGCTGCAGAGTCTTTACTCTGGGAAATTACTCTTTTCTTGGTTGTTTGTAGCCTAGTTACTCACTACCTTTATCCTACATCTTAGAGTCTTTCAAAATAACACAGATAATTTCAGTCTGAACTTACATAACCTCACTTGGTCATTACCTATAATCAAGGTCTATC C TCACAGTATCATTCTGAGAAATTTGCACACATTGAATACGAAATGCTACCTGGGACGTGTCTCCCCAGTTGCTACTGATGAGAGGACCTCTAGTTCAAGTAACAGGAAAAAACAGCTTTTCTGAGTCATGGCCTGAGTTCCCAGAGTGACTGAGGTCTTACAGTGGGCAGATCTAAAGGAAAAGTTGGGACAGCTTTGTGTTCTATGGGGTGTCTGCATTAGAGCAAGAAGGTTAGAAAAGGTAGCTCCTAT; (SEQ ID NO: 19); ACATGAGCCACAGTGCAAGTCATCCTCTGTATCAAGATTGTAGTTTATCTCTCTGTAGTAGTTACAGTGCTGCAGAGTCTTTACTCTGGGAAATTACTCTTTTCTTGGTTGTTTGTAGCCTAGTTACTCACTACCTTTATCCTACATCTTAGAGTCTTTCAAAATAACACAGATAATTTCAGTCTGAACTTACATAACCTCACTTGGTCATTACCTATAATCAAGGTCTATC T TCACAGTATCATTCTGAGAAATTTGCACACATTGAATACGAAATGCTACCTGGGACGTGTCTCCCCAGTTGCTACTGATGAGAGGACCTCTAGTTCAAGTAACAGGAAAAAACAGCTTTTCTGAGTCATGGCCTGAGTTCCCAGAGTGACTGAGGTCTTACAGTGGGCAGATCTAAAGGAAAAGTTGGGACAGCTTTGTGTTCTATGGGGTGTCTGCATTAGAGCAAGAAGGTTAGAAAAGGTAGCTCCTAT; (SEQ ID NO: 20) Note: Underlined sequences are single nucleotide polymorphism mutation sites, and C indicates a C / T mutation.
[0043] After sequencing the PCR amplification products of the ducks to be tested, the genotype is determined and compared with the genotype corresponding to the selected SNP combination. Based on Bayes' theorem, the probability that the individual belongs to the Yulin Black Duck is determined. The calculation formula is as follows:
[0044] The probability that this individual belongs to a non-Yulin Black Duck breed is:
[0045] Where pi represents the frequency of the genotype corresponding to the Yulin Black Duck breed in the i-th SNP of the SNP combination, and qi represents the average frequency of the genotypes corresponding to the other duck breeds in the i-th SNP of the SNP combination. Considering the genotyping error rate and the extreme case where the product of frequencies is 0 when the genotype frequency is 0, the frequencies of genotypes less than 0.05 are uniformly adjusted to 0.05, and the maximum genotype frequency is adjusted to ensure that the sum of the frequencies of the three genotypes is 1.
[0046] Based on the calculation results, to ensure accuracy, a threshold of 0.95 is used. If the probability of belonging to Yulin Black Duck is greater than or equal to 0.95, it is determined to be Yulin Black Duck; if the probability of belonging to non-Yulin Black Duck is greater than or equal to 0.95, it is determined to be non-Yulin Black Duck; if it is less than 0.95, it can only be determined as one possibility. For example, if the probability of belonging to Yulin Black Duck is 0.85, it is considered that there is only an 85% possibility that it belongs to Yulin Black Duck.
[0047] In previous studies, the different allele frequencies at each locus were determined for 24 duck breeds, including Yulin Black Duck, Longsheng Green Duck, Jingxi Hemp Duck, Donglan Duck, Rongshui Fragrant Duck, Beijing Duck, Shaoxing Duck, and Gaoyou Duck. The genotypes, gene frequencies, and corrected genotype frequencies of five SNP loci in each duck breed were also determined, as shown in Table 6. Table 6. Genotypes and gene frequencies of five SNP loci in Yulin Black Duck and other breeds.
[0048] The probability of an individual belonging to the Yulin Black Duck breed can then be determined using the above calculation formula. For example, if we select the five SNP loci from SNP1 to SNP5, and the combined genotype is TT, CC, TT, GG, TT, then the probability of this individual belonging to the Yulin Black Duck breed is...
[0049] The probability that this individual belongs to a non-Yulin Black Duck breed is:
[0050] Example 2 Application verification of identification methods Ten Yulin Black Ducks and ten other ducks (Donglan Duck, Putian Black Duck, Rongshui Fragrant Duck, Longsheng Green Duck, Wendeng Duck, Jingxi Hemp Duck, Xilin Hemp Duck, and Yulin Black Duck) were randomly selected. Blood was collected from the wing veins, and genomic DNA was extracted using the phenol-chloroform method. PCR amplification was performed using primers for the five SNP sites in Table 3 of Example 1.
[0051] The final concentration of the reaction system (25 μl) is: 50 ng of duck DNA to be tested 2 x Accurate Taq Master Mix 12.5μl 1 μl of upstream primer 1 μl of downstream primer Sterilized water replenished to 25 μl The PCR program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min.
[0052] Based on the sequencing results, and following Table 6 of Example 1 and the calculation formula using Bayes' theorem, the probability of a duck belonging to the Yulin Black Duck breed was determined by combining the genotype of five SNP loci. A threshold of 0.95 was used; ducks with a probability greater than or equal to 0.95 were identified as Yulin Black Ducks. The results showed that all 10 Yulin Black Ducks were correctly identified. Similarly, ducks with a probability greater than or equal to 0.95 were identified as non-Yulin Black Ducks, and all 10 non-Yulin Black Ducks were correctly identified. The results are shown in Table 7. This confirms that the identification method is accurate and reliable, and can effectively determine the breed of Yulin Black Duck.
[0053] Table 7. Probability results of determining the genotype of Yulin Black Duck using five SNP loci combined.
[0054] In addition to the above-described embodiments, the present invention may have other implementations. All technical solutions formed by equivalent substitution or equivalent transformation fall within the protection scope claimed by the present invention.
Claims
1. A primer set of SNP molecular markers for identifying the Yulin Black Duck breed, characterized in that: The SNP molecular marker set is located at the duck reference genome version GCF_047663525.1, and includes the following 5 SNP molecular markers. SNP1 is located at position 51148602 on chromosome 4. The mutation type is G / T, and the genotype is GG, GT, or TT. The nucleotide sequences of the SNP1 primers are shown in SEQ ID NO:1 and SEQ ID NO:
2. SNP2 is located at position 51648174 on chromosome 4. The mutation type is T / C, and the genotype is TT, TC, or CC. The nucleotide sequences of the SNP2 primers are shown in SEQ ID NO:3 and SEQ ID NO:
4. SNP3 is located at position 24672692 on chromosome 9. The mutation type is A / T, and the genotype is AA, AT, or TT. The nucleotide sequences of the SNP3 primers are shown in SEQ ID NO:5 and SEQ ID NO:
6. SNP4 is located at position 12572031 on chromosome 14. The mutation type is T / G, and the genotype is TT, TG, or GG. The nucleotide sequences of the SNP4 primers are shown in SEQ ID NO:7 and SEQ ID NO:
8. SNP5 is located at position 5919153 on chromosome 16, with a mutation type of C / T and a genotype of CC, CT, or TT. The nucleotide sequences of the SNP5 primers are shown in SEQ ID NO:9 and SEQ ID NO:
10.
2. The application of the SNP molecular marker combination for identifying Yulin Black Duck breeds according to claim 1, characterized in that: The molecular marker primer combination was used to identify the Yulin Black Duck breed. The detection method included the following steps: Step 1: The duck DNA sample to be tested was subjected to PCR amplification using the molecular marker primers shown in SEQ ID NO:1-10 to obtain the amplification product combination. The amplification product contains a gene fragment combination of 5 SNP sites of the duck reference genome version GCF_047663525.
1. The second step is to perform Sanger sequencing on the amplified product combination. The third step is to determine the genotype of each SNP site in the gene fragment combination of the five SNP sites in the duck reference genome version GCF_047663525.1 based on the sequencing results of the second step.
3. The application of the SNP molecular marker combination for identifying Yulin Black Duck breeds according to claim 2, characterized in that: The PCR reaction system is in 25 μl increments, and the system is as follows: 50 ng of duck DNA to be tested 2 x Accurate Taq Master Mix 12.5μl 1 μl of upstream primer 1 μl of downstream primer Add sterile water to a final volume of 25 μl; The PCR amplification reaction conditions are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 30 cycles; 72℃ extension for 2 min; the nucleotide sequences of the amplification products are shown in SEQ ID NO:11 - SEQ ID NO:
20.
4. The application of the SNP molecular marker combination for identifying Yulin Black Duck breeds according to claim 2, characterized in that: In the third step, the probability of identifying the duck as a Yulin Black Duck breed based on the genotype determination result is calculated using the following formula: , Where, p i q represents the frequency of the genotype corresponding to the Yulin Black Duck breed in the i-th SNP of the SNP combination. i p represents the frequency of the corresponding genotypes of other duck breeds in the i-th SNP combination. i and q i The frequency values are derived from the table below. When the probability score is greater than or equal to 0.95, the duck to be tested is determined to be of the Yulin Black Duck breed.