Detection platform and method based on CRISPR / Cas12a mediated liposome amplification

Abstract

The invention belongs to the field of biological detection, and particularly relates to a biomarker ultra-sensitive detection platform and a biomarker ultra-sensitive detection method. The detection product comprises a signal probe and an activatable sensor; the signal probe is a'magnetic bead-DNA-lipidosome 'compound formed by coupling a magnetic bead with a lipidosome wrapped with a mass label through a single-stranded DNA connecting arm; the activatable sensor is a locking compound formed by complementary hybridization of a specific recognition element aiming at a target object to be detected and a Cas12a activation chain. The sensor is in a locked state when no target exists, and a free activation chain is released only after the sensor encounters a target object to be detected, so that trans-cleavage of Cas12a to ssDNA in the signal probe is activated. By utilizing a'two-stage 'signal amplification strategy of enzymatic reaction and liposome load release, the problems of low ionization efficiency and complex matrix interference of biomacromolecules in ESI-MS are solved, and high-sensitivity, high-specificity and wide-linear-range detection of low-abundance biomarkers in complex biological samples is realized.

Description

Technical Field

[0001] This invention belongs to the field of biological detection, specifically relating to a detection platform and method based on CRISPR / Cas12a-mediated liposome amplification. Background Technology

[0002] Cardiac troponin I (cTnI) is the gold standard biomarker for the diagnosis of acute myocardial infarction (AMI), and its ultrasensitive quantification is crucial for early diagnosis. Electrospray ionization mass spectrometry (ESI-MS) has advantages such as high sensitivity, low sample consumption, and fast detection speed, and is widely used in biomedical analysis. Meanwhile, CRISPR / Cas systems (especially Cas12a) have become powerful tools in the field of molecular diagnostics due to their high specificity and trans-cleavage activity.

[0003] However, current detection methods still have significant shortcomings, including: when performing direct ESI-MS detection, large protein molecules experience strong ionization inhibition during electrospray scattering, and serum matrix interference is significant, making it difficult to detect low-abundance proteins at the fg / mL level, thus the detection sensitivity often fails to meet clinical requirements. Conventional CRISPR / Cas12a detection is mainly based on fluorescence or colorimetric readout, largely relying on optical signals and easily affected by background fluorescence interference; it also typically requires a nucleic acid amplification step, increasing operational complexity and the risk of false positives. Therefore, existing technologies suffer from insufficient sensitivity, high cost, low efficiency, and long processing times, limiting their practical application.

[0004] Therefore, providing a product and method for detecting cardiac troponin I with high specificity and high sensitivity would have significant research and application value. Summary of the Invention

[0005] The purpose of this invention is to provide a detection platform and method based on CRISPR / Cas12a-mediated liposome amplification.

[0006] To achieve the aforementioned objectives, the technical solution adopted by this invention is: a detection product for detecting biomarkers (e.g., cTnI), comprising a signal probe and an activatable sensor; the signal probe is a ternary complex structure formed by coupling streptavidin magnetic beads with liposomes encapsulating mass spectrometry tags (e.g., crystal violet) via single-stranded DNA (ssDNA); wherein the liposomes serve as a signal amplification carrier, internally encapsulating signal molecules (e.g., mass tags such as crystal violet) with high response characteristics in detection modes (e.g., mass spectrometry detection); the activatable sensor is a locking complex formed by complementary hybridization of a specific recognition element (nucleic acid aptamer) targeting the biomarker (e.g., cTnI) with a Cas12a activation chain. In the absence of a target, the Cas12a activation chain is in a locked, inactive state; only when the specific recognition element specifically binds to the biomarker is the Cas12a activation chain released, thereby activating the trans-cleavage activity of the Cas12a nuclease.

[0007] The liposomes of the signal probe use phosphatidylcholine, cholesterol, polyethylene glycol-modified phospholipids, and functionalized phospholipids as membrane materials. A mass spectrometry mass tag is encapsulated within the membrane material, and then immobilized on the surface of streptavidin magnetic beads using single-stranded DNA. Preferably, the phosphatidylcholine is 1,2-dipalmitoyl-sn-glycerol-3-phosphate choline (DPPC); the polyethylene glycol-modified phospholipid is 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine-N-[methoxy(polyethylene glycol)-2000] (DSPE-PEG2k); and the functionalized phospholipid is 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine-N-[maleimide(polyethylene glycol)-2000] ammonium salt (DSPE-PEG2k-Mal). More preferably, the molar ratio of 1,2-dipalmitoyl-sn-glycerol-3-phosphate choline, cholesterol, 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine-N-[methoxy(polyethylene glycol)-2000] and 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine-N-[maleimide(polyethylene glycol)-2000] ammonium salt is (35-45):(45-55):(1-3):(1-3). The membrane material contains a high concentration of mass spectrometry mass tags, which are immobilized on the surface of magnetic beads via the ssDNA, forming a "magnetic bead-DNA-liposome" structure.

[0008] According to a preferred embodiment, the activatable sensor is assembled by hybridization of specific recognition elements (such as aptamer-1, aptamer-2) with the activation chain of Cas12a; wherein each sequence is designed to ensure a stable locking structure in the absence of a target, and to undergo a conformational change to release the activation chain in the presence of a target.

[0009] Accordingly, the present invention also provides a method for preparing the detection product, the method comprising the following steps: (1) preparing a signal probe: mixing liposome membrane materials in a suitable proportion, and preparing liposomes with uniform particle size and encapsulating signal molecules by thin film hydration and extrusion process; subsequently, coupling activated single-stranded DNA with the liposomes, and then fixing it on the surface of magnetic beads modified with streptavidin, and obtaining the signal probe after washing to remove non-specific adsorbed components. (2) preparing an activatable sensor: mixing a specific recognition element with a Cas12a activation chain in a specific molar ratio, and forming a stable locking complex by base complementarity pairing between the chains through an annealing process.

[0010] Accordingly, the present invention also provides a method for detecting biomarkers (such as cTnI) using the detection product. The method includes the following steps: (1) Complex assembly: Cas12a protein and crRNA are mixed and incubated to assemble a potentially active Cas12a / crRNA complex; (2) System construction: A reaction system containing a signal probe, an activatable sensor, a Cas12a / crRNA complex and necessary buffer components is constructed; (3) Target response and cleavage: The sample to be tested is added to the system. If the target analyte is present in the sample, it will induce the activatable sensor to release the activation chain, thereby activating the trans-cleavage activity of the Cas12a / crRNA complex and cleaving the DNA linker arm on the signal probe; (4) Signal release and detection: Unreacted probes are removed by magnetic separation (or the released supernatant is collected), and the liposome structure is destroyed by solvent to release the massive signal molecules encapsulated inside. Finally, the signal molecules are quantitatively analyzed by electrospray ionization mass spectrometry (ESI-MS) or other suitable detection methods; (5) Quantitative analysis: The signal intensity ratio of the signal molecules to the internal standard is monitored, and the concentration of the target analyte in the sample to be tested is calculated according to the standard curve.

[0011] The present invention has the following beneficial effects:

[0012] This invention constructs an innovative "dual-cascade signal amplification" mechanism, achieving ultrasensitive detection without nucleic acid amplification. Specifically, this invention organically combines the highly efficient enzymatic catalytic ability of CRISPR / Cas12a with the physical loading capacity of liposomes; the first-stage amplification utilizes the trans-cleavage activity of activated Cas12a to achieve enzymatic amplification by "one activating molecule cleaving multiple linkers"; the second-stage amplification utilizes liposome nanocarriers to achieve physical amplification by "one liposome releasing tens of thousands of signal molecules". This dual mechanism overcomes the limitations of insufficient sensitivity in traditional methods, enabling the detection of low-abundance proteins without complex nucleic acid pre-amplification.

[0013] This invention pioneers a CMLA-MS detection architecture, opening up a new pathway for biomarker detection. It is the first to combine the biorecognition and cleavage capabilities of the CRISPR / Cas12a system with the release of liposome mass tags and the high-sensitivity readout of electrospray ionization mass spectrometry (ESI-MS) (CMLA-MS). This architecture is specifically designed for biomarkers (such as proteins), solving the problems of low ionization efficiency and significant matrix interference encountered in traditional mass spectrometry for direct protein detection.

[0014] This invention designs a modular, universal signal probe with significant potential for platform versatility. The universally applicable signal probe (CV@liposome-ssDNA-MB) features modularity: for different detection targets (such as other disease biomarker proteins), only the specific recognition element (such as the nucleic acid aptamer) needs to be replaced, allowing direct reuse of the signal probe and subsequent mass spectrometry detection process without the need for resynthesizing mass tags or re-optimizing mass spectrometry conditions. Although this invention has been validated using cTnI as a model, this universal design concept provides a new technical approach for constructing a broad-spectrum biomarker detection platform.

[0015] The detection platform and method provided by this invention possess excellent anti-interference capabilities and detection accuracy. This invention fully utilizes the high resolution of triple quadrupole mass spectrometry multiple reaction monitoring (MRM) mode and combines it with the extremely high sequence specificity of the CRISPR system. This dual specificity guarantee mechanism effectively eliminates matrix interference in complex biological samples (such as serum), achieving quantitative analysis with high recovery and high accuracy.

[0016] In summary, this invention provides a novel product (platform) and method for detecting biomarkers, which can detect biomarkers with high sensitivity and high specificity. Attached Figure Description

[0017] Figure 1 This is a schematic diagram of the detection platform provided by the present invention;

[0018] Figure 2 This is a schematic diagram illustrating the effect of ssDNA dosage on the signal-to-noise ratio.

[0019] Figure 3 A schematic diagram illustrating the effect of the relationship between aptamer and activator dosage on signal-to-noise ratio;

[0020] Figure 4 This is a schematic diagram illustrating the detection sensitivity of the method of the present invention;

[0021] Figure 5 This is a schematic diagram illustrating the detection specificity of the method of the present invention;

[0022] Figure 6 This is a schematic diagram illustrating the impact of the buffer system on the detection results. Detailed Implementation

[0023] This invention provides a detection platform based on CRISPR / Cas12a-mediated liposome amplification combined with electrospray mass spectrometry (CMLA-MS).

[0024] The overall principle of the detection platform is as follows: Figure 1 As shown, this platform cleverly integrates the high specificity of the CRISPR / Cas system with the high capacity loading of liposomes to construct a dual-cascade signal amplification strategy of "enzymology-physics":

[0025] The detection platform mainly consists of two core components: a signal probe and an activatable sensor. The signal probe is designed as a ternary complex structure of "magnetic beads-single-stranded DNA linker-liposomes carrying signal molecules." The liposomes, acting as nanocarriers of the signal molecules, preferably contain components such as phosphatidylcholine, cholesterol, and polyethylene glycol-modified phospholipids in a specific molar ratio to ensure the stability and biocompatibility of the liposomes. The liposomes encapsulate a high concentration of mass spectrometry signal molecules, preferably compounds with high response characteristics in electrospray ionization mass spectrometry (ESI-MS), such as crystal violet (CV) or rhodamine-like, acridine-like, or other small molecule dyes with easily ionized groups. The activatable sensor is designed based on the allosteric regulation mechanism of the CRISPR / Cas12a system. Specifically, it is a locked complex formed by a specific recognition element (such as a nucleic acid aptamer) targeting the biomarker (such as cardiac troponin I, cTnI) and the Cas12a activation chain through base complementary pairing. In the absence of the target, the activation chain is firmly locked and cannot activate Cas12a; when the target is present, the specific recognition element binds to the target with high affinity, inducing a conformational change in the complex, thereby releasing the activation chain and activating the trans-cleavage activity of Cas12a.

[0026] This invention also provides a method for preparing the aforementioned detection platform and a detection procedure. This method utilizes the highly efficient trans-cleavage of single-stranded DNA (ssDNA) by activated Cas12a to cleave the linker arms in the signal probe, causing liposomes loaded with signal molecules to detach from the surface of magnetic beads. Subsequently, the release of a large number of signal molecules by destroying the liposomes allows for quantitative analysis using multiple reaction monitoring (MRM) mode of triple quadrupole mass spectrometry. This method achieves high sensitivity and high specificity detection of low-abundance protein biomarkers without requiring complex nucleic acid pre-amplification steps.

[0027] The detection platform provided by this invention specifically includes a signal probe and an activatable sensor. The optional dosage relationship is: 5–20 μg of signal probe and 2–10 pmol of activatable sensor; the preferred dosage is: 1 μg of signal probe and 2.4 pmol of activatable sensor. The signal probe is a sandwich structure composed of magnetic beads, ssDNA, and liposomes (containing CV). Specifically, the liposomes use DPPC (1,2-dipalmitoyl-sn-glycerol-3-phosphocholine), cholesterol, DSPE-PEG2k (1,2-distearyl-sn-glycerol-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]), and DSPE-PEG2k-Mal (1,2-distearyl-sn-glycerol-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)-2000]ammonium salt) as membrane materials, with a molar ratio of (35-45):(45-55):(1-3):(1-3); preferably, the molar ratio is 40:50:2:2. High concentrations of crystal violet (CV) are encapsulated using a thin-film hydration method as a mass spectrometry mass label. CV exhibits extremely high response in ESI-MS (m / z 372.4→356.1).

[0028] The sensor is an activatable sensor that can be activated by cTnI, specifically obtained by hybridizing cTnI-targeting aptamers (aptamer-1, aptamer-2) with the activation strand of Cas12a. After the sensor is fabricated, the activation strand is locked and cannot autonomously activate Cas12a.

[0029] The present invention also provides a method for preparing the detection platform, comprising the following steps:

[0030] 1. Preparation of signal probes

[0031] (1) Preparation of liposomes encapsulating mass spectrometry mass tags, such as crystal violet.

[0032] 1) Dissolve DPPC, cholesterol, DSPE-PEG2k, and DSPE-PEG2k-Mal in 1 mL of chloroform. Remove the organic solvent by rotary evaporation at 40℃~50℃ to form a uniform lipid film.

[0033] 2) Add 5 mL of a deionized aqueous solution containing 4 mM crystal violet (CV) to the lipid membrane, hydrate and incubate at 50℃–60℃ for 30–60 min, followed by sonication. Extrude the resulting mixture through a polycarbonate membrane to obtain a uniformly sized liposome solution coated with crystal violet. Store at 4℃ for later use. Stepwise extrusion through a polycarbonate membrane avoids clogging of small-pore membranes and ensures uniform liposome size, facilitating subsequent modification and signal release.

[0034] (2) Preparation of signal probes

[0035] The preparation process involves "thiol-maleimide" click chemistry and "biotin-streptavidin" interaction, specifically including:

[0036] 1) DNA activation: Take double-modified ssDNA (5' end modified with biotin, 3' end modified with thiol group; custom-synthesized by a biotechnology company such as Sangon Biotech (Shanghai) Co., Ltd.), add 10 times molar excess of TCEP (tris(2-chloroethyl) phosphate, dissolved in 10mM Tris-HCl, pH=7.4), and reduce at room temperature to open disulfide bonds.

[0037] 2) Liposome Coupling: TCEP-treated ssDNA was mixed with 900 μL of liposome solution containing a mass spectrometry mass tag, such as crystal violet, and incubated overnight. This allowed the thiol groups on the ssDNA to covalently couple with the maleimide groups on the liposome surface, forming a ternary complex structure of "magnetic beads - single-stranded DNA linker - liposome loaded with signal molecule". Unbound ssDNA was then removed by centrifugation (8000 rpm, 10 min, 4 °C), and the precipitate was resuspended in 400 μL of binding buffer (10 mM Tris-HCl, 0.05% Tween-20, 2 M NaCl, pH = 7.4).

[0038] 3) Magnetic bead immobilization: Take 50 μL of streptavidin magnetic beads, wash three times with binding buffer, and resuspend. Add the ternary complex prepared above and incubate at room temperature.

[0039] (4) After incubation, the magnetic beads were washed three times with binding buffer to remove non-specifically adsorbed liposomes, and then the ternary complex was resuspended in 100 μL of DEPC-treated water for storage.

[0040] 2. Fabrication of Activatable Aptamer Sensors

[0041] Preparation of the mixture: Take 10 μL of aptamer-1 with a concentration of 5 μM and 10 μL of aptamer-2 with a concentration of 5 μM, and mix them with 10 μL of activator chain with a concentration of 2.5 μM.

[0042] Annealing procedure: The mixture is heated to 95°C and held for 10 minutes, then slowly cooled to room temperature, allowing the three chains to form a stable "locked" structure through base complementarity pairing. In this structure, the activating chain is hybridized and locked by the aptamer chain, thus preventing the activation of Cas12a.

[0043] The present invention also provides a method for detecting cardiac troponin I (cTnI) using the aforementioned detection platform, specifically comprising the following steps:

[0044] 1. Assembly of the Cas12a / crRNA complex: Cas12a protein and crRNA were mixed in 1×HOLMES buffer at a molar ratio of 1:1.5 and incubated at 35℃~39℃ for 10 min to assemble the Cas12a-crRNA ribonucleoprotein complex (Cas12a / crRNA complex). The Cas12a / crRNA complex is the core cleavage element and a key member of the detection system; once the released activation strand binds, its trans-cleavage activity is activated, thereby cleaving the signal probe.

[0045] 2. Construction of the detection reaction system: Add the following to the reaction tube in sequence: 5-20 μg signal probe, 2-10 pmol activatable aptamer sensor, 2 μL assembled Cas12a / crRNA complex, 1 μL RNase inhibitor (to prevent RNA degradation; purchased from Shanghai Beyotime Biotechnology Co., Ltd., product number: R0102-2kU), 5 μL 10×HOLMES buffer; and DEPC water to bring the volume to 45 μL.

[0046] 3. Target incubation and cleavage: Add 5 μL of the cTnI sample (or serum sample) to be tested, mix well, and incubate at 35℃~39℃ for 30~60 min. During this process, cTnI induces the release of Activator, which in turn activates the ssDNA linker arm on the Cas12a cleavage signal probe.

[0047] 4. Signal Release: After the reaction, magnetic separation is performed. Since the ssDNA is cleaved, the CV-loaded liposomes are released into the supernatant. Magnetic separation is performed, the supernatant is discarded, the magnetic beads are washed, and 100 μL of electrospray solvent is added to the magnetic beads to destroy any remaining liposomes for mass spectrometry detection.

[0048] Electrospray solvent: Add 0.1% (v / v) formic acid to acetonitrile / water (1:1, v / v), and then add 100 ng / mL rhodamine B as an internal standard (IS).

[0049] 5. Mass spectrometry detection: A QTRAP 5500 triple quadrupole mass spectrometer was used for detection, with the ion source in positive ion electrospray mode (ESI+).

[0050] After detection, the average signal intensity ratio of CV to IS within 0.5 minutes was calculated for quantitative analysis. Specifically, it was calculated based on the linear regression equation fitted from the experimental results: y = -0.1260 × lg(c) + 1.027. Where y is the signal intensity ratio of CV detected by mass spectrometry to the internal standard IS (Ic). CV / I IS c is the concentration of cTnI in the sample (pg / mL). That is, cTnI concentration = 10^((1.027-y) / 0.1260).

[0051] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and the data obtained are all average values ​​obtained after at least three repetitions, and each repetition yields valid data.

[0052] Example 1: Construction and Preparation of the Detection Platform

[0053] 1. Reagents and Materials: The nucleic acid sequences (including aptamers, activation strands, crRNA, etc.) involved in this embodiment were designed and synthesized according to the characteristics of the target analyte. Unless otherwise specified, all chemical reagents used in the experiment were of analytical grade or biochemical grade.

[0054] 2. Nucleic acid sequence: The oligonucleotides were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0055] Aptamer-1:

[0056] CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTTATTGT GT (SEQ ID NO: 1);

[0057] Aptamer-2:

[0058] GTTTCGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCTCTT A (SEQ ID NO: 2);

[0059] Activation chain: ACTGCACGAAACACACAATAAGAGGGGC (SEQ ID NO: 3);

[0060] crRNA:UAAUUUCUACUAAGUGUAGAUCUCUUAUUGUGUGUUUCGUGC (SEQ ID NO: 4);

[0061] ssDNA Linker:Biotin-T75-(CH2)6-SH.

[0062] Due to limitations of the "WIPOSequence" sequence editing software, it cannot recognize "U". Therefore, in the computer-readable carrier sequence list, "U" in "SEQ ID NO: 4" is uniformly changed to "T"; the actual sequence is subject to the description in the instruction manual.

[0063] 3. Preparation of signal probes

[0064] (1) Preparation of liposomes loaded with signal molecules

[0065] DPPC, cholesterol, DSPE-PEG2k, and DSPE-PEG2k-Mal were mixed and dissolved in 1 mL of chloroform at a molar ratio of 40:50:2:2, resulting in a total molar amount of 688 nmol. The organic solvent was removed by rotary evaporation at 45 °C, forming a uniform lipid film.

[0066] Add 5 mL of a deionized aqueous solution containing 4 mM crystal violet to the lipid membrane, hydrate and incubate for 40 min at a temperature higher than the membrane's phase transition temperature, followed by ultrasonic treatment. Repeatedly extrude the resulting mixture through a polycarbonate membrane to obtain a liposome solution with uniform particle size and good dispersibility loaded with signal molecules.

[0067] (2) Signal probe assembly

[0068] The preparation process involves "thiol-maleimide" click chemistry and "biotin-streptavidin" interaction, specifically including:

[0069] DNA activation: Take double-modified ssDNA (5' end modified with biotin, 3' end modified with thiol), add 10 times the molar excess of TCEP (tris(2-chloroethyl) phosphate, dissolved in 10mM Tris-HCl, pH=7.4), and reduce at room temperature to open disulfide bonds.

[0070] Liposome conjugation: TCEP-treated ssDNA was mixed with 900 μL of liposome solution coated with crystal violet and incubated overnight to allow the thiol groups on the ssDNA to covalently couple with the maleimide groups on the liposome surface, forming a ternary complex. Unbound ssDNA was then removed by centrifugation (8000 rpm, 10 min, 4 °C), and the precipitate was resuspended in 400 μL of binding buffer (10 mM Tris-HCl, 0.05% Tween-20, 2 M NaCl, pH 7.4).

[0071] Magnetic bead immobilization: Take 50 μL of streptavidin magnetic beads, wash three times with binding buffer, and resuspend. Add the ternary complex structure prepared above and incubate at room temperature.

[0072] After incubation, the magnetic beads were washed three times with binding buffer to remove non-specifically adsorbed liposomes, and the complex was then resuspended in 100 μL of DEPC-treated water for storage.

[0073] 4. Fabrication of Activatable Aptamer Sensors

[0074] Preparation of the mixture: Take 10 μL of aptamer-1 with a concentration of 5 μM and 10 μL of aptamer-2 with a concentration of 5 μM, and mix them with 10 μL of activator chain with a concentration of 2.5 μM.

[0075] Annealing procedure: The mixture is heated to 95°C and held for 10 minutes, then slowly cooled to room temperature, allowing the three chains to form a stable "locked" structure through base complementarity pairing. In this structure, the activating chain is hybridized and locked by the aptamer chain, thus preventing the activation of Cas12a.

[0076] In addition, the inventors discovered the following during their research:

[0077] (1) Liposomes are large nanoparticles attached to the surface of magnetic beads via ssDNA. If the density of ssDNA in the linker arms is too low, the liposomes cannot be effectively captured; if the density is too high, the steric hindrance of the liposomes will prevent the Cas12a protein from approaching and cleaving the ssDNA, resulting in incomplete signal release and decreased sensitivity. After several attempts, it was found that 0.2 nmol of ssDNA (i.e., the ratio of ssDNA to streptavidin magnetic beads is 0.4 nmol / mg) was the optimal balance point, which ensured both efficient loading of liposomes and sufficient space for Cas12a to exert its trans-cleavage activity, thus achieving the maximum signal-to-noise ratio. Specific results are as follows: Figure 2 As shown.

[0078] (2) In the "lock-activate" system, if the aptamer and the activation chain are not tightly bound, the activation chain will spontaneously leak, resulting in the erroneous activation of Cas12a in the absence of a target (cTnI), leading to extremely high background noise. After extensive preliminary experiments and exploration, the inventors discovered that optimizing the molar ratio of the aptamer to the activation chain can solve this problem; a molar ratio of 2:1 can most effectively lock the activation chain, effectively preventing spontaneous leakage in the absence of a target, while ensuring effective displacement and release when a target is present. Specific results are as follows: Figure 3 As shown.

[0079] Example 2: Demonstration of the detection effect of cardiac troponin I (cTnI)

[0080] 1. Experimental Group 1 (Demonstration of Detection Sensitivity)

[0081] Assembly of Cas12a / crRNA complex: Cas12a protein and crRNA were mixed in 1×HOLMES buffer at a molar ratio of 1:1.5 and incubated at 37°C for 10 min to assemble the Cas12a-crRNA complex.

[0082] Construction of the detection reaction system: Add the following to the reaction tube in sequence: 10 μg signal probe, 5 μL activatable aptamer sensor (2:1), 2 μL assembled Cas12a / crRNA complex, 1 μL RNase inhibitor, 5 μL 10×HOLMES buffer; then add DEPC water to make up the volume to 45 μL.

[0083] Target incubation and cleavage: Add 5 μL of a series of cTnI standard solutions (0 fg / mL to 100 ng / mL), mix well, and incubate at 37°C for 40 min. During this process, cTnI induces the release of the activation chain, which in turn activates the ssDNA linker arm on the Cas12a cleavage signal probe.

[0084] Signal release: After the reaction, magnetic separation was performed. Due to the cleavage of ssDNA, the CV-loaded liposomes were released into the supernatant. Magnetic separation was performed, the supernatant was discarded, the magnetic beads were washed, and 100 μL of electrospray solvent was added to the magnetic beads to destroy any remaining liposomes for mass spectrometry detection. Electrospray solvent: 0.1% (v / v) formic acid was added to acetonitrile / water (1:1, v / v), followed by the addition of 100 ng / mL rhodamine B as an internal standard (IS).

[0085] Detection was performed using a QTRAP 5500 triple quadrupole mass spectrometer with positive ion electrospray ionization (ESI+) as the ion source. After detection, the average signal intensity ratio of CV to IS over 0.5 minutes was calculated for quantitative analysis.

[0086] The results are as follows Figure 4 As shown in the figure. The results show that the signal intensity ratio of CV / IS decreases with increasing cTnI concentration (due to liposome detachment caused by Cas12a cleavage). A good linear relationship is observed in the range of 0.1 pg / mL to 100 ng / mL (R² = 0.99). The limit of detection (LOD): calculated according to the 3σ criterion, is as low as 10.8 fg / mL. This result demonstrates that the "dual cascade amplification" strategy can indeed achieve ultrasensitive detection.

[0087] 2. Experimental Group 2 (Demonstration of Detection Specificity)

[0088] The detection method was the same as that of Experimental Group 1. During the target incubation and shearing steps, 100 ng / mL cTnI standard solution and the same concentrations (100 ng / mL) of IgG, BNP (brain natriuretic peptide), HSA (human serum albumin), CEA (carcinoembryonic antigen), and BSA (bovine serum albumin) were added. A mixed interference group (MIX) was also set up: a mixed solution containing all the above interfering substances and cTnI (each substance was at a final concentration of 100 ng / mL). Each group was detected under the same conditions and methods. The "relative signal intensity" of each treatment was calculated relative to the initial theoretical value of the signal probe (or the maximum response value of the system). The results are as follows: Figure 5 As shown.

[0089] The results showed that when IgG, BNP, HAS, CEA, and BSA were detected individually, the relative signal intensities were all above 80% or even 90%, indicating that these non-target proteins could not induce the release of the activating chain, Cas12a remained in an inactive state, and the liposome signaling probe remained intact, serving as a good negative control. In contrast, when the cTnI group and the mixed group containing cTnI (MIX) were detected, the relative signal intensity decreased significantly (to about 25%). This significant signal difference indicates that only the target cTnI can specifically activate Cas12a and trigger the cleavage and release of the liposome signaling probe.

[0090] The results show that even when multiple high-concentration interfering proteins coexist, the detection platform and method provided by this invention can still accurately identify cTnI, demonstrating extremely high specificity.

[0091] In addition, the inventors discovered in their research that the activity of the Cas12a enzyme depends on a specific ionic environment (such as Mg). 2+ However, certain buffer components can cause liposome instability (spontaneous rupture releasing signals) or inhibit enzyme activity, making the buffer system crucial. After experimenting with various buffer systems, HOLMES buffer was ultimately found to achieve the optimal balance between maintaining liposome integrity (low background) and supporting efficient Cas12a cleavage (high signal), providing the highest signal-to-noise ratio. Specific results are as follows: Figure 6 As shown.

[0092] Example 3: Demonstration of detection results for complex biological samples (serum)

[0093] cTnI at concentrations of 1, 100, and 10000 pg / mL were added to 50-fold diluted healthy human serum as the analytes, and detection was performed according to the method of Experimental Group 1 in Example 2. Reactions were conducted in the presence of 0 ng / mL (blank control) and 100 ng / mL (high-concentration target) cTnI, and the relative signal ratio of CV to internal standard IS was detected by electrospray mass spectrometry. The results are shown in Table 1.

[0094] Table 1. Comparison of Test Results (n=3)

[0095] serum samples Add cTnI (pg / mL) cTnI (pg / mL) was measured. RSD (%) Recovery (%) 1 1 0.90 2.6 90.3 2 100 101.57 1.2 101.6 3 10000 9258.08 9.7 92.6

[0096] The results showed a recovery rate of 90.3%–101.6%. This result is within the generally accepted acceptable range in analytical chemistry (typically 85%–115%), demonstrating that this method can effectively eliminate serum matrix effects and is suitable for the detection of complex clinical samples.

[0097] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Any modifications, alterations, substitutions, or variations made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention shall fall within the protection scope defined by the claims of the present invention.

Claims

1. A testing product, characterized in that: The detection product includes a signal probe and an activatable sensor; the signal probe is a ternary complex formed by coupling streptavidin magnetic beads with liposomes encapsulating mass spectrometry tags via single-stranded DNA; the activatable sensor is a locking complex formed by complementary hybridization of a specific recognition element for the analyte and a Cas12a activation chain, wherein the Cas12a activation chain is released after the specific recognition element specifically binds to the analyte.

2. The test product according to claim 1, characterized in that: The liposomes of the signal probe use phosphatidylcholine, cholesterol, polyethylene glycol-modified phospholipids and functionalized phospholipids as membrane materials, with mass spectrometry quality tags encapsulated inside the membrane materials, and then immobilized on the surface of streptavidin magnetic beads by the single-stranded DNA.

3. The test product according to claim 2, characterized in that: The phosphatidylcholine is 1,2-dipalmitoyl-sn-glycerol-3-phosphocholine; and / or; the PEGylated phospholipid is 1,2-distearyl-sn-glycerol-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]; and / or; the functionalized phospholipid is 1,2-distearyl-sn-glycerol-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)-2000]ammonium salt.

4. The test product according to claim 1, characterized in that: The activatable sensor is obtained by hybridizing a specific recognition element with the Cas12a activation chain; the specific recognition element includes aptamer-1 and aptamer-2. The aptamer-1 sequence is shown in SEQ ID NO: 1; the aptamer-2 sequence is shown in SEQ ID NO: 2; and the activation chain sequence is shown in SEQ ID NO:

3.

5. The method for preparing the test product according to any one of claims 1 to 4, characterized in that: The method includes the following steps: (1) Preparation of signal probe (1-1) Phosphatidylcholine, cholesterol, polyethylene glycol-modified phospholipids and functionalized phospholipids were mixed and dissolved in chloroform, and the organic solvent was removed by rotary evaporation to form a uniform lipid film. (1-2) Add a deionized aqueous solution containing a mass spectrometry mass tag to the lipid membrane, hydrate and incubate, then sonicate, and extrude the resulting mixture through the membrane to obtain a lipid body solution with uniform particle size and encapsulated mass spectrometry mass tag. (1-3) DNA activation: Take a double-modified single-stranded DNA with biotin at the 5' end and thiol at the 3' end, add excess tris(2-chloroethyl) phosphate, and reduce at room temperature; (1-4) Liposome conjugation: Tris(2-chloroethyl) phosphate-treated single-stranded DNA was mixed with the liposome solution containing the mass spectrometry mass tag and incubated overnight to form a ternary complex; then centrifugation was used to remove unbound single-stranded DNA, and the precipitate was resuspended in binding buffer; (1-5) Magnetic bead fixation: Take streptavidin magnetic beads, wash and resuspend them, then add the ternary complex and incubate at room temperature; (1-6) After incubation, wash the magnetic beads to remove non-specifically adsorbed liposomes and obtain the signal probe; (2) Fabrication of an activatable sensor (2-1) Preparation of the mixture: The specific recognition element and the Cas12a activation chain are mixed to obtain the mixture; (2-2) Annealing procedure: Heat the mixture to 90-100°C and hold for 5-15 minutes, then slowly cool it to room temperature so that the three chains form a stable "locked" structure through base complementary pairing, thereby obtaining the activatable sensor.

6. The preparation method according to claim 5, characterized in that: In step (2-1), the molar ratio of the specific recognition element to the Cas12a activation chain is (1.5-2.5):

1.

7. The preparation method according to claim 5, characterized in that: The binding buffer formulation includes Tris-HCl, Tween-20, and NaCl.

8. A method for detecting biomarkers using the detection product according to any one of claims 1 to 4 or the detection product prepared by the preparation method according to any one of claims 5 to 7.

9. The method according to claim 8, characterized in that: The method includes the following steps: (1) Assembly of Cas12a / crRNA complex: Cas12a protein and crRNA were mixed in buffer and incubated to assemble Cas12a / crRNA complex. (2) Construction of the detection reaction system: Add the signal probe, the activatable sensor, the assembled Cas12a / crRNA complex, the RNase inhibitor, and the buffer to the reaction tube in sequence; (3) Target incubation and shearing: Add the sample to be tested, mix well and incubate; (4) Signal release: After the reaction is completed, magnetic separation is performed, the supernatant is discarded, the magnetic beads are washed, the electrospray solvent is added to the magnetic beads, and the mixture is detected by electrospray ionization mass spectrometry. (5) Quantitative analysis: Monitor the signal intensity of the mass spectrometer label and the internal standard, calculate the ratio between the two, and thus calculate the concentration of the target analyte in the sample.

10. The method according to claim 9, characterized in that: The formulation of the electrospray solvent includes: formic acid and rhodamine B added to acetonitrile / water.

Images