Molecular marker primer group for identifying content of tannin in corn kernels and application of molecular marker primer group
By developing a molecular marker primer set for identifying tannin content in maize kernels, and using KASP technology for PCR identification with SNP site 1_204244283, the problem of high cost and low efficiency in maize tannin breeding was solved, enabling early screening of high-tannin varieties, reducing breeding costs and improving efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-29
- Publication Date
- 2026-03-27
AI Technical Summary
Existing technologies have failed to effectively integrate the complete chain of "trait genetic analysis - high-throughput SNP typing - efficient breeding selection", resulting in high costs and low efficiency in breeding maize tannin content.
A molecular marker primer set was developed for identifying tannin content in maize kernels. KASP technology was used to perform PCR identification with SNP locus 1_204244283. Genotype A/A indicates low tannin and T/T indicates high tannin, enabling early screening of high-tannin maize varieties.
This enabled early identification and screening of high-tannin maize varieties, saving production costs and improving breeding efficiency.
Smart Images

Figure CN121737339A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetics and breeding, and in particular to a primer set for molecular markers used to identify the tannin content in maize kernels and its application. Background Technology
[0002] Tannins are the second most abundant polyphenol in the plant kingdom after lignin, possessing antioxidant properties, the ability to chelate metal ions, and resistance to pests and diseases. Tannins are rich in phenolic hydroxyl groups, which are effective against superoxide anion free radicals (O2-). ), hydroxyl radicals ( Tannins have significant scavenging effects on free radicals such as OH, 1,1-diphenyl-2-picrylhydrazyl (DPPH), and can also bind to toxic proteins in cells, thus giving tannins antioxidant and antibacterial functions.
[0003] The biological functions of tannins, including their antioxidant and free radical scavenging, antimutagenic or antigenic toxicity, antibacterial, metabolic, or immunomodulatory properties, are closely related to their chemical structure and degree of polymerization. Tannins have a high affinity for proteins, and relatively high tannin concentrations may lead to potential gastrointestinal problems, potentially resulting in the inhibition of digestive enzymes. Therefore, the protein-binding properties of tannins may interfere with the absorption of nutrients such as proteins, carbohydrates, and metals. However, the ability of tannins to bind gluten could serve as a potential treatment for celiac disease. Dias et al. revealed that tannins may have a potential role in regulating some molecular processes associated with celiac disease. In their in vitro transwell cell experiments with Caco-2, they found that epigallocatechin-3-gallate reduced the translocation of immune-responsive peptides involved in the pathogenesis of celiac disease across the mimicked intestinal epithelial barrier. Furthermore, in vitro studies have shown that proanthocyanidin B3, proanthocyanidin trimers, proanthocyanidin tetramers, and oligomeric mixtures of high molecular weight proanthocyanidins can bind to wheat gliadin.
[0004] Researchers have pointed out that tannins can be added to feed as a substitute for antibiotics, but they are more expensive. Therefore, some researchers have turned their attention to plants rich in tannins to explore their potential as feed ingredients.
[0005] However, in the field of maize tannin content breeding, there is still a technological gap in developing a dedicated SNP marker and detection system by associating KASP technology with identified and re-validated key QTLs / genes related to tannin content. Existing technologies have failed to effectively integrate the complete chain of "trait genetic analysis - high-throughput SNP genotyping - efficient breeding selection". Summary of the Invention
[0006] To address the aforementioned technical problems, this invention provides a primer set for molecular markers used to identify the tannin content in maize kernels and its application.
[0007] To achieve the above objectives, the present invention is implemented according to the following technical solution: One objective of this invention is to provide a primer set for molecular markers used to identify tannin content in maize kernels, the primer set comprising: Primer_X:ATTAGCATCCCTGATTTTTTCTATACATATTA; Primer_Y: ATTAGCATCCCTGATTTTTTCTATACATATTT; Primer_C:CACAAGAAGAGATGCAATTGATACAACTTA; The molecular marker is SNP site 1_204244283, which is located at 204244283 bp on chromosome 1 of the maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0 and is an A / T mutation. The sequences of 50 bp before and after SNP site 1_204244283 are shown in SEQ ID NO.1.
[0008] The second objective of this invention is to provide an application of the above-mentioned primer set in assisted selection breeding for identifying tannin content in maize kernels, comprising the following steps: S1. Genomic DNA was extracted from the young leaves of the corn to be identified, and PCR identification was performed using a primer set of molecular markers for identifying the tannin content of corn kernels. S2. If the genotype of SNP locus 1_204244283 is A / A, the tannin content of the maize kernels to be identified is low; if the genotype of SNP locus 1_204244283 is T / T, the tannin content of the maize kernels to be identified is high.
[0009] Further, in step S1, the real-time PCR reaction system consists of 5 μL DNA, 5 μL 2×KASPMasterMix, and 0.14 μL of a mixture of primers consisting of primer_X, primer_Y, and primer_C in a volume ratio of 1:1:2.5; the PCR reaction program is as follows: 94℃ for 15 min; 94℃ for 20 s, 61-55℃ for 60 s, cooling at a rate of 0.6℃ / cycle for 10 cycles; 94℃ for 20 s, 55℃ for 60 s for 36 cycles.
[0010] Compared with existing technologies, this invention identifies a locus that is significantly associated with the tannin content of maize kernels. This locus is located at 204244283 bp on the first chromosome of maize. When the genotype is T / T, the corresponding maize kernel tannin content is high, and when the genotype is A / A, the tannin content is low. This molecular marker can be used to identify and screen maize varieties with high tannin content at an early stage, thereby greatly saving production costs and improving production efficiency. Attached Figure Description
[0011] Figure 1 Frequency distribution of tannin content in maize kernels from inbred line populations.
[0012] Figure 2 This is a Manhattan plot of tannin content in corn kernels obtained using the MLM method in TASSEL software.
[0013] Figure 3 This is a schematic diagram for analyzing the superior haplotype effect.
[0014] Figure 4 A schematic diagram illustrating the development and utilization of the optimal haplotype functional marker for 1_204244283. Detailed Implementation
[0015] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.
[0016] Example 1: Identification of SNP sites significantly associated with tannin content in maize kernels 1. Materials A total of 567 backbone inbred lines from maize producing areas in Southwest China and the Huang-Huai-Hai Plain were collected. A population of superior germplasm with different characteristics was established. The whole genome was resequencing at a depth of 20X based on the DNBSEQ-T7 / PE150 sequencing platform, and 13.2 million high-quality SNP markers were obtained.
[0017] 2 Experimental Methods 2.1 Determination of tannin content in corn kernels Several maize inbred lines harvested in Gucheng, Hubei Province, were randomly selected, dried using a dryer, and then pulverized using a grinder. 1g of sample was accurately weighed into a centrifuge tube. 10mL of dimethyl methylamine solution was pipetted into the centrifuge tube containing the sample. The tube was sealed tightly and stirred for 60 min. Then, it was centrifuged at 3000g for 10 min. 1mL of the supernatant was pipetted into a test tube, and 6mL of water and 1mL of ammonia solution were added, followed by shaking for a few seconds. 1mL of the supernatant was pipetted into another test tube, and 5mL of water and 1mL of ferric ammonium citrate solution were added, followed by shaking for a few seconds. Then, 1mL of ammonia solution was added, and the tube was shaken again for a few seconds. The solutions from both test tubes were poured into cuvettes, with water as a blank control. The absorbance was measured at 525nm using a spectrophotometer. A standard curve was constructed using the same method. Frequency distribution of tannin content in maize kernels from inbred lines as follows: Figure 1 As shown in Table 1.
[0018] Table 1 Statistical analysis of tannin content in corn kernels ; Depend on Figure 1 As shown in Table 1, the tannin content of maize kernels in the inbred line population of Gucheng, Hubei Province, ranged from 0 to 0.86 mg / g with an average of 0.27 mg / g, and the skewness and kurtosis were 0.452 and 0.035, respectively.
[0019] 2.2 Genome-wide association analysis This embodiment uses the mixed linear model (MLM) of TASSEL 5.0 software to perform phenotypic association analysis on Gucheng, Hubei.
[0020] For the raw sequencing data after sequencing, data quality control was performed to obtain high-quality clean data. This clean data was then aligned to a reference genome for variant detection. The reference genome used was AGPv5, downloaded from http: / / plants.ensembl.org / Zea_mays / Info / Index. BWA software was used to align PE reads with the B73 reference genome sequence, obtaining alignment results in AM format. The SAM format file was converted to BAM format using samtools software. Then, the reads in the BAM file were sorted using the SortSam tool in Picard, and PCR duplicates were removed to obtain the final BAM file suitable for variant calling. Finally, the HaplotypeCaller module of GATK was used for variant detection, including SNPs and InDels. Q and K were calculated using STRUCTURE and TESSEL 5.0 software, respectively. After correction, the P-value was set to 1.0 × 10⁻⁶. -5 As a threshold for the significance of GWAS results, significant SNP sites in the GWAS results are named as follows: SNP chromosome number_physical location.
[0021] In 2024, 24 SNP loci were identified in Gucheng, Hubei Province. Of these, 11 were on chromosome 1, 1 on chromosome 3, 3 on chromosome 7, and 9 on chromosome 9. The results are as follows: Figure 2 As shown. Figure 2 As shown, the main SNP sites were located on chromosome 1, and seven closely adjacent SNPs were located within the target region on chromosome 1. To reduce site redundancy in subsequent analyses, we selected a core tagSNP (1_204244283) as the representative of this linkage region for further research, using r²≥0.8 as the criterion.
[0022] This embodiment identifies a locus controlling tannin content in maize kernels based on genome-wide association analysis. This locus is located at 204244283 bp on chromosome 1 (maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0, referred to in this invention as maize B73V5 reference genome), named SNP locus 1_204244283. When the genotype of SNP locus 1_204244283 is T / T, the corresponding maize kernel tannin content is high; when the genotype of SNP locus 1_204244283 is A / A, the tannin content is low.
[0023] For SNP site 1_204244283, 50 bp sequences were extracted from the front and rear of chromosome 1, position 204244283 of the maize B73V5 reference genome: TTATATTTTCATATTTTTTATTAGCATCCCTGATTTTTTCTATACATATT W AGTTGAAATTTTAATTTAAGTTGTATCAATTGCATCTCTTCTTGTGACAT (See SEQ ID NO.1, the underlined W indicates SNP site 1_204244283).
[0024] The KASP marker detection primer sequences obtained according to the primer design principles are shown in Table 2.
[0025] Table 2 Primer Sequences ; Using genomic DNA from a maize inbred line population as a template, quantitative real-time PCR amplification was performed using the primers described above. The quantitative real-time PCR reaction system consisted of 5 μL DNA, 5 μL 2×KASPMasterMix (2×KASP Master Mix is a universal kit from LGC (Laboratory of the Government Chemist), applicable to all KASP experiments, and operated according to the product instructions), and 0.14 μL of a mixture of primers X, Y, and C in a volume ratio of 1:1:2.5. The PCR reaction program was 94℃ for 15 min; 94℃ for 20 s, 61-55℃ for 60 s, cooling at a rate of 0.6℃ / cycle for 10 cycles; 94℃ for 20 s, 55℃ for 60 s for 36 cycles. The FAM and HEX signals were then scanned and the results were output using a qPCR instrument (CFX96 Real-Time PCR Deduction System, BIO-RAD, USA), and finally converted to genotypes.
[0026] like Figure 3As shown, the 567 maize inbred lines were divided into two haplotypes, named Hap1 and Hap2, according to SNP locus 1_204244283. The differences in tannin content in maize kernels between the two haplotypes were then compared. 178 inbred lines had the genotype T / T (or Hap1 allele) at SNP locus 1_204244283, and 372 lines had the genotype A / A (or Hap2 allele). Other heterozygous loci were filtered out. Compared to the Hap2 haplotype, the tannin content of the Hap1 haplotype inbred lines was on average 16% higher (p=0.0009). Therefore, Hap1 is the high-tannin haplotype, accounting for 31%.
[0027] Example 2: Assisted selection breeding for identifying tannin content in maize kernels Genomic DNA was extracted from the young leaves of the maize to be identified, and PCR identification was performed using a primer set of molecular markers for identifying the tannin content of maize kernels (the fluorescence quantitative PCR reaction system and reaction procedure are the same as in Example 1). If the genotype of SNP locus 1_204244283 is A / A, the tannin content of the maize kernels to be identified is low; if the genotype of SNP locus 1_204244283 is T / T, the tannin content of the maize kernels to be identified is high. This molecular marker can be used to identify and screen maize varieties with high tannin content in maize kernels at an early stage.
[0028] Twenty maize inbred lines with tannin content less than 0.3 mg / g and 20 maize inbred lines with tannin content greater than 0.4 mg / g were randomly selected. Three plants from each inbred line were pooled, and DNA was extracted. Genotyping was performed using KASP primers developed from the optimal allele at locus 1_204244283 in Example 1. The results are shown in Figures 3 and 4. Figure 4 As shown.
[0029] Table 3 shows that KASP marker 1_204244283 can be used for tannin content identification and evaluation. ; Note: All inbred lines in Table 3 can be found in the database at https: / / www.ncbi.nlm.nih.gov / .
[0030] From Table 3 and Figure 4 It was found that inbred lines with tannin content less than 0.3 mg / g all belonged to the Hap1 allele, while 20 families with tannin content greater than 0.4 mg / g all belonged to the Hap2 allele. These results confirm that the developed functional markers can be used for molecular marker-assisted selection for genetic improvement of high-tannin lines, providing selection targets for creating new high-tannin maize germplasm and breeding new high-tannin varieties.
[0031] In summary, this invention can identify and screen maize varieties with high tannin content at an early stage by using SNP locus 1_204244283, thereby greatly saving production costs and improving production efficiency.
[0032] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.
Claims
1. A primer set for molecular markers used to identify tannin content in maize kernels, characterized in that, The primer set includes: Primer_X:ATTAGCATCCCTGATTTTTTCTATACATATTA; Primer_Y: ATTAGCATCCCTGATTTTTTCTATACATATTT; Primer_C:CACAAGAAGAGATGCAATTGATACAACTTA; The molecular marker is SNP site 1_204244283, which is located at 204244283 bp on chromosome 1 of the maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0 and is an A / T mutation. The sequences of 50 bp before and after SNP site 1_204244283 are shown in SEQ ID NO.
1.
2. The application of the primer set as described in claim 1 in assisted selection breeding for identifying tannin content in maize kernels, characterized in that, Includes the following steps: S1. Genomic DNA was extracted from the young leaves of the corn to be identified, and PCR identification was performed using a primer set of molecular markers for identifying the tannin content of corn kernels. S2. If the genotype of SNP locus 1_204244283 is A / A, the tannin content of the maize kernels to be identified is low; if the genotype of SNP locus 1_204244283 is T / T, the tannin content of the maize kernels to be identified is high.
3. The application according to claim 2, characterized in that, In step S1, the real-time PCR reaction system consists of 5 μL DNA, 5 μL 2×KASPMasterMix, and 0.14 μL of a mixture of primers (primer_X, primer_Y, and primer_C) in a volume ratio of 1:1:2.
5. The PCR reaction program is as follows: 94℃ for 15 min; 94℃ for 20 s, 61-55℃ for 60 s, cooling at a rate of 0.6℃ / cycle for 10 cycles; 94℃ for 20 s, 55℃ for 60 s for 36 cycles.
Citation Information
Patent Citations
Core SNP sites combination maizeSNP384 for building of maize DNA fingerprint database and molecular identification of varieties
CN104532359A
Application of DNA (deoxyribonucleic acid) sequence for regulating and controlling included angles of corn leaves and mutant, molecular marker and detection primer of DNA sequence
CN111118030A
Primers for identifying molecular markers of sorghum tannin Tan1 allelic variant genes as well as identification method and an application of primers
CN111607660A
Methods for engineering proanthocyanidins (PAS) in plants by affecting MYB transcription factors
WO2018136476A1
Methods and compositions for engineering condensed tannins in maize
WO2025207520A1