HAO1 gene targeting composition and application thereof
By targeting the HAO1 gene using the CRISPR/Cas system and employing a combination of nucleases and guide RNA for gene editing, the problem of long-term inhibition of HAO1 expression was solved, resulting in a reduction in glyoxylate production and oxalate accumulation, and alleviating kidney damage caused by type 1 primary hyperoxaluria.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-30
- Publication Date
- 2026-03-31
AI Technical Summary
Current technologies have not yet provided an effective long-term treatment to inhibit HAO1 expression, which leads to excessive glyoxylate production in patients with type 1 primary hyperoxaluria, resulting in oxalate accumulation and kidney damage.
The CRISPR/Cas system is used to target the HAO1 gene, and gene editing is performed using a combination of nucleases and guide RNA to reduce the production of HAO1 protein. The combination includes nucleases, guide RNA, vectors, lipid nanoparticles, etc., which are used to edit the HAO1 gene and inhibit its expression.
It effectively reduces glyoxylic acid production, lowers urinary oxalate excretion, reduces oxalate accumulation, alleviates kidney damage, and delays or prevents the progression of end-stage renal disease.
Smart Images

Figure BDA0005071131630000231 
Figure BDA0005071131630000331 
Figure BDA0005071131630000341
Abstract
Description
[0001] Cross-references to related applications
[0002] This application claims the benefit and priority of PCT patent application PCT / CN2024 / 092707, filed on May 11, 2024, entitled “A Cas protein, a corresponding gene editing system thereof and its application”, the entire contents of which, including any sequence listings and figures, are incorporated herein by reference in their entirety.
[0003] Regarding electronic sequence lists
[0004] According to WIPO standard ST.26, the symbol “t” is used to represent both T in DNA and U in RNA (the symbol “t” is defined as “thymine in DNA / uracil in RNA (t / u)”). Therefore, in sequence listings prepared according to ST.26, T in any sequence that is RNA should be considered as U. Background Technology
[0005] Primary hyperoxaluria type 1 (PH1) is a hereditary disorder characterized by the accumulation of oxalate. In PH1 cases, mutations are typically found in the enzyme encoded by the AGXT gene: alanine glyoxylate aminotransferase (AGT or AGT1). Normally, AGT converts glyoxylate to glycine in the liver peroxisomes. However, the mutant AGT in PH1 patients is unable to break down glyoxylate, leading to elevated levels of glyoxylate and its metabolite, oxalate. Humans cannot oxidize oxalate, so the high levels of oxalate in PH1 patients cause hyperoxaluria, characterized by abnormally high levels of oxalate in the urine.
[0006] In primary hyperoxaluria type 1 (PH1), excess oxalate binds with calcium, forming calcium oxalate in the kidneys and other organs. This calcium oxalate deposition can lead to widespread calcium oxalate buildup (nephrocalcinosis) or the formation of kidney and bladder stones (urolithiasis), resulting in kidney damage. Common kidney complications in PH1 include hematuria (blood in the urine), urinary tract infections, kidney injury, and end-stage renal disease (ESRD). Over time, the kidneys of patients with PH1 may begin to fail, and blood oxalate levels may rise. Deposition of oxalate in systemic tissues, such as systemic oxalate deposition, can occur due to high blood oxalate levels and can lead to complications in the bones, skin, and eyes.
[0007] Hydroxy acid oxidase 1 (HAO1) converts glycolic acid to glyoxylate. Inhibition of HAO1 in individuals with PH1 blocks glyoxylate formation, and excess glycolic acid is excreted in the urine. The idea of treating PH1 by inhibiting HAO1 is further supported by data indicating asymptomatic glycolic aciduria in human subjects with an aberrant splice variant of HAO1, where increased urinary glycolic acid excretion is not accompanied by significant renal pathology (see Frishberg Y et al., J Med Genet 51(8):526-9(2014)). Therefore, PH1 could be treated by inhibiting HAO1 expression to block glyoxylate production and thus the production of its metabolite oxalate.
[0008] Although the results of short-term suppression of HAO1 expression have shown encouraging preliminary data (see Liebow et al., Journal of American Soc Nephrology, February 2017; 28(2):494-503), there is still a need for treatments that can suppress HAO1 expression in the long term.
[0009] As used herein, the term "treatment" means any administration or application of a therapeutic agent for a disease or condition of a subject, and includes suppressing the disease, preventing its progression, alleviating one or more symptoms of the disease, curing the disease, or preventing the recurrence of one or more symptoms of the disease. For example, treatment for PH1 may include reducing the symptoms of PH1.
[0010] As used herein, the terms “therapeutic reduction in oxalate” or “therapeutic range oxalate level” mean a reduction in urinary oxalate excretion greater than 30% compared to baseline (see Leumann and Hoppe (1999) Nephrol Dial Transplant 14:2556-2558, 2557, column 2), and reaching the therapeutic range oxalate level means a reduction in urinary oxalate from baseline greater than 30%. For example, “normal oxalate level” or “normal oxalate range” can refer to a level between about 80 and about 122 μg oxalate / mg creatine (see Li et al. (2016) Biochim Biophys Acta 1862(2):233-239). In some embodiments, a therapeutic reduction in oxalate is defined as a level below or within 200%, 150%, 125%, 120%, 115%, 110%, 105%, or 100% of the normal level. Summary of the Invention
[0011] In view of the above background, this disclosure provides compositions and methods for targeting the HAO1 gene using a CRISPR / Cas system to reduce HAO1 protein production and reduce glyoxylate production in subjects with PH1.
[0012] In some aspects, this disclosure provides a nuclease comprising an amino acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO. 1.
[0013] In some aspects, this disclosure provides a composition targeting the HAO1 gene for gene editing of the HAO1 gene, said composition comprising:
[0014] (i) The nuclease of this disclosure or the first nucleic acid encoding the nuclease;
[0015] (ii) guide RNA or a second nucleic acid encoding the guide RNA, wherein the guide RNA includes a spacer sequence that is specific to a target sequence within the HAO1 gene.
[0016] In some aspects, this disclosure provides a polynucleotide that encodes the nuclease and / or guide RNA disclosed herein.
[0017] In some aspects, this disclosure provides a vector comprising the polynucleotides of this disclosure. In some embodiments, the vector of this disclosure encodes a guide RNA as disclosed herein. In some embodiments, the vector is a plasmid vector, a recombinant AAV (rAAV) vector, or a recombinant lentiviral vector.
[0018] In some aspects, this disclosure provides a ribonucleoprotein (RNP) comprising the nuclease and guide RNA of this disclosure.
[0019] In some aspects, this disclosure provides a lipid nanoparticle (LNP) comprising the composition of this disclosure.
[0020] In some aspects, this disclosure provides a kit comprising the compositions of this disclosure, the polynucleotides of this disclosure, the vectors of this disclosure, or the ribonucleoproteins (RNPs) of this disclosure.
[0021] In some aspects, this disclosure provides a cell comprising a composition of this disclosure, a nucleic acid of this disclosure, or a vector of this disclosure.
[0022] In some aspects, this disclosure provides a guide RNA comprising
[0023] (i) a spacer sequence specific to a target sequence in the HAO1 gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) located at the 5' end of the target sequence, including a 5'-TTN-3' motif; and
[0024] (ii) Directly repeating sequences;
[0025] Optionally, the target sequence is selected from any one of SEQ ID NO. 6-17;
[0026] Optionally, the spacer subsequence is selected from any one of SEQ ID NO. 31-42;
[0027] Optionally, the guide RNA sequence has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with the sequence of any of SEQ ID NO. 18-29, 43-54.
[0028] In some aspects, this disclosure provides a pharmaceutical composition comprising the composition of this disclosure, the carrier of this disclosure, the ribonucleoprotein (RNP) of this disclosure, the lipid nanoparticles (LNP) of this disclosure, or the cells described in this disclosure; and a pharmaceutically acceptable excipient.
[0029] In some aspects, this disclosure provides a formulation comprising, as in the compositions of this disclosure, the polynucleotides of this disclosure, the carriers of this disclosure, the ribonucleoproteins (RNPs) of this disclosure, the lipid nanoparticles (LNPs) of this disclosure, the pharmaceutical compositions of this disclosure, or the cells described in this disclosure, and pharmaceutically acceptable carriers, diluents, or excipients.
[0030] In another preferred embodiment, the formulation is a liquid formulation.
[0031] In another preferred embodiment, the dosage form of the preparation is an injection.
[0032] In some aspects, this disclosure provides a method for editing the HAO1 gene in cells, the method comprising contacting a host cell with a composition of this disclosure, a polynucleotide of this disclosure, a vector of this disclosure, or a ribonucleoprotein (RNP) of this disclosure to perform gene editing on the HAO1 gene in the host cell.
[0033] In some aspects, this disclosure provides a method for treating hyperoxaluria in a subject, the method comprising administering to a subject in need a composition of this disclosure for editing the HAO1 gene, a polynucleotide of this disclosure, a vector of this disclosure, a ribonucleoprotein (RNP) of this disclosure, a lipid nanoparticle (LNP) of this disclosure, a pharmaceutical composition of this disclosure, or a cell of this disclosure. Attached Figure Description
[0034] Some features and advantages of this disclosure will be understood by referring to the following detailed description and accompanying drawings, which illustrate illustrative embodiments in which the principles of this disclosure can be utilized, and in these drawings:
[0035] Figure 1 The cleavage activity of different CasY7 variants and guide RNAs targeting the HAO1 gene was described.
[0036] Figure 2 The cleavage activities of HAO1-crRNA-1 to 12 mediated by variant C30725 targeting the HAO1 gene were described.
[0037] Figure 3 The spectrum of the PHK09T plasmid is described. Detailed Implementation Plan
[0038] Overview
[0039] General technology
[0040] The techniques and procedures described or cited herein include those generally well understood by those skilled in the art and / or commonly employed using conventional methods, such as the widely used methods described in Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd edition, 2001); Current Protocols in Molecular Biology (Ausubel et al., eds., 2003).
[0041] Technical terms
[0042] Unless otherwise specified, each of the following terms has the meaning relating to it in this section.
[0043] The indefinite article “a” (“a” and “an”) refers to at least one related noun and is used interchangeably with the terms “at least one” and “one or more”. For example, “a module” means at least one module, or one or more modules.
[0044] The conjunctions “or” and “and / or” can be used interchangeably as non-exclusive disjunctive terms. Furthermore, the usage of the terms “including” and other forms such as “include,” “includes,” and “included” is unrestricted.
[0045] The terms “comprising” (and any comprising type, such as “comprise” and “comprises”), “having” (and any having type, such as “have” and “has”), “including” (and any including type, such as “includes” and “include”), or “containing” (and any containing type, such as “contains” and “contain”) used in this disclosure are inclusive or open-ended and do not exclude additional, unextracted elements or method steps. Any embodiment discussed in this specification is intended to be performed using any method or composition of this disclosure, and vice versa.
[0046] As used herein, the term "consistent with..." refers to those elements required for a given embodiment. This term allows for the presence of additional elements that do not substantially affect the basis and novelty of the embodiments disclosed herein or the functional features.
[0047] The term "about" means that a particular value determined by a person skilled in the art is within an acceptable margin of error, with a portion depending on the method of measurement or determination, i.e., limited by the measurement system. When a particular value is specified in an application or claim, unless otherwise stated, it should be assumed that the term "about" means within an acceptable margin of error for that particular value.
[0048] The term "subject" refers to a human, mouse, or non-human primate. Human subjects can be of any age (e.g., infants, children, young adults, or adults) and may have a disease and may actually have genetic alterations.
[0049] The terms “treat,” “treating,” and “treatment” refer to treating a subject’s (e.g., a human subject) disease, including one or more of the following: suppressing the disease, i.e., stopping or preventing its development or progression; alleviating the disease, i.e., causing the disease state to subside; reducing one or more symptoms of the disease; and curing the disease.
[0050] The terms “prevent,” “preventing,” and “prevention” refer to preventing a subject’s disease, including: (a) avoiding or preemptively eliminating the disease; (b) influencing the tendency toward the disease; or (c) preventing or delaying the onset of at least one symptom of the disease.
[0051] As used herein, the term "complex" refers to a grouping of two or more molecules. In some embodiments, the complex comprises polypeptide and nucleic acid molecules that interact with each other (e.g., bind, contact, adhere). As used herein, the term "complex" can refer to the histochemistry of guide RNA and polypeptide (e.g., CasY7 / its variants). As used herein, the term "complex" can refer to the histochemistry of guide RNA, polypeptide, and target sequence. As used herein, the term "complex" can refer to a complex of guide RNA targeting HAO1 and CasY7.
[0052] As used herein, the terms “prototype spacer adjacent motif” and “PAM” are used interchangeably to refer to a DNA sequence adjacent to a target sequence (e.g., the HAO1 target sequence), containing a guide RNA (e.g., a guide RNA targeting the HAO1 gene) and a complex of CasY7 / a variant thereof that binds to the target sequence. In the case of a double-stranded target, the guide RNA binds to the first strand of the target (e.g., the target strand or the spacer complementary strand), and the PAM sequence as described herein is present in the second complementary strand (e.g., the non-target strand or the non-spacer complementary strand). As used herein, the term “adjacent” includes cases where the guide RNA, which contains a complex of the guide RNA and CasY7 / a variant thereof, specifically binds, interacts with, or associates with the target sequence immediately adjacent to the PAM. In such cases, there are no nucleotides between the target sequence and the PAM. The term “adjacent” also includes cases where there are a few (e.g., 1, 2, 3, 4, or 5) nucleotides between the target sequence that binds to the guide RNA and the PAM. In some embodiments, the PAM sequence as described herein is present in the non-target strand (e.g., the non-spacer complementary strand).
[0053] As used herein, the term "guide RNA" refers to any RNA molecule that facilitates the targeting of a nuclease polypeptide (e.g., CasY7 or a variant thereof) to a target sequence (e.g., a sequence of the HAO1 gene). Guide RNAs can be programmed to include sequences complementary to a specific nucleic acid sequence (e.g., the HAO1 nucleic acid sequence). Guide RNAs may contain a DNA-targeting sequence (i.e., a spacer sequence) and a direct repeat (DR) sequence. The term "crRNA" is also used herein to refer to guide RNA, and the terms "spacer sequence" and "spacer sequence" are used interchangeably herein.
[0054] In some embodiments, the spacer sequence is complementary to the target sequence. As used herein, the term "complementarity" refers to the ability of a nucleobase pairing of a first nucleic acid molecule (e.g., guide RNA) with the nucleobase pairing of a second nucleic acid molecule (e.g., the target sequence). Two complementary nucleic acid molecules are capable of non-covalent binding under appropriate temperature and solution ionic strength conditions. In some embodiments, the first nucleic acid molecule (e.g., the spacer sequence of guide RNA) contains 100% complementarity with the second nucleic acid (e.g., the target sequence). In some embodiments, the first nucleic acid molecule (e.g., the spacer sequence of guide RNA) is complementary to the second nucleic acid molecule (e.g., the target sequence) if the first nucleic acid molecule contains at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity with the second nucleic acid. As used herein, the term "substantially complementary" refers to a polynucleotide (e.g., a spacer sequence of a guide RNA) that has a certain level of complementarity with the target sequence. In some embodiments, the complementarity level is such that the polynucleotide can hybridize with the target sequence with sufficient affinity to allow a nuclease polypeptide (e.g., CasY7 / its variants) complexed with the polynucleotide to act on (e.g., cleave) the target sequence. In some embodiments, the spacer sequence that is substantially complementary to the target sequence has less than 100% complementarity with the target sequence. In some embodiments, the spacer sequence that is substantially complementary to the target sequence has at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity with the target sequence. In some embodiments, the guide RNA having a spacer sequence that is substantially complementary to the target sequence has 100% complementarity with the target sequence.
[0055] As used herein, the terms “target” and “target sequence” refer to the nucleic acid sequence that the guide RNA specifically binds to. In some embodiments, the DNA targeting sequence of the guide RNA (e.g., a spacer) binds to the target sequence. In the case of a double-stranded target, the guide RNA binds to the first strand of the target (i.e., the target strand or the spacer complementary strand), and the PAM sequence, as described herein, is present in the second complementary strand (i.e., the non-target strand or the non-spacer complementary strand).
[0056] The term "kit" refers to any collection of two or more components that together constitute a functional unit usable for a specific purpose. By way of illustration (and not limitation), a kit according to this disclosure may include a guide RNA complexed with or capable of complexing with an RNA-directed nuclease, and accompanied by (e.g., suspended in, or suspendable in) a pharmaceutically acceptable carrier. In some embodiments, the kit may include a reinforcing element. The kit can be used to introduce the complex into, for example, cells or a subject, for the purpose of inducing a desired genomic alteration in such cells or a subject. The components of the kit may be packaged together or may be packaged separately. Kits according to this disclosure may also optionally include a direct instruction user (DFU) describing, for example, the method of using the kit according to this disclosure. The DFU may be physically packaged with the kit or may be made available to the user of the kit, for example, electronically.
[0057] The terms “polynucleotide,” “nucleotide sequence,” “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” and “oligonucleotide” refer to a series of nucleotide bases (also called “nucleotides”) in DNA and RNA, and mean any chain of two or more nucleotides. Polynucleotides, nucleotide sequences, nucleic acids, etc., can be chimeric mixtures or derivatives thereof, or modified forms, single-stranded or double-stranded. They can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve the stability of the molecule, its hybridization parameters, etc. Nucleotide sequences typically carry genetic information, including but not limited to information about organelles used to make proteins and enzymes. These terms include double-stranded or single-stranded genomic DNA, RNA, any synthetic and genetically manipulated polynucleotides, and both sense and antisense polynucleotides. These terms also include nucleic acids containing modified bases.
[0058] The term "vector" refers to a nucleic acid molecule capable of delivering an additional nucleic acid linked to it. One type of vector is the "plasmid," which refers to a circular double-stranded DNA loop in which an additional nucleic acid fragment can be linked. Another type of vector is a viral vector, in which an additional nucleic acid fragment can be linked to a viral genome. Some vectors are capable of autonomous replication in the host cell to which they are introduced (e.g., bacterial vectors with a bacterial origin of replication and episomal mammalian vectors). Upon introduction into a host cell, other vectors (e.g., non-episomal mammalian vectors) integrate into the host cell's genome and replicate along with the host genome. Furthermore, some vectors are capable of directing the expression of genes operatively linked to them. In this document, such vectors are referred to as "recombinant expression vectors," or more simply as "expression vectors." Typically, expression vectors used in recombinant DNA technology are in the form of plasmids. In this specification, because plasmids are the most commonly used form of vector, "plasmid" and "vector" are used interchangeably. However, the methods and compositions described herein may include other forms of expression vectors that provide equivalent functionality, such as viral vectors (e.g., replication-defective retroviruses, lentiviruses, adenoviruses, and adeno-associated viruses).
[0059] The term "operably linked" refers to linking a nucleotide sequence of interest to a regulatory sequence in a manner that allows for the expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a target cell when a vector is introduced into a target cell).
[0060] The term "regulatory sequence" is intended to include promoters, enhancers, and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those that direct constitutive expression of nucleotide sequences in a variety of host cell types, as well as those that direct nucleotide sequence expression only in certain host cells (e.g., tissue-specific regulatory sequences). Furthermore, the DNA-targeted endonuclease can be delivered via a vector containing a regulatory sequence that directs the synthesis of the DNA-targeted endonuclease at specific time intervals or within specific time periods. It will be understood by those skilled in the art that the design of the expression vector can depend on factors such as the selection of target cells and the desired expression level.
[0061] As used herein, the term "HAO1" refers to "glycolate oxidase 1," also known as "hydroxy acid oxidase." HAO1 is a peroxisome protein primarily expressed in the liver and pancreas, and its activity involves the oxidation of glycolic acid and 2-hydroxy fatty acids.
[0062] Type 1 primary hyperoxaluria (PH1) is an autosomal recessive disorder caused by a mutation in the AGXT gene, which encodes the hepatic peroxisome alanine-glyoxylate transaminase (AGT). AGT metabolizes glyoxylate to glycine. A deficiency in AGT activity, or its mistargeting of mitochondria, leads to the oxidation of glyoxylate to oxalate, which is excreted only in urine. High oxalate levels result in calcium oxalate stone formation and renal parenchymal damage, leading to progressive deterioration of kidney function and ultimately end-stage renal disease.
[0063] The term "treatment" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease, or disorder. For example, the term "treatment" means administering an effective amount of a composition (e.g., an effective amount of a composition comprising a hematopoietic progenitor cell population) to a subject to reduce or improve at least one symptom of the disease (e.g., a beneficial or desired clinical outcome). For the purposes of this disclosure, a beneficial or desired clinical outcome includes, but is not limited to: reduction of one or more symptoms, reduction of disease severity, stabilization of the disease (e.g., no worsening), delay or slowing of disease progression, improvement or mitigation of the disease state, and remission (whether partial or complete), whether detectable or undetectable. In some embodiments, treatment may refer to prolonged survival compared to expected survival without treatment. Therefore, those skilled in the art will understand that treatment can improve the disease condition but may not completely cure the disease. In some embodiments, treatment may include prevention. In alternative embodiments, treatment does not include prevention.
[0064] The phrase “pharmaceutically acceptable” in this article refers to compounds, materials, compositions, and / or dosage forms that, within sound medical judgment, are suitable for use in human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, and have a reasonable benefit / risk ratio.
[0065] When referring to compositions, carriers, diluents, and reagents, the terms "pharmaceutically acceptable," "physiologically tolerable," and their grammatical variations are used interchangeably and indicate that the material can be administered to or applied to mammals without producing undesirable physiological effects (such as nausea, dizziness, stomach upset, etc.). A pharmaceutically acceptable carrier will not induce an immune response against the drug mixture therewith unless desired. The preparation / formulation of pharmaceutical compositions containing an active ingredient dissolved or dispersed therein is well known in the art and is not necessarily limited by formulation. Typically, such compositions can be prepared as injectable liquid solutions or suspensions; however, they can also be prepared in solid forms suitable for forming a solution or suspension in a liquid prior to use. Formulations can also be emulsified as liposomal compositions or provided as liposomal compositions. The active ingredient can be mixed with a pharmaceutically acceptable and compatible excipient in an amount suitable for use in the treatment methods described herein. Suitable excipients include, for example, water, saline, dextran, glycerol, ethanol, and combinations thereof. In addition, if desired, the composition may contain small amounts of excipients to enhance the potency of the active ingredient, such as wetting agents or emulsifiers, pH buffers, etc. The therapeutic compositions of this disclosure may comprise pharmaceutically acceptable salts of the components therein. Pharmaceutically acceptable salts include acid addition salts (salts formed with the free amino group of a polypeptide) formed with inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, tartaric acid, mandelic acid, etc.). Salts formed with free carboxyl groups may also be derived from inorganic bases (e.g., hydroxides of sodium, potassium, ammonium, calcium, or iron) and organic bases (e.g., isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine, etc.). Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions containing no substances other than the active ingredient and water, or sterile aqueous solutions containing buffers (e.g., sodium phosphate at physiological pH), physiological saline, or both (e.g., phosphate-buffered saline). Furthermore, the aqueous carrier may contain more than one buffer salt, as well as salts (e.g., sodium chloride and potassium chloride), dextran, polyethylene glycol, and other solutes. The liquid composition may also include a liquid phase on top of water, or, in the absence of water, a liquid phase. Exemplary examples of such additional liquid phases are glycerol, vegetable oils (e.g., cottonseed oil), and water-oil emulsions. The amount of active pharmaceutical agent used in the methods described herein (which will be effective in treating a particular disorder or condition) will depend on the nature of the disorder or condition and can be determined using standard clinical techniques.
[0066] When referring to a disease, disorder, or its symptoms, the term "prevention" as used herein means reducing the likelihood that an individual will develop the disease or disorder (e.g., PH1). For example, an individual with one or more risk factors for the disease or disorder does not develop the condition; or, statistically speaking, these individuals are less likely to develop the disease or disorder at a later time or with less severity compared to a group with the same risk factors who did not receive the treatments described herein. The absence of symptoms, or a reduction in symptom development (e.g., a decrease of at least 10% in clinically accepted scores for the disease or disorder) or a delay (e.g., a delay of days, weeks, months, or years) is considered effective prevention.
[0067] I. Composition
[0068] This disclosure provides compositions that target the HAO1 gene, which can be used to edit the HAO1 gene target; exemplary, the compositions can disrupt the HAO1 gene.
[0069] In some embodiments, the composition targeting the HAO1 gene, used for gene editing of the HAO1 gene, comprises:
[0070] (i) The nuclease of this disclosure or the first nucleic acid encoding the nuclease of this disclosure;
[0071] (ii) guide RNA or a second nucleic acid encoding the guide RNA, wherein the guide RNA includes a spacer sequence that is specific to a target sequence within the HAO1 gene.
[0072] In some implementations, the guide RNA consists of a direct repeat (DR) sequence and a spacer sequence.
[0073] In some implementations, the guide RNA binds to a nuclease to form a CRISPR-Cas complex that targets the HAO1 gene target sequence.
[0074] In some embodiments, the spacer sequence is specific to the HAO1 target sequence, wherein the HAO1 target sequence is adjacent to the prototype spacer neighbor motif (PAM), and in some embodiments, the PAM sequence is the 5'-TTN-3' described herein. In the case of a gene target of dsDNA, the guide RNA binds to the first strand (non-PAM strand) of the gene target, and the PAM sequence as described herein is present in the second complementary strand (i.e., the PAM strand).
[0075] In some embodiments, this disclosure provides a complex comprising a guide RNA and a nuclease. In some embodiments, the RNA guide and the nuclease bind to each other in a molar ratio of about 1:1. In some embodiments, the complex comprising the guide RNA and the nuclease binds to the complementary region of a target sequence within the HAO1 gene. In some embodiments, the complex comprising a guide RNA and a nuclease targeting HAO1 binds to the complementary region of a target sequence within the HAO1 gene in a molar ratio of about 1:1. In some embodiments, the guide RNA and nuclease complex has enzymatic activity, such as nuclease activity, for cleaving the HAO1 target sequence and / or its complementary sequence. In some embodiments, the guide RNA, the nuclease, and the complementary region of the HAO1 target sequence, whether individually or together, are not naturally occurring.
[0076] In some embodiments, the guide RNA in the complex comprises the direct repeat (DR) sequence and / or spacer sequence described herein. In some embodiments, the sequence of the guide RNA has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with the sequence of any of SEQ ID NO. 18-29, 43-54. In some embodiments, the guide RNA has any of the sequences of SEQ ID NO. 18-29, 43-54.
[0077] In some embodiments, the compositions provided in this disclosure comprise a nuclease polypeptide as described herein and / or a nucleic acid (e.g., RNA) encoding a nuclease as described herein. In some embodiments, the compositions provided in this disclosure comprise a nuclease polypeptide as described herein and / or a first nucleic acid (e.g., RNA) encoding a nuclease as described herein and a guide RNA or a second nucleic acid encoding said guide RNA. In some embodiments, the nuclease polypeptide or the first nucleic acid encoding the nuclease is included in the same composition as the guide RNA or the second nucleic acid encoding the guide RNA. In some embodiments, the nuclease or the RNA encoding the nuclease polypeptide is included in a separate composition as well as the guide RNA or the second nucleic acid encoding the guide RNA. In some embodiments, the guide RNA comprises a direct repeat (DR) sequence and / or a spacer sequence as described herein. In some embodiments, the DR sequence of the guide RNA has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with the sequence of any of SEQ ID NO. 3-4. In some embodiments, the spacer sequence of the guide RNA has the sequence of any one of SEQ ID NO. 31-42.
[0078] 1. CasY7 peptide / variant
[0079] The compositions disclosed herein contain CasY7 or variations thereof, as described in PCT / CN2024 / 092707, the relevant disclosure of which is incorporated herein by reference for the purposes and purposes described herein.
[0080] The nucleotide sequence of the CasY7 polypeptide parent is shown in SEQ ID NO.1, and the encoding nucleotide is shown in SEQ ID NO.2.
[0081] In some embodiments, the nuclease of this disclosure has an amino acid sequence comprising at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with SEQ ID NO. 1.
[0082] In some embodiments, the nuclease of this disclosure comprises an amino acid sequence that is approximately 70 amino acids different from the amino acid sequence of SEQ ID NO.1, for example, differing by 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 amino acid residues.
[0083] In some embodiments, the nuclease of this disclosure includes one or more of the following mutations: positions 175, 176, 282, 283, 285, 416, 1417, 418, 419, 420, 788, and 829 of SEQ ID NO. 1.
[0084] In some cases, the nuclease contained in the compositions of this disclosure contains amino acid mutations at multiple sites. In some embodiments, the nuclease contained in the compositions of this disclosure contains one or more mutations relative to the amino acid sequence shown in SEQ ID NO. 1 as amino acid substitutions, said amino acid substitutions optionally comprising the following mutations:
[0085] (i)Y282+D283+A285+G416+I417+E418+F419+D420; or
[0086] (ii)E176+Y282+D283+A285+G416+I417+E418+F419+D420.
[0087] In some embodiments, the nuclease of this disclosure contains one or more mutations relative to the amino acid sequence shown in SEQ ID NO.1, which may optionally include the following mutations:
[0088] (a)Y282+D283+A285+G416+I417+E418+F419+D420;
[0089] (b)A175+E176+Y282+D283+A285+G416+I417+E418+F419+D420;
[0090] (c)E176+Y282+D283+A285+G416+I417+E418+F419+D420+E788; or
[0091] (d)E176+Y282+D283+A285+G416+I417+E418+F419+D420+E829.
[0092] In some embodiments, the nuclease of this disclosure contains one or more mutations relative to the amino acid sequence shown in SEQ ID NO.1, which may optionally include the following mutations:
[0093] (e)Y282F+D283Q+A285T+G416L+I417Q+E418M+F419R+D420A;
[0094] (f)A175R+E176R+Y282F+D283Q+A285T+G416L+I417Q+E418M+F419R+D420A;
[0095] (g)E176R+Y282F+D283Q+A285T+G416L+I417Q+E418M+F419R+D420A+E788R; or
[0096] (h)E176R+Y282F+D283Q+A285T+G416L+I417Q+E418M+F419R+D420A+E829R.
[0097] The amino acid mutations of the nucleases described herein relative to the amino acid sequence shown in SEQ ID NO.1 can be one or more amino acid changes, but in some cases, the changes to the nucleases disclosed herein can also be substantial, for example, when the nucleases are part of a fusion protein with N-terminal and / or C-terminal extensions:
[0098] In some embodiments, the nuclease may contain additional proteins or peptides, such as one or more proteins or polypeptides. In some cases, additional proteins or peptides may be selected from nuclear localization signals (NLS), nuclear export signals (NES), reporter proteins (e.g., fluorescent proteins), Cas protein targeting regions, DNA binding domains (e.g., Lex A DBD, Gal4DBD, Sp1DBD), epitope tags (e.g., His, myc, V5, FLAG, HA, VSV-G, etc.), transcriptional activation domains (e.g., VP64, VPR, p65, Rta), transcriptional repression domains (e.g., KRAB domain, SID domain, NuE domain, NcoR domain, or SID4X domain), nucleases, deaminases (e.g., adenosine deaminase or cytidine deaminase), methyltransferases (e.g., DNA methyltransferase DNMT), demethylases, transcription release factors, HDAC, cleavage-active peptides, ligases, integrases, transposases, recombinases, polymerases, exonucleases (e.g., T5E), and base excision repair inhibitors (e.g., uracil-DNA glycosylation inhibitors (UGI)).
[0099] In some cases, additional proteins or peptides may be selected from proteins or peptides having the following activities: methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin ligase activity, deubiquitination activity, adenylation activity, deadenylation activity, SUMOylation activity, deSUMOylation activity, ribosylation activity, deribosylation activity, myristylation activity, demyristylation activity, glycosylation activity (e.g., from O-GlcNAc transferase), and deglycosylation activity. In some embodiments, the functional domain is selected from adenosine deaminase catalytic domains or cytidine deaminase catalytic domains. In some embodiments, the adenosine deaminase catalytic domain or cytidine deaminase catalytic domain includes one or more of ADAR1, ADAR2, APOBEC, AID, or TAD.
[0100] In some embodiments, additional proteins or peptides may include epitope peptides for labeling, such as His tags, Myc, and FLAG. In some embodiments, the nucleases described in this disclosure may be fused with a detectable moiety, such as a fluorescent protein (e.g., green fluorescent protein (GFP) or yellow fluorescent protein (YFP)).
[0101] In some embodiments, the nuclease of this disclosure includes at least one nuclear localization signal (NLS) and / or a nuclear output signal (NES), for example, including 2, 3, 4, 5, or more NLS, and / or at least one nuclear output signal (NES) (e.g., 2, 3, 4, 5, or more). In some embodiments, the nuclease of this disclosure includes 2-4 nuclear localization signals (NLS). In some embodiments, the nuclease of this disclosure includes at least one (e.g., 2, 3, 4, 5, or more) NLS and at least one (e.g., 2, 3, 4, 5, or more) NES.
[0102] In some embodiments, the nuclease of this disclosure is substantially inactivated, for example, the nuclease contains amino acid mutations selected from D592A, D643A, E820A and / or D992A relative to the amino acid sequence shown in SEQ ID NO.1.
[0103] The nucleases disclosed herein (e.g., CasY7 or its variants) are smaller than other nucleases (CasY7 parent polypeptide and its variants have only 1022 amino acids), while spCas9 has 1368 amino acids and LbCpf1 has 1246 amino acids. This makes CasY7 and its variants of the present disclosure advantageous for delivery and have the characteristics of low off-target and high specificity.
[0104] 2. Guide RNA
[0105] In some embodiments, the compositions described herein include guide RNAs targeting the HAO1 gene. The guide RNAs can direct a CasY7 peptide or a variant thereof contained in the compositions described herein to a target sequence of the HAO1 gene. Two or more guide RNAs can direct two or more individual CasY7s and / or their variants to two or more (e.g., three, four, five, six, seven, eight, nine, or more) target sequences of the HAO1 gene.
[0106] In some embodiments, the compositions of this disclosure comprise a guide RNA that targets a regulatory sequence (e.g., an enhancer sequence) of the HAO1 gene. In some embodiments, the compositions of this disclosure comprise one guide RNA that targets the HAO1 gene, and in some cases, the compositions of this disclosure comprise two or more (e.g., two, three, four, five, six, seven, eight, nine, ten or more) guide RNAs.
[0107] In some embodiments, the guide RNA contained in the compositions herein comprises:
[0108] (1) Capable of hybridizing with the target sequence of the HAO1 gene, thereby guiding the complex to the spacer sequence of the target DNA of the HAO1 gene, and
[0109] (2) A direct repeat (DR) sequence capable of forming a complex with the nuclease or a variant thereof disclosed herein. In some embodiments, the guide RNA of the present disclosure includes (i) a spacer sequence specific to a target sequence in the HAO1 gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) located at the 5' of the target sequence, including a 5'-TTN-3' motif; and (ii) a direct repeat (DR) sequence capable of forming a complex with the nuclease or a variant thereof disclosed herein.
[0110] In some implementations, the guide RNA does not contain tracrRNA.
[0111] In some embodiments, the directional repeat (DR) sequence is located at the 5' end of the spacer sequence, which is capable of forming a complex with the Cas protein of this disclosure or its variant polypeptides, or the fusion protein of this disclosure.
[0112] In some embodiments, the guide RNA comprises, or consists essentially of, or is composed of a direct repeat (DR) sequence and a spacer sequence. In some embodiments, the guide RNA is a single nucleic acid molecule with the DR sequence linked to the spacer sequence.
[0113] In some embodiments, the guide RNA comprises a plurality of tandemly arranged spacer sequences, optionally separated by nucleotide sequences, such as directed repeat (DR) sequences as defined herein. The different spacer sequences are tandemly arranged without affecting activity. In some embodiments, the guide RNA comprises a plurality (e.g., two or more) identical direct repeat (DR) sequences. In some embodiments, the guide RNA comprises a plurality (e.g., two or more) different direct repeat (DR) sequences. In some embodiments, the spacer sequences and direct repeat sequences comprised in the guide RNA are directly linked to each other. In some embodiments, the spacer sequences and direct repeat sequences comprised in the guide RNA are linked to each other by a linker (e.g., an RNA linker comprising multiple nucleotides).
[0114] (i) Direct Repeat (DR) sequence
[0115] In some implementations, the guide RNA described herein includes a direct repeat (DR) sequence.
[0116] In some implementations, the guide RNA has a direct repeat (DR) sequence consisting of a sequence of multiple nucleotides. In some cases, the guide RNA described herein contains a direct repeat (DR) sequence consisting of 15-90 nucleotides (e.g., 16-80, 17-75, 18-70, 19-65, 20-60, 23-55, 25-50, 23, or 27 nucleotides).
[0117] In some embodiments, the direct repeat (DR) sequence may include the nucleotide sequence shown in any of SEQ ID NO. 3 or 4, or a nucleotide sequence having at least about 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the nucleotide sequence shown in any of SEQ ID NO. 3 or 4. In some embodiments, the DR is a “functional variant” (e.g., a “functional truncated version,” a “functional extended version,” or a “functional replacement version”) of the nucleotide sequence shown in SEQ ID NO. 3 or 4, but still has DR function and retains at least partially (e.g., at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or higher) the function of the reference DR (parental DR).
[0118] In some implementations, the DR sequence includes a stem-loop structure (immediately adjacent spacer sequence) near the 3' end. A "stem-loop structure" refers to a nucleic acid having a secondary structure comprising nucleotide regions known or predicted to form a double-stranded (stem) portion, linked at one end by basic single-stranded nucleotides via a linker region (loop). The term "hairpin" structure is also used herein to refer to stem-loop structures. These structures are well known in the art, and these terms are used in the manner commonly known in the art. Stem-loop structures do not require precise base pairing. Therefore, the stem may contain one or more base mismatches. Alternatively, base pairing may be precise, i.e., not including any mismatches.
[0119] In one embodiment, the guide RNA of this disclosure comprises a direct repeat (DR) sequence, wherein a stem-loop structure is included near the 3' end of the DR. In some embodiments, the stem of the DR consists of 5 complementary base pairs that hybridize with each other, and the loop is 6, 7, 8, or 9 nucleotides in length. In some embodiments, the loop is 7 nucleotides in length. In some embodiments, the stem may contain at least 2, at least 3, at least 4, or at least 5 base pairs. In some embodiments, the DR comprises two complementary nucleotide segments of approximately 5 nucleotides in length, separated by approximately 7 nucleotides. In some embodiments, the stem-loop structure comprises a first stem nucleotide chain of 5 nucleotides in length; a second stem nucleotide chain of 5 nucleotides in length, wherein the first and second stem nucleotide chains can hybridize with each other; and a circular nucleotide chain arranged between the first and second stem nucleotide chains, wherein the circular nucleotide chain contains 6, 7, or 8 nucleotides.
[0120] As used herein, two or more guide RNAs having substantially identical or no substantial differences in secondary structure means that the stems and / or loops contained in these crRNAs differ in length by no more than 1, 2, or 3 nucleotides; and in terms of nucleotide type (A, U, G, or C), when comparing the nucleotide sequences of these guide RNAs by sequence alignment, the differences are no more than 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides. In some embodiments, two or more guide RNAs having substantially identical or no substantial differences in secondary structure means that the stems contained in the crRNAs differ by at most one complementary base pair, and / or the loops differ by at most one nucleotide length, and / or contain stems of the same length but with mismatched bases.
[0121] In some embodiments, the stem-loop structure comprises 5'-X1X2X3X4X5NNNNNNNX6X7X8X9X10-3'; X1, X2, X3, X4, X5, X6, X7, X8, X9, X10 are any bases containing A, T, C, or G, and N is any base containing A, T, C, or G; wherein X1, X2, X3, X4, X5 and X6, X7, X8, X9, X10 can hybridize with each other to form a stem and such that NNNNNNN forms a loop; more preferably, wherein the DR sequence comprises a stem-loop structure near the 3' end of the DR sequence of any one of the following: 5'-CCGTCNNNNNNNGACGG-3'; wherein, N is any base containing A, T, C, or G.
[0122] In some embodiments, the DR sequence that can guide any nuclease or variant polypeptide of this disclosure to the target site comprises one or more nucleotide changes selected from nucleotide addition, insertion, deletion and substitution, which do not result in a substantial difference in secondary structure compared to the DR sequence listed in SEQ ID NO. 3 or 4 or a functionally truncated version thereof.
[0123] In some embodiments, the direct repeat (DR) sequence described herein has at least 90% identity with the sequence shown in SEQ ID NO. 3 or 4 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity). In some embodiments, the direct repeat (DR) sequence described herein has at least 95% identity with a portion of the sequence shown in SEQ ID NO. 3 or 4 (e.g., at least 95%, 96%, 97%, 98%, or 99% identity).
[0124] In some embodiments, the direct repeat (DR) sequence described herein has at least 90% identity with the inverse complementary sequence of SEQ ID NO. 3 or 4 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity). In some embodiments, the direct repeat (DR) sequence described herein has at least 90% identity with a portion of the inverse complementary sequence of SEQ ID NO. 3 or 4 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity).
[0125] In some embodiments, the direct repeat (DR) sequence herein is as shown in SEQ ID NO. 3 or 4. In some embodiments, the direct repeat (DR) sequence herein is the reverse complementary sequence to the one shown in SEQ ID NO. 3 or 4.
[0126] (ii) Interval sequence
[0127] In some embodiments, the guide RNA comprising the compositions of this disclosure includes a spacer sequence. In some embodiments, the spacer sequence is at least about 15 nucleotides in length, preferably about 15 to about 100 nucleotides, more preferably about 15 to about 50 nucleotides (e.g., any one of about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides). In some embodiments, the spacer sequence is about 16 to about 27 nucleotides, for example, about 17 to about 24 nucleotides, about 18 to about 24 nucleotides, or about 18 to about 22 nucleotides. In some embodiments, the spacer sequence of the guide RNA is complementary to the non-PAM strand sequence. In some embodiments, the spacer sequence is designed to be complementary to a specific DNA strand, such as the DNA strand of a genomic locus. In some embodiments, the complementarity of the spacer sequence to the target sequence of the HAO1 gene is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). In some embodiments, there is at least about 15 nucleotide matches between the spacer sequence and the target sequence of the target nucleic acid (e.g., DNA) (e.g., at least about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more). Perfect complementarity is not required for the spacer sequence, as long as sufficient complementarity exists for the guide RNA to function (i.e., guide the nuclease to the target site). In some implementations, nuclease-mediated cleavage efficiency can be tuned by introducing one or more mismatches between the spacer and target sequences (e.g., one or two mismatches between the spacer and target sequences, including mismatch locations along the spacer / target sequence). Mismatches (e.g., double mismatches) have a greater impact on cleavage efficiency when they are located more centrally within the spacer sequence (i.e., not at the 3' or 5' end of the spacer sequence). Therefore, by selecting the location of the mismatch along the spacer sequence, the cleavage efficiency of the nuclease targeting the HAO1 gene target sequence can be modulated. For example, if a cleavage rate of less than 100% of the target sequence is desired (e.g., in a cell population), one or two mismatches between the spacer and target sequences can be introduced into the spacer sequence.
[0128] In some embodiments, the spacer sequence of the guide RNA disclosed herein comprises at least 15 consecutive nucleotides in any of the nucleotide sequences described in any one of SEQ ID NO. 31-42.
[0129] In some embodiments, the spacer sequence comprises a nucleotide sequence as described in any one of SEQ ID NO. 31-42.
[0130] (iii) Modification of guide RNA
[0131] In some embodiments, the guide RNA described herein comprises one or more nucleotide modifications. Exemplary modifications may include any modification to sugars, nucleotides, nucleoside internucleotides (e.g., to the linking phosphate / phosphodiester bond / phosphodiester backbone), and any combination thereof. In some embodiments, the RNA guide may comprise any available modification to sugars, nucleotides, or nucleoside internucleotides (e.g., to the linking phosphate, phosphodiester bond, phosphodiester backbone). One or more atoms of the pyrimidine nucleotide may be replaced or substituted with an optionally substituted amino group, an optionally substituted thiol group, an optionally substituted alkyl group (e.g., methyl or ethyl), or a halogen group (e.g., chloro or fluorine). In some embodiments, the modification (e.g., one or more modifications) is present in each of the sugar and nucleoside internucleotides. The modification may be a modification of ribonucleic acid (RNA) to deoxyribonucleic acid (DNA), threonine nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or a hybrid thereof.
[0132] In some implementations, the modification of the guide RNA can include chemical modifications or cell-induced modifications. For example, Lewis and Pan describe some non-limiting examples of intracellular RNA modifications in "RNA modifications and structures cooperate to RNA guide-protein interactions" in *Nature Reviews Molecular Cell Biology*, 2017, 18:202-210. Different sugar modifications, nucleotide modifications, and / or nucleotide inter-bonds (e.g., backbone structures) can be present at different positions in the sequence. Those skilled in the art will understand that nucleotide analogs or other modifications can be located at any position in the sequence such that the function of the sequence is not substantially diminished. The sequence can contain from about 1% to about 100% modified nucleotides (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any one or more of A, G, U, or C) or any intermediate percentage (e.g., 1-100%).
[0133] In some embodiments, the functional nucleotide analog comprises at least one chemical modification of a nucleotide base, glycosyl group, and / or phosphate group. Therefore, a payload nucleic acid molecule comprising at least one functional nucleotide analog contains at least one chemical modification of a nucleotide base, glycosyl group, and / or nucleoside bond. Exemplary chemical modifications of the nucleotide base, glycosyl group, or nucleoside bond of a nucleic acid molecule are provided herein.
[0134] In some embodiments, the functional nucleotide analogue comprises a non-standard nucleobase. In some embodiments, the standard nucleobase in the nucleotide (e.g., adenine, guanine, uracil, thymine, and cytosine) may be modified or replaced to provide one or more functional analogues of the nucleotide. Exemplary modifications of the nucleobase include, but are not limited to, one or more substitutions or modifications, including but not limited to alkyl, aryl, halogen, oxo, hydroxyl, alkoxy, and / or thio substitutions; one or more fused or open rings; oxidation and / or reduction.
[0135] In some embodiments, the non-standard nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridine-4-ketoribonucleotide, 5-azauracil, 6-azauracil, 2-thio-5-azauracil, 2-thiouracil (s2U), 4-thiouracil (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuracil (ho5U), 5-aminoallyluracil, 5-halouracil (e.g., 5-iodouracil or 5-bromouracil), 3-methyluracil (m3U), 5-methoxyuracil (mo5U), and uracil 5-oxoacetyluracil. Acid (cmo5U), methyl 5-oxyacetate of uracil (mcmo5U), 5-carboxymethyl-uracil (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm5U), methyl 5-carboxyhydroxymethyl-uracil (mchm5U), 5-methoxycarbonylmethyluracil (mcm5U), 5-methoxycarbonylmethyl-2-thiouracil (mcm5s2U), 5-aminomethyl-2-thiouracil (nm5s2U), 5-methylaminomethyl-2-uracil (mnm5U), 5-methylaminomethyl-2-thiouracil Uracil (mnm5s2U), 5-methylaminomethyl-2-selenouracil (mnm5se2U), 5-carbamoylmethyluracil (ncm5U), 5-carboxymethylaminomethyluracil (cmnm5U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm5s2U), 5-propynyluracil, 1-propynyl-pseudouracil, 5-tauronic acid methyluracil (τm5U), 1-tauronic acid methyl-pseudouridine, 5-tauronic acid methyl-2-thiouracil (τm5s2U), 1-tauronic acid methyl-4-thio-pseudouridine Glycosides, 5-methyl-uracil (m5U, i.e., deoxythymidine with nucleobases), 1-methyl-pseudoneuridine (m1ψ), 1-ethyl-pseudoneuridine (Et1ψ), 5-methyl-2-thiouracil (m5s2U), 1-methyl-4-thio-guduridine (m1s4ψ), 4-thio-1-methyl-guduridine, 3-methyl-guduridine (m3ψ), 2-thio-1-methyl-guduridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-Dihydrouracil, 5-Methyl-Dihydrouracil (m5D), 2-Thio-Dihydrouracil, 2-Thio-Dihydropseudouridine, 2-Methoxy-uracil, 2-Methoxy-4-Thiouracil, 4-Methoxy-Pseudouridine, 4-Methoxy-2-Thiopseudouridine, N1-Methyl-Pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp3U), 1-Methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3ψ), 5-(isopentenylaminomethyl)uracil (m5U), 5-(isopentenyl)aminomethyl)-2-thiouracil (m5s2U), 5,2′-O-dimethyluridine (m5Um), 2-Thio-2′-O-methyluridine (s2Um), 5-methyl Oxycarbonylmethyl-2′-O-methyluridine (mcm5Um), 5-carbamoylmethyl-2′-O-methyluridine (ncm5Um), 5-carboxymethylaminomethyl-2′-O-methyluridine (cmnm5Um), 3,2′-O-dimethyluridine (m3Um) and 5-(isopentenylaminomethyl)-2′-O-methyluridine (inm5Umm), 1-thiouracil, deoxythymidine, 5-(2-carbonylmethoxyvinyl)uracil, 5-(carbamoylhydroxymethyl)uracil, 5-carbamoylmethyl-2-thiouracil, 5-carboxymethyl-2-thiouracil, 5-cyanomethyluracil, 5-methoxy-2-thiouracil and 5-3-(1-E-propenylamino)uracil.
[0136] In some embodiments, the non-standard nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides with modified cytosine include 5-azacytosine, 6-azacytosine, pseudocytosine, 3-methylcytosine (m3C), N4-acetylcytosine (ac4C), 5-formylcytosine (f5C), N4-methylcytosine (m4C), 5-methylcytosine (m5C), 5-halocytosine (e.g., 5-iodocytosine), 5-hydroxymethylcytosine (hm5C), 1-methyl-pseudocytosine, pyrazine, etc. Pyrrolocytosine, pyrrolopseudocytosine nucleoside, 2-thiocytosine nucleoside (s2C), 2-thio-5-methylcytosine nucleoside, 4-thio-pseudocytosine nucleoside, 4-thio-1-methyl-pseudocytosine nucleoside, 4-thio-1-methyl-1-deazo-pseudocytosine, 1-methyl-1-deazo-pseudocytosine, zebularine, 5-aza-zebularine, 5-methyl 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methylcytosine, 4-methoxy-pseudoisocytosine nucleoside, 4-methoxy-1-methyl-pseudoisocytosine nucleoside, lysine (k2C) 5,2′-O-dimethylcytosine nucleoside (m5Cm), N4-acetyl-2′-O-methylcytidine (ac4Cm), N4,2′-O-dimethylcytidine (m4Cm), 5-formyl-2′-O-methylcytidine (fSCm), N4,N4,2′-O-trimethylcytidine (m42Cm), 1-thiocytosine, 5-hydroxycytosine, 5-(3-azidopropyl)cytosine, and 5-(2-azidoethyl)cytosine.
[0137] In some embodiments, the non-standard nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having alternative adenine include 2-aminopurine, 2,6-diaminopurine, 2-amino-6-halopurine (e.g., 2-amino-6-chloropurine), 6-halopurine (e.g., 6-chloropurine), 2-amino-6-methylpurine, 8-azidoadenine, 7-deadenine, 7-deadenine-8-azaadenine, 7-deadenine-2-aminopurine, 7-deadenine-8-aza-2-aminopurine, 7-deadenine-2,6-diaminopurine, and 7-deadenine-8-aza-2,6-diaminopurine. -Diaminopurine, 1-methyladenine (m1A), 2-methyladenine (m2A), N6-methyladenine (m6A), 2-methylthio-N6-methyladenine (ms2m6A), N6-isopentenyladenine (i6A), 2-methylthio-N6-isopentenyladenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (i06A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2i06A), N6-glycylcarbamoyl -Adenine (g6A), N6-threomethylcarbamoyl-adenine (t6A), N6-methyl-N6-threomethylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threomethylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxy-n-pentylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxy-n-pentylcarbamoyl-adenine (ms2hn6A), N6-acetyladenine ( ac6A), 7-methyladenine, 2-methylthioadenine, 2-methoxyadenine, N6,2′-O-dimethyladenine (m6Am), N6,N6,2′-O-trimethyladenine (m62Am), 1,2′-O-dimethyladenine (m1Am), 2-amino-N6-methylpurine, l-thioadenine, 8-azidoadenine, N6-(19-amino-pentadodecane)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine
[0138] In some embodiments, the non-standard nucleobase is a modified guanine. Exemplary nucleobases and nucleosides with modified guanine include inosine (I), 1-methylinosine (m1I), inosine (imG), methylinosine (mimG), 4-demethylinosine (imG-14), isotyrosine (imG2), wybutosine (yW), peroxytyrosine (o2yW), hydroxytyrosine (OHyW), undermodified hydroxytyrosine (OHyW*), 7-denitroguanine, quinone (... Q), cyclooxyquinone (oQ), galactosylquinone (galQ), mannosylquinone, 7-cyano-7-denitroguanine (preQO), 7-aminomethyl-7-denitroguanine (preQ1), archaeal alkaloids (G+), 7-denitro-8-azaguanine, 6-thioguanine, 6-thio-7-denitro-guanine, 6-thio-7-denitro-8-azaguanine, 7-methylguanine (m7G), 6-thio-7-methylguanine Purines, 7-methyl-inosine, 6-methoxy-guanine, 1-methylguanine (m1G), N2-methylguanine (m2G), N2,N2-dimethylguanine (m22G), N2,7-dimethylguanine (m2,7G), N2,N2,7-dimethylguanine (m2,2,7G), 8-oxoguanine, 7-methyl-8-oxoguanine, 1-methyl-6-thioguanine, N2-methyl-6-thioguanine, N2,N2 -Dimethyl-6-thioguanine, N2-methyl-2′-O-methyl-guanine (m2Gm), N2,N2-dimethyl-2′-O-methylguanosine (m22Gm), 1-methyl-2′-O-methylguanosine (mlGm), N2,7-dimethyl-2′-O-methylguanosine (m2,7Gm), 2′-O-methylinosine (Im), 1,2′-O-dimethylinosine (mIm), 1-thioguanine and O-6-methylguanine.
[0139] In some embodiments, the non-standard nucleobase of the functional nucleotide analog can be independently a purine, pyrimidine, or a purine or pyrimidine analog. For example, in some embodiments, the non-canonical nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, the non-canonical nucleobase may also include, for example, naturally occurring and synthetic derivatives of the base, including pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halogenated (e.g., 8-bromo), 8-amino, 8-thiol 8-Thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogenated especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deadenine, 7-deadenine, 3-deadenine, deadenidine, 7-deadenidine, 3-deadenidine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5-triazinone, 9-deadenine, imidazo[4,5-d]pyrazine, thiazo[4,5-d]pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine, or 1,3,5-triazine.
[0140] In some embodiments, the functional nucleotide analog comprises a non-standard glycosyl group. In various embodiments, the non-standard glycosyl group can be a 5-carbon or 6-carbon sugar (e.g., pentose, ribose, arabinose, xylose, glucose, galactose, or a deoxygenated derivative thereof) having one or more substituents, said substituents being halogens, hydroxyl groups, thiols, alkyl groups, alkoxy groups, alkenyloxy groups, alkynyloxy groups, cycloalkyl groups, aminoalkoxy groups, alkoxyalkoxy groups, hydroxyalkoxy groups, amino groups, azide groups, aryl groups, aminoalkyl groups, aminoalkenyl groups, aminoalkynyl groups, etc.
[0141] Typically, RNA molecules contain a ribose group, which is a five-membered ring with oxygen. Exemplary non-restrictive nucleotide substitutions include oxygen substitution in the ribose (e.g., with S, Se, or alkylene groups such as methylene or ethylene); double bond addition (e.g., with cyclopentenyl or cyclohexenyl substitution of the ribose); ring closing of the ribose (e.g., forming a four-membered ring of cyclobutane or oxetane); ring expansion of the ribose (e.g., forming a 6 or 7-membered ring with an additional carbon atom or heteroatom, such as anhydrohexitol, araitol, mannitol, cyclohexyl, cyclohexenyl, and morpholino (also having an aminophosphate backbone)); and polycyclic forms (e.g., tricyclic and “unlocked” forms, such as glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA, where the ribose is attached to a phosphate group). Nucleic acid molecules can be substituted with ethylene glycol units on ester bonds, threonine nucleic acids (TNA, where the ribose is replaced by α-L-threofuranofuranose-(3′→2′)), and peptide nucleic acids (PNA, where the 2-amino-ethyl-glycine bond replaces the ribose and phosphodiester backbone). In some embodiments, the sugar group comprises one or more carbons having a stereochemical configuration opposite to that of the corresponding carbon in ribose. Therefore, nucleic acid molecules can include nucleotides containing, for example, arabinose or L-ribose as sugars. In some embodiments, nucleic acid molecules include at least one nucleoside, wherein the sugar is L-ribose, 2′-O-methylribose, 2′-fluororibose, arabinose, hexitol, LNA, or PNA.
[0142] In some embodiments, the payload nucleic acid molecule of this disclosure may contain one or more modified nucleoside bonds (such as a phosphate backbone). The phosphate groups of the backbone can be modified by replacing one or more oxygen atoms with different substituents.
[0143] In some embodiments, the functional nucleotide analog may include another nucleoside bond replacing the unchanged phosphate moiety. Examples of alternative phosphate groups include, but are not limited to, thiophosphates, selenophosphite, borate phosphates, phosphate borate, hydrogen phosphonate, aminophosphates, diaminophosphates, alkyl or aryl phosphonates, and triphosphates. In dithiophosphates, both non-linked oxygen atoms are replaced by sulfur. The modified phosphate bond can also be linked by replacing oxygen atoms with nitrogen (bridged aminophosphate), sulfur (bridged thiophosphate), and carbon (bridged methylene phosphonate).
[0144] Alternative nucleosides and nucleotides include borane moieties (BH3), thio, methyl, ethyl, and / or methoxy groups replacing one or more non-bridging oxygen atoms. As a non-limiting example, two non-bridging oxygen atoms at the same position (e.g., α, β, or γ positions) can be replaced by thio and methoxy groups. The stability of RNA and DNA is enhanced (e.g., against exonucleases and endonucleases) by substituting one or more oxygen atoms at the position of the phosphate moieties (e.g., α-thiophosphates) with non-natural thiophosphate backbone linkages. Thiophosphate DNA and RNA exhibit enhanced nuclease resistance and therefore longer half-lives in the cellular environment. Other nucleoside bonds used according to this disclosure include nucleoside bonds that do not contain a phosphorus atom.
[0145] When the compositions disclosed herein include nucleic acids (e.g., mRNA molecules) encoding nucleases disclosed herein, the nucleic acid molecules may contain any of the modifications disclosed herein, if applicable.
[0146] (iv) Exemplary guide RNA
[0147] In some embodiments, the target sequence of the guide RNA of this disclosure is selected from any of SEQ ID NO. 6-17. In some embodiments, the spacer sequence of the guide RNA of this disclosure is selected from any of SEQ ID NO. 31-42.
[0148] In some embodiments, the guide RNA in the compositions of this disclosure, as shown in SEQ ID NO.18-29 (Group 1) and SEQ ID NO.43-54 (Group 2), is chemically modified as shown in the table below.
[0149]
[0150] II. Preparation and expression of compositions targeting HAO1
[0151] 1. Preparation of CasY7 peptides and their variants
[0152] In some implementations, the nucleases disclosed herein can be prepared in a variety of ways.
[0153] In some embodiments, the nucleases of this disclosure are obtained by constructing expression vectors capable of expressing them, expressing them in host cells, and then isolating and purifying them. In some embodiments, they are obtained by in vitro coupled transcription-translation systems.
[0154] In some embodiments, the host cell used to express the nuclease of this disclosure can be selected from any cell type suitable for nuclease expression. Exemplarily, the host cell can be selected from *Escherichia coli*, yeast (budding yeast, *Saccharomyces cerevisiae*, and *Schizosaccharomyces cerevisiae*, *Schizosaccharomyces cerevisiae*), nematodes (*C. elegans*), Xenopus laevis oocytes, and animal cells (e.g., CHO cells, COS cells, and HEK293 cells). A method for in vivo expression of the nuclease or a variant thereof in a host cell includes providing the host cell with a polynucleotide encoding the nuclease or a variant thereof, said polynucleotide encoding the nuclease or a variant thereof, expressing the nuclease polypeptide or a variant thereof in the host cell, thereby enabling the acquisition of the nuclease polypeptide or a variant thereof from the host cell.
[0155] There are no particular limitations on the methods used to transfer the above expression vectors into host cells (i.e., transformation methods), and known methods such as electroporation, calcium phosphate method, liposome method, and DEAE dextran method can be used.
[0156] In some embodiments, after transforming the host with an expression vector, the host cells are cultured, cultivated, or propagated to produce nucleases. In some embodiments, after expressing the nuclease, the host cells are collected and purified to obtain the nuclease polypeptide. Exemplarily, the nuclease can be purified from the culture, etc., using conventional methods (e.g., filtration, centrifugation, cell disruption, gel filtration chromatography, ion exchange chromatography, etc.).
[0157] A variety of methods can be used to determine the level of nuclease production in host cells. Exemplarily, polyclonal or monoclonal antibodies specific to the nuclease peptides and variants of this disclosure, or labeling methods as described elsewhere herein, can be used, such as enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (MA), fluorescence immunoassay (FIA), and fluorescence activated cell sorting (FACS). These and other assays are well known in the art (see, for example, Maddox et al., Journal of Experimental Medicine (J. Exp. Med.) 158:1211
[1983] ).
[0158] 2. Preparation of guide RNA
[0159] Guide RNA can be prepared using various methods. In some embodiments, guide RNA can be synthesized chemically, enzymatically, or in combination thereof. For example, it can be synthesized using standard phosphoramide-based solid-phase synthesis methods, or it can be synthesized in vitro by operatively linking DNA encoding the guide RNA to a promoter control sequence recognized by a phage RNA polymerase. Examples of suitable phage promoter sequences include the T7, T3, and SP6 promoter sequences or variations thereof.
[0160] In some implementations, the guide RNA is expressed by DNA encoding it, such as a DNA vector containing a sequence encoding the guide RNA. The guide RNA can encode either alone or together with a nuclease. These DNA sequences can be introduced into the expression system (e.g., a cell) together or separately. For example, a DNA sequence encoding a nuclease and a DNA sequence encoding the guide RNA can be introduced into a cell; each DNA sequence can be part of a separate molecule (e.g., a vector containing a nuclease-encoding sequence and a second vector containing a guide RNA-encoding sequence), or both can be part of the same molecule (e.g., a vector containing sequences encoding (and regulating) both the nuclease and the guide RNA). The RNA can be transcribed from a synthetic DNA molecule (e.g., a gene fragment). Guide RNA molecules can be transcribed in vitro.
[0161] In some embodiments, such as those described above, RNA guides are synthesized using one or more modified nucleotides. In some embodiments, guide RNA is prepared by expressing an RNA guide sequence in cells transfected with a plasmid containing a sequence encoding guide RNA. In some embodiments, the plasmid encodes multiple different guide RNAs. In some embodiments, multiple different plasmids, each encoding a different guide RNA, are transfected into cells. In some embodiments, the guide RNA is expressed by a recombinant vector (e.g., a plasmid) that encodes both the guide RNA and a nuclease. In some embodiments, the guide RNA is expressed by a recombinant vector (e.g., a plasmid) that expresses the guide RNA but not the nuclease.
[0162] In some implementations, the guide RNA may be provided by a supplier.
[0163] 3. Preparation of Ribonucleic Acid Complex (RNP)
[0164] This document provides a ribonucleic acid complex (RNP) comprising a nuclease and a guide RNA of the present disclosure.
[0165] In some embodiments, the guide RNA targeting the HAO1 gene complexes with a nuclease to form a ribonucleoprotein (RNP). In some embodiments, the guide RNA and the nuclease complex to form the RNP at specific temperatures (e.g., between 20 and 50°C, specifically, at approximately 20°C, 25°C, 30°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, and 50°C). In some embodiments, the guide RNA does not dissociate from the nuclease at 37°C for a specific incubation period (e.g., at least approximately 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, or longer).
[0166] In some embodiments, the guide RNA and nuclease are complexed in a complexation buffer. In some embodiments, the pH of the complexation buffer is within a certain range. In some embodiments, it is in the range of about 7.3 to 8.6 (e.g., about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6).
[0167] In some embodiments, prior to purification as described herein, the nuclease can be overexpressed in host cells and complexed with guide RNA. In some embodiments, the mRNA or DNA encoding the nuclease is introduced into the cell, causing the nuclease to be expressed in the cell. In some embodiments, the guide RNA is also introduced into the cell simultaneously, individually, or sequentially from a single mRNA or DNA construct, causing the formation of an RNP complex in the cell.
[0168] III. Methods targeting the HAO1 gene
[0169] This disclosure also provides a method for targeted editing of the target sequence of the HAO1 gene.
[0170] In some embodiments, the method includes introducing a guide RNA and a nuclease targeting the HAO1 gene into cells. For example, an RNP formed by the guide RNA and nuclease targeting the HAO1 gene may be introduced into cells; or a nucleic acid vector expressing the guide RNA and nuclease targeting the HAO1 gene may be introduced into cells; or nuclease mRNA and guide RNA may be introduced into cells, optionally, template DNA may also be introduced. In some embodiments, the HAO1 gene in cells / tissues / humans is disrupted by delivering the compositions described herein to cells / tissues / humans.
[0171] 1. Design of target sequences
[0172] In some embodiments, the guide RNA disclosed herein is designed to be complementary to a target sequence adjacent to the PAM of the CasY7 polypeptide or a variant thereof. In some embodiments, the target sequence is within the regulatory sequence of the HAO1 gene, and the guide RNA binds to said target sequence via base pairing. In some embodiments, the cell contains one or more copies (e.g., 1, 2, 3, 4, 5, 6 or more) of the target sequence.
[0173] In some embodiments, the guide RNA of this disclosure targets the HAO1 gene located in mammalian cells. In some embodiments, the HAO1 gene is located in primate cells, preferably human cells. In some embodiments, the target sequence of the HAO1 gene is located in the cell nucleus. In some embodiments, the target sequence is endogenous to the cell. In some embodiments, the target sequence is located in genomic DNA. In some embodiments, the target sequence is located in chromosomal DNA. In some embodiments, the target sequence is located in the regulatory region of the HAO1 gene, such as a promoter, enhancer, 5' or 3' untranslated region, etc.
[0174] In some embodiments, the target sequence is adjacent to the 5'-TTN-3' PAM sequence, where N is any nucleotide. The 5'-TTN-3' sequence may be immediately adjacent to the target sequence, or, for example, within a small number (e.g., 1, 2, 3, 4, or 5) nucleotides of the target sequence. In some embodiments, the target sequence is ssDNA (single-stranded DNA). In some embodiments, the target sequence is dsDNA (double-stranded DNA). In some embodiments, the target sequence comprises both single-stranded and / or double-stranded regions.
[0175] In some embodiments, the guide RNA is programmed to bind to the first strand (non-PAM strand) of the double-stranded target nucleic acid, and the 5'-TTN-3' PAM sequence is present in the second complementary strand (PAM strand). In some embodiments, the guide RNA binds to the target sequence on the non-PAM strand, which is complementary to the target sequence on the PAM strand adjacent to the 5'-TTN-3' sequence.
[0176] In some implementations, the target sequence of the HAO1 gene is shown in SEQ ID NO.6-17.
[0177] 2. Gene Editing
[0178] This disclosure also provides methods for modifying target sequences of the HAO1 gene. In some embodiments, the method includes introducing a guide RNA targeting HAO1 and a nuclease into the cell.
[0179] In some implementations, the target sequence of the HAO1 gene is as shown in SEQ ID NO.6-17 or its reverse complementary sequence.
[0180] In some embodiments, the nuclease has nuclease activity. In some embodiments, CasY7 or a variant thereof induces one or more DNA double-strand breaks in a cell. In some embodiments, CasY7 or a variant thereof induces one or more DNA single-strand breaks in a cell. In some embodiments, CasY7 or a variant thereof induces one or more DNA nicks in a cell. In some embodiments, DNA breaks and / or nicks result in the formation of one or more insertions or deletions (e.g., one or more deletions).
[0181] In some embodiments, the guide RNA disclosed herein forms a complex with CasY7 or a variant thereof and guides it to a target sequence adjacent to the 5'-TTN-3' sequence. In some embodiments, the complex induces a deletion (e.g., a nucleotide deletion or a DNA deletion) adjacent to the 5'-TTN-3' sequence. In some embodiments, the complex induces a deletion adjacent to the following PAM sequences: 5'-TTA-3', 5'-TTT-3', 5'-TTG-3', or 5'-TTC-3'. In some embodiments, the deletion is downstream of the 5'-TTN-3' sequence, for example, downstream of the following sequences: 5'-TTA-3', 5'-TTT-3', 5'-TTG-3', or 5'-TTC-3'.
[0182] In some embodiments, the deletion results in altered HAO1 gene expression. In some embodiments, the deletion results in altered HAO1 gene function. In some embodiments, the deletion reduces or inactivates HAO1 gene function. In some embodiments, the deletion is a frameshift deletion or a non-frameshift deletion. In some embodiments, the deletion begins approximately 5 to approximately 10 nucleotides (e.g., approximately 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5'-TTN-3' sequence.
[0183] In some implementations, the methods described herein are used to engineer cells containing the deletions described herein in the HAO1 gene.
[0184] The compositions, vectors, nucleic acids, guide RNAs, and cells disclosed herein may be used for the treatment of type 1 hyperoxaluria (PH1). Any suitable delivery or administration method known in the art may be used to deliver the compositions, vectors, nucleic acids, guide RNAs, and cells disclosed herein. Such methods may involve contacting a target sequence with the compositions, vectors, nucleic acids, or guide RNAs disclosed herein. Such methods may involve methods of editing the HAO1 sequence as disclosed herein. In some embodiments, cells engineered using the guide RNAs of this disclosure are used for ex vivo gene therapy.
[0185] In some embodiments, the compositions, vectors, nucleic acids, guide RNAs, and cells of this disclosure are used to treat hyperoxaluria. In some embodiments, the compositions, vectors, nucleic acids, guide RNAs, and cells of this disclosure are used to treat type 1 hyperoxaluria. In some embodiments, one or more guide RNAs target exon regions of the HAO1 gene, and one or more guide RNAs are used to treat type 1 hyperoxaluria (PH1).
[0186] 3. Delivery
[0187] The compositions disclosed herein can be formulated.
[0188] In some aspects, this disclosure provides a polynucleotide that encodes a nuclease of the disclosed invention (e.g., CasY7 and its variants).
[0189] In another aspect, this disclosure provides a delivery composition comprising (1) a nuclease of this disclosure, a polynucleotide of this disclosure, or a composition thereof; and (2) a delivery vehicle.
[0190] In another aspect, this disclosure also provides a vector comprising the polynucleotides of this disclosure. In some embodiments, the vector encodes a guide nucleic acid as defined in this disclosure. In some embodiments, the vector is a plasmid vector, a recombinant AAV (rAAV) vector (vector genome), or a recombinant lentiviral vector.
[0191] In another aspect, this disclosure provides a recombinant AAV (rAAV) viral particle containing the rAAV vector genome of this disclosure. A brief introduction to AAV for delivery can be found in the "Adeno-Associated Virus (AAV) Guide" (addgene.org / guides / aav / ).
[0192] In some embodiments, the compositions of this disclosure include a delivery medium, such as liposomes, and are delivered to cells (e.g., prokaryotes, eukaryotes, plants, mammals, etc.) by known methods. These methods include, but are not limited to, transfection (e.g., lipid-mediated cationic polymers, calcium phosphate, dendritic structures); electroporation or other membrane disruption methods (e.g., nuclear transfection); viral delivery (e.g., lentiviruses, retroviruses, adenoviruses, adeno-associated viruses (AAVs)); microinjection; microparticle bombardment (“gene gun”); direct acoustic loading; cell extrusion; optical transfection; protoplast fusion; impale infection; magnetic transfection; exogenous bodies; lipid nanoparticle (LNP)-mediated transfer; and any combination thereof.
[0193] In some embodiments, the nuclease and guide RNA of the compositions of this disclosure are delivered together; exemplarily, the nuclease and guide RNA are packaged together in a single AAV particle.
[0194] In another example, the nuclease component and the guide RNA component are delivered together via LNP. In some embodiments, the nuclease component and the guide RNA component are delivered separately; exemplarily, the nuclease component and the guide RNA are packaged into separate AAV particles. In some cases, the nuclease component and the guide RNA are delivered in different ways; for example, the nuclease component is delivered via AAV particles, while the guide RNA is delivered via LNP.
[0195] In some embodiments, this disclosure provides an LNP comprising mRNA encoding a nuclease (e.g., CasY7 or a variant thereof), a guide RNA, or mRNA encoding both a nuclease and a guide RNA. In some embodiments, the transcription template of the mRNA encoding the CasY7 polypeptide is as shown in SEQ ID NO:5. In some embodiments, the transcription template of the mRNA encoding the CasY7 polypeptide is obtained by adaptively modifying (as opposed to the mutation mode of the CasY7 variant) the transcription template of the mRNA encoding the CasY7 polypeptide to obtain the mRNA transcription template of each variant.
[0196] Correspondingly, in some embodiments, this application further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) including or produced by such cells.
[0197] 4. Genetically modified cells
[0198] The compositions or complexes disclosed herein can be delivered to a variety of cells. In some embodiments, the cells are isolated cells. In some embodiments, the cells are in cell cultures or in co-cultures of two or more cell types. In some embodiments, the cells are ex vivo. In some embodiments, the cells are derived from a living organism and maintained in a cell culture. In some embodiments, the cells are single-celled organisms.
[0199] In some embodiments, the cell is a prokaryotic cell. In some embodiments, the cell is a bacterial cell. In some embodiments, the cell is an archaea cell. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is selected from animal cells, vertebrate cells, mammalian cells, non-human mammalian cells, non-human primate cells, rodent (e.g., mouse or rat) cells, human cells, plant cells, or yeast cells, or prokaryotic cells (e.g., bacterial cells). In some embodiments, the cell is a plant cell. In some embodiments, the cell is a fungal cell. In some embodiments, the cell is an animal cell. In some embodiments, the cell is an invertebrate cell. In some embodiments, the cell is a vertebrate cell. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a rodent cell. In some embodiments, the cell is synthetically made and is sometimes referred to as an artificial cell. In some implementations, the plant cells are derived from monocotyledons, such as rice, maize, wheat, barley, oats, sorghum, millet, grasses, Poaceae, Zizania, Avena, Coix, Hordeum, Oryza, Panicum (e.g., millet), Secale, Setaria (e.g., foxtail millet), Sorghum, Triticum, Zea, Cymbopogon, Saccharum (e.g., sugarcane), Phyllostachys, Dendrocalamus, Bambusa, and Yushania.
[0200] In some implementations, the cells are derived from animals such as pigs, cattle (ox), sheep, goats, mice, rats, alpacas, monkeys, rabbits, chickens, ducks, geese, and fish (e.g., zebrafish).
[0201] In some embodiments, the cells are derived from cell lines. A wide variety of cell lines used for tissue culture are known in the art. Examples of cell lines include, but are not limited to, 293T, MF7, K562, HeLa, and CHO. In some embodiments, the cells are immortalized or immortalized cells. In some embodiments, the cells are primary cells.
[0202] In some embodiments, the modified cell population is animal cells; for example, cells derived from rodents, rats, mice, rabbits, dogs, or non-human primates; for example, cynomolgus monkey cells. In some embodiments, the cells are human cells. In some embodiments, the cells are hepatocytes.
[0203] Any genetically modified cells produced using the compositions disclosed herein are also within the scope of this disclosure, and said modified cells may include a disrupted HAO1 gene.
[0204] The compositions, vectors, nucleic acids, guide RNAs, and cells disclosed herein can be used in therapies. The compositions, vectors, nucleic acids, guide RNAs, and cells disclosed herein can be used in methods of treating a subject's disease or condition. Any suitable delivery or administration method known in the art can be used to deliver the compositions, vectors, nucleic acids, guide RNAs, and cells disclosed herein. Such methods may involve contacting a target sequence with the compositions, vectors, nucleic acids, or guide RNAs disclosed herein. Such methods may involve methods of editing the HAO1 gene target sequence as disclosed herein. In some embodiments, cells engineered using the guide RNAs disclosed herein are used for ex vivo gene therapy.
[0205] IV. Application of Treatment
[0206] Any composition disclosed herein, or modified cells generated using a composition disclosed herein, may be used to treat diseases associated with the HAO1 gene. In some embodiments, diseases associated with the HAO1 gene are primary hyperoxaluria, exemplary including type 1 hyperoxaluria.
[0207] Any suitable delivery or administration method known in the art can be used to deliver the compositions, vectors, nucleic acids, guide RNAs, and cells disclosed herein. Such methods may involve contacting a target sequence with the compositions, vectors, nucleic acids, or guide RNAs disclosed herein. Such methods may involve methods for editing the HAO1 gene target sequence as disclosed herein. In some embodiments, cells engineered using the compositions disclosed herein can be used for ex vivo gene therapy.
[0208] The compositions disclosed herein, or modified cells generated using such compositions, can be used to treat diseases associated with the HAO1 gene, such as primary hyperoxaluria (PH). In some embodiments, primary hyperoxaluria (PH) includes PH1, PH2, or PH3. In some embodiments, the compositions disclosed herein target PH1.
[0209] In some embodiments, this disclosure provides methods for treating HAO1 gene-related diseases (e.g., PH, specifically, PH1), the methods comprising administering any of the compositions disclosed herein to a subject requiring treatment (e.g., a human patient); delivering the compositions of this disclosure to a specific tissue or cell in need; and in some embodiments, the compositions of this disclosure comprising one or more LNPs covering the nuclease and / or guide RNA components of this disclosure, one or more vectors (e.g., viral vectors) encoding one or more components of the compositions of this disclosure, or combinations thereof. In some embodiments, the compositions of this disclosure may be formulated to form pharmaceutical compositions, which may further comprise one or more pharmaceutically acceptable carriers, such as active agents in combinations of sterile water or sterile isotonic saline (e.g., the compositions of this disclosure or components thereof, or modified cells). Some formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous media, pastes, and implantable, sustained-release, or biodegradable formulations. Some formulations may further include one or more additional ingredients, including, but not limited to, suspending agents, stabilizers, or dispersants.
[0210] Pharmaceutical compositions may be in the form of sterile, injectable aqueous or oily suspensions or solutions. Such suspensions or solutions may be formulated according to known techniques and may include additional components besides cells, such as dispersants, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using non-toxic, parenteral-acceptable diluents or solvents, such as water or saline. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils, such as synthetic monoglycerides or diglycerides. Other available parenteral-application formulations include those that may include cells in packaged form, in liposome formulations, or as components of a biodegradable polymer system. Some compositions for sustained release or implantation may include pharmaceutically acceptable polymers or hydrophobic materials, such as emulsions, ion exchange resins, microsoluble polymers, or microsoluble salts.
[0211] In some embodiments, modified cells produced using any of the compositions disclosed herein can be administered to a subject requiring treatment (e.g., a human patient). Modified cells may include substitutions, insertions, and / or deletions in the HAO1 gene. In some embodiments, modified cells may comprise cell lines modified by nucleases (such as CasY7 or variants thereof), reverse transcriptases, and editing template RNAs (e.g., guide RNAs and RT donor RNAs). In some cases, modified cells may be a heterologous population comprising cells with different types of gene edits. Alternatively, modified cells may comprise a substantially homologous population of cells (e.g., at least 80% of the cells in the entire population) containing a specific gene edit in the HAO1 gene. In some instances, cells may be suspended in a suitable culture medium.
[0212] In some embodiments, the pharmaceutical compositions of this disclosure may be prepared, packaged, or marketed as formulations suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, intralesional, oral, ocular, intravenous, intra-organ, or other routes of administration. The pharmaceutical compositions of this disclosure may be prepared, packaged, or marketed in bulk as a single unit dose or multiple single unit doses. As used herein, a “unit dose” is a discrete amount of a pharmaceutical composition (e.g., a gene-editing system or a component thereof) that will be the amount administered to a subject or a convenient fraction of such a dose, such as half or one-third of such a dose.
[0213] In some implementations, a pharmaceutical composition comprising a gene-editing system or a component thereof as described herein may be administered to a subject in need, such as a subject suffering from liver disease associated with the HAO1 gene. In some cases, the gene-editing system or a component thereof may be delivered to specific cells or tissues (e.g., liver cells) where the gene-editing system can act to genetically modify the HAO1 gene in such cells.
[0214] In some embodiments, this disclosure provides a method of treating or preventing a disease or condition in a subject, the method comprising administering the composition or pharmaceutical composition described herein. In some embodiments, the disease or condition is PH1. In some embodiments, the composition or pharmaceutical composition described herein is administered in a unit dose, such as a single administration, as described above. In some embodiments, the unit dose achieves durable treatment and / or prevention. In some embodiments, the method achieves durable treatment and / or prevention. Durable treatment and / or prevention as used herein includes treatment and / or prevention extended for at least the following durations: 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 18 months, 24 months, 30 months, 36 months, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or longer. In some embodiments, a single dose of the composition or pharmaceutical composition described herein is sufficient to treat and / or prevent any of the indications described herein during the subject's lifetime.
[0215] Those skilled in the art will understand that the actual dose can vary considerably depending on a variety of factors, such as the choice of carrier, target cells, organism, tissue, general condition of the subject to be treated, the degree of transformation / modification sought, route of administration, mode of administration, and type of transformation / modification sought.
[0216] In some embodiments, the compositions of this disclosure or pharmaceutical compositions comprising thereof are administered intravenously to a subject. In some embodiments, the compositions or pharmaceutical compositions are administered into the hepatic circulation of a subject. In some embodiments, a single administration of a composition comprising the presently provided is sufficient to knock down the expression of the mutant protein. In some cases, multiple administrations of compositions or pharmaceutical compositions comprising this disclosure may result in better therapeutic effects. In some embodiments, treatment slows or halts the progression of PH1 disease.
[0217] In some implementations, the treatment slows or stops the progression of end-stage renal disease (ESRD). In some implementations, the treatment slows or stops the need for kidney and / or liver transplantation. In some implementations, the treatment leads to improvement, stabilization, or slowing of changes in PH1 symptoms.
[0218] V. Detection Methods
[0219] This disclosure also provides a method for detecting target DNA, the method comprising contacting the target DNA with a system of the present disclosure, wherein the target DNA is modified by the complex, and wherein the modification is detected in the target DNA. In some embodiments, the modification generates a detectable signal, such as a fluorescence signal.
[0220] VI. Kit and its uses
[0221] This disclosure also provides kits, for example, kits that can be used to implement, for example, the methods for genetic modification of the HAO1 gene described herein. In some embodiments, the kits of this disclosure comprise guide RNA and a nuclease (CasY7 or a variant thereof). In some embodiments, the kits of this disclosure comprise guide RNA, template DNA, and a nuclease (CasY7 or a variant thereof). In some embodiments, the kit comprises a polynucleotide encoding the nuclease (CasY7 or a variant thereof) of this disclosure, and optionally the polynucleotide is included within any vector, for example, as described herein. In some embodiments, the kits of this disclosure comprise a polynucleotide encoding the guide RNA disclosed herein. In some embodiments, the nuclease CasY7 or a variant thereof (or a polynucleotide encoding CasY7 or a variant thereof) and the guide RNA (e.g., as a ribonucleoprotein) may be packaged in the same container (e.g., a vial) within the kit, or may be packaged in separate containers (e.g., vials) whose contents may be mixed prior to use.
[0222] In some embodiments, the kit of this disclosure may additionally include instructions for use of optional buffers, guide RNA, template DNA, and / or nucleases. In some embodiments, the kit includes one or more buffers that can be used to dissolve any of the one or more components contained therein, and / or to provide suitable reaction conditions for one or more of the components. Exemplarily, the buffer may include one or more of the following: PBS, HEPES, Tris, MOPS, Na₂CO₃, NaHCO₃, NaB, or combinations thereof. In some embodiments, reaction conditions include a suitable pH, such as an alkaline pH. In some embodiments, the pH is between 7 and 10.
[0223] In some implementations, any one or more of the kit components may be stored in a suitable container or at a suitable temperature, such as 4°C.
[0224] All references and publications cited in this article are hereby incorporated by way of citation.
[0225] Example
[0226] The following examples are provided to further illustrate some embodiments of this disclosure, but are not intended to limit the scope of this disclosure; it will be understood by their exemplary nature that other procedures, methods or techniques known to those skilled in the art may be used alternatively.
[0227] Example 1: Constructing a variant of CasY7
[0228] To identify more nucleases, the applicant used bioinformatics to annotate and obtain the CasY7 protein (amino acid sequence as shown in SEQ ID NO.1, nucleotide coding sequence as shown in SEQ ID NO.2), DR sequence (SEQ ID NO.3) and PAM preference (5'-TTN-3'), optimized DR-1 (SEQ ID NO.4), etc. (PCT / CN2024 / 092707, the entire contents of which are incorporated herein by reference).
[0229] Based on protein function prediction, it was believed that engineered mutations at positions 282-920 of the CasY7 polypeptide amino acid sequence might affect its cleavage activity. Therefore, using the CasY7 expression plasmid as a template, PCR primers were designed centered on the predicted mutation site. The mutated nucleotide sequence was introduced into the PCR primers, and engineered mutations were performed. The details of CasY7 and its variants are shown in Table 1 below:
[0230] Table 1. Mutation patterns of CasY7 (relative to CasY7)
[0231]
[0232]
[0233] Example 2: CasY7 and its variants target HAO1 in HepG2 cells
[0234] 1. mRNA transcription templates for CasY7 and its variants were synthesized by Nanjing GenScript (the CasY7-WT mRNA transcription template sequence is shown in SEQ ID NO. 5, and the mRNA transcription template sequences of each variant are adaptively changed according to the mutation). The T7 High Yield RNA Synthesis Kit (NEB, E2040S) was used to perform in vitro transcription to obtain the mRNA of each nuclease.
[0235] 2. Based on the PAM (5'-TTN-3') of CasY7 and its variants, a spacer sequence was designed 20 bp downstream of the PAM sequence. A crRNA sequence was designed using the optimized DR sequence (DR-1, SEQ ID NO.4):
[0236] crRNA name PAM target sequence crRNA sequence Target sequence location HAO1-crRNA-1 TTT SEQ ID NO.6 SEQ ID NO.18 promoter HAO1-crRNA-2 TTG SEQ ID NO.7 SEQ ID NO.19 exon1 HAO1-crRNA-3 TTA SEQ ID NO.8 SEQ ID NO.20 exon2 HAO1-crRNA-4 TTA SEQ ID NO.9 SEQ ID NO.21 exon2 HAO1-crRNA-5 TTG SEQ ID NO.10 SEQ ID NO.22 exon4 HAO1-crRNA-6 TTA SEQ ID NO.11 SEQ ID NO.23 exon4 HAO1-crRNA-7 TTG SEQ ID NO.12 SEQ ID NO.24 exon4 HAO1-crRNA-8 TTC SEQ ID NO.13 SEQ ID NO.25 exon4 HAO1-crRNA-9 TTG SEQ ID NO.14 SEQ ID NO.26 promoter HAO1-crRNA-10 TTC SEQ ID NO.15 SEQ ID NO.27 promoter HAO1-crRNA-11 TTG SEQ ID NO.16 SEQ ID NO.28 promoter HAO1-crRNA-12 TTA SEQ ID NO.17 SEQ ID NO.29 promoter
[0237] HAO1-crRNA-4 was synthesized by GenScript in Nanjing and delivered to HepG2 cells via LNP, as detailed below:
[0238] A four-component LNP lipid delivery system (purchased from Ivetop (Shanghai) Pharmaceutical Technology Co., Ltd.) was used. Specifically, Yoltech Lipid1 (compound 10), DSPC, cholesterol, and PEG-DMG were dissolved in anhydrous ethanol at a molar ratio of 50:10:38.5:1.5. CasY7 and its variant mRNA were dissolved separately with hHAO-crRNA targeting the hHAO1 gene (mass ratio 1:1) in 100 mM enzyme-free citrate buffer at pH 4 (RNA concentration 0.2 mg / mL). The ethanol solution of the lipid carrier and the buffer of mRNA were mixed at a 1:3 (volume / volume) ratio (total lipid to mRNA mass ratio 40:1) and flowed through a microfluidic nanomedicine manufacturing system (NanoAssemblr Ignite, Canada) at a flow rate of 12 ml / min to obtain nucleic acid lipid nanoparticles. The obtained nucleic acid lipid nanoparticles were immediately diluted 40-fold in 1×DPBS buffer.
[0239] HepG2 cells (purchased from ATCC) were seeded in DMEM medium (Gibco, 11965092) supplemented with 10% FBS (v / v) containing 1% Penicillin Streptomycin (v / v) (Gibco, 15140122) and cultured in a 37°C cell culture incubator containing 5% CO2. Cells for transfection were seeded in 96-well cell culture plates the day before transfection and observed the following day. LNP transfection was performed when the cell density reached approximately 80%. LNP@mRNA (transfection dose of 40 ng / well) was added to HepG2 cells. Cells were collected 48 hours after transfection, and genomic DNA was extracted from the collected cells (TIANGEN, DP304-03). Cleavage activity was assessed, amplified by PCR, and sequenced by Beijing Qingke Biotechnology Co., Ltd.
[0240] The synthetic method of Yoltech Lipid1 (compound 10, PCT / CN2024 / 104304, the entire contents of which are incorporated herein by reference) is as follows:
[0241] 5-[(2-Butyl-1-oxylidene octyl)oxy]valerate-7-butyl-21-(10-butyl-3,9-dioxylidene-2,8-dioxahexadecane-1-yl)-19-[3-(diethylamino)propyl]-8-oxylidene-19-aza-9-oxadodecane-22-yl ester
[0242]
[0243] Step 1: Synthesis of Compounds 1-2
[0244] In a 500 mL round-bottom flask, cyclohexyl ester (25.00 g, 249.70 mmol, 1.0 eq), distilled water (20 mL), ethanol (200 mL), and sodium hydroxide (10.99 g, 274.67 mmol, 1.1 eq) were added. After reacting at 70 °C for 3 hours, the solvent was removed by concentration under reduced pressure. Then, 200 mL of acetone, tetrabutylammonium iodide (4.61 g, 12.48 mmol, 0.05 eq), and benzyl bromide (51.25 g, 299.64 mmol, 1.2 eq) were slowly added to the flask, and the reaction was continued overnight at 70 °C. The reaction was quenched with 500 mL of water, and the mixture was extracted twice with 500 mL of ethyl acetate. The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by column chromatography to give benzyl 5-hydroxyvalerate (37.00 g, 71.2% yield).
[0245] Step 2: Synthesis of compounds 1-4
[0246] In a 500 mL round-bottom flask, benzyl 5-hydroxypentanoate (37.00 g, 177.67 mmol, 1.0 eq), 2-butyloctanoic acid (35.59 g, 177.67 mmol, 1.0 eq), 250 mL of dichloromethane, and 4-dimethylaminopyridine (21.70 g, 177.67 mmol, 1.0 eq) were added, followed by 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (51.09 g, 266.50 mmol, 1.5 eq). The reaction was carried out at room temperature for 4 hours. The mixture was diluted with 500 mL of water and extracted twice with 500 mL of dichloromethane. The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by column chromatography to give 2-butyloctanoate-5-(benzyloxy)-5-oxylidenepentyl ester (64.00 g, 92.2% yield).
[0247] Step 3: Synthesis of compounds 1-5
[0248] In a 250 mL round-bottom flask, 2-butyloctanoic acid-5-(benzyloxy)-5-oxylidene pentyl ester (64.00 g, 163.87 mmol, 1.0 eq), methanol (75 mL), tetrahydrofuran (75 mL), and finally Pd / C (3.49 g, 32.78 mmol, 0.2 eq, 10% purity) were added. The reaction was carried out at room temperature under a hydrogen atmosphere at one atmosphere for 16 hours. The mixture was then filtered and concentrated to give compound 5-[(2-butyl-1-oxylidene octyl)oxy]pentanoic acid (45.00 g, yield 91.4%).
[0249] Step 4: Synthesis of compounds 1-7
[0250] At room temperature, 5-[(2-butyl-1-oxomylidene octyl)oxy]valerate (10.00 g, 33.29 mmol, 1.0 eq), 2-hydroxymethylpropane-1,3-diol (3.53 g, 33.29 mmol, 1.0 eq), 4-dimethylaminopyridine (0.81 g, 6.66 mmol, 0.2 eq), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (9.57 g, 49.94 mmol, 1.5 eq) and N,N-diisopropylethylamine (8.60 g, 66.58 mmol, 2.0 eq) were added to a round-bottom flask containing 100 mL of dichloromethane, and the mixture was stirred at room temperature for 4 hours. The reaction solution was quenched with 200 mL of water, extracted twice with 200 mL of dichloromethane, the organic phases were combined, washed with brine, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to obtain 2-butyloctanoic acid-18-butyl-8-(hydroxymethyl)-5,11,17-trioxane-6,10,16-trioxane-1-yl ester (7.80 g, yield 69.9%).
[0251] Step 5: Synthesis of compounds 1-8
[0252] At room temperature, 3.90 g (5.81 mmol, 1.0 eq) of compound 2-butyloctanoic acid-18-butyl-8-(hydroxymethyl)-5,11,17-trioxane-6,10,16-trioxanetetracosane-1-yl ester and triethylamine (1.76 g, 17.43 mmol, 3.0 eq) were added to 30 mL of dichloromethane. Methanesulfonic anhydride (2.02 g, 11.62 mmol, 2.0 eq) was slowly added at 0°C, and the mixture was slowly brought back to room temperature. The reaction was allowed to proceed for 4 hours. The reaction solution was quenched with 30 mL of water and extracted twice with 50 mL of dichloromethane. The organic phases were combined, washed with brine, dried over anhydrous sodium sulfate, filtered, concentrated, and purified by column chromatography to obtain 12-butyl-2-(10-butyl-3,9-dioxane-2,8-dioxahexadecane-1-yl)-5,11-dioxane-4,10-dioxaoctadecane-1-yl ester (3.85 g, yield 88.4%).
[0253] Step 6: Synthesis of compounds 1-10
[0254] Compounds 1-8 (600.0 mg, 0.80 mmol, 1.0 eq), 3-amino-1-propanol (300.0 mg, 3.99 mmol, 5.0 eq), potassium carbonate (280.0 mg, 2.00 mmol, 2.5 eq), and potassium iodide (130.0 mg, 0.80 mmol, 1.0 eq) were added to 10 mL of acetonitrile under nitrogen protection and heated to 90 °C for 16 hours. The reaction solution was concentrated, diluted with water, and extracted three times with ethyl acetate. The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to give compound 5-[(2-butyl-1-oxoylideneoctyl)oxy]valerate-12-butyl-2-{[(3-hydroxypropyl)amino]methyl}-5,11-dioxoylidene-4,10-dioxaoctadecane-1-yl ester (210.0 mg, 36.11%). MS: m / z [M+H] + =728.6.
[0255] Step 7: Synthesis of Compound 10
[0256] At room temperature, 2-butyloctanoic acid-8-(10-butyl-3,9-dioxayne-2,8-dioxahexadecane-1-yl)-14-ethyl-5-oxayne-10,14-diaza-6-oxahexadecane-1-yl ester (500.0 mg, 0.64 mmol, 1.0 eq), 2-butyloctanoic acid-9-bromononyl ester (390.0 mg, 0.96 mmol, 1.5 eq), potassium carbonate (270.0 mg, 1.92 mmol, 3.0 eq), and potassium iodide (110.0 mg, 0.64 mmol, 1.0 eq) were added to 20 mL of acetonitrile, heated to 90 °C under nitrogen protection, and reacted overnight. The reaction solution was concentrated, diluted with water, and extracted three times with dichloromethane. The organic phases were combined, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated, and purified by column chromatography to give 5-[(2-butyl-1-oxoylidene octyl)oxy]valerate-7-butyl-21-(10-butyl-3,9-dioxoylidene-2,8-dioxahexadecane-1-yl)-19-[3-(diethylamino)propyl]-8-oxoylidene-19-aza-9-oxadodecane-22-yl ester (132.8 mg, yield 18.8%). MS: m / z [M+H] + =1107.9. 1 H NMR(300MHz, CDCl3)δ4.15-4.01(m,10H),3.44-3.20(m,4H),2.71-2.50(m,6H), 2.39-2.23(m,12H),2.02-1.40(m,28H),1.38-1.22(m,48H),0.92-0.75(m,18H).
[0257] Analysis showed that all variants of CasY7 and the guide RNA (HAO1-crRNA-4) mediated significant targeted cleavage activity. Figure 1 ).
[0258] 3. To investigate the mediating effects of HAO1-crRNA-1, HAO1-crRNA-2, HAO1-crRNA-3, HAO1-crRNA-5, HAO1-crRNA-6, HAO1-crRNA-7, HAO1-crRNA-8, HAO1-crRNA-9, HAO1-crRNA-10, HAO1-crRNA-11, and HAO1-crRNA-12, variant C30725 was selected as the research subject, and HAO1-crRNA-4 was used as a control in the experiment:
[0259] (1) The encoding nucleotide sequence of C30725 was constructed into the ABE8e plasmid (Addgene, Plasmid#138489) at positions 466-5160 to obtain the C30725 expression plasmid.
[0260] Construct a HAO1-crRNA expression plasmid, add a CACC sequence to the 5' end of the upstream sequence of the HAO1-crRNA and an AAAA sequence to the 5' end of the downstream sequence, and synthesize oligos, as follows:
[0261]
[0262]
[0263] (2) After the synthesis of the aforementioned HAO1-crRNA upstream and downstream sequences, the samples were annealed using a pre-defined program (95℃, 5 min; decreasing from 95℃ to 85℃ at -2℃ / s; decreasing from 85℃ to 25℃ at -0.1℃ / s). The annealed products were then ligated into the PHK09T vector linearized by BsmBI (NEB, #R0580L) (the sequence of the PHK09T vector is shown in SEQ ID NO.30; plasmid map can be found in [link to plasmid map]). Figure 3 ).
[0264] The linearization of the PHK09T vector and its ligation with the HAO1-crRNA annealing product are as follows:
[0265] First, the PHK09T vector was linearized. The linearization system is as follows:
[0266] 3 μg PHK09T vector; 6 μL buffer (NEB, #R0539L); 2 μL BsmBI; ddH2O to bring the total to 60 μL; digest overnight at 50°C.
[0267] HAO1-crRNA annealing product and linearized vector ligation system:
[0268] 1 μL of T4 ligase buffer (NEB, #M0202L), 20 ng of linearized vector, 5 μL of annealed oligo fragment, 0.5 μL of T4 ligase (NEB, #M0202L), and ddH2O to bring the total volume to 10 μL. Incubate overnight at 16°C.
[0269] (3) The HAO1-crRNA expression plasmid obtained in step (2) was transferred to Escherichia coli DH5α competent cells (Weidi Bio, DL1001) for amplification. The plasmid was then extracted (using an endotoxin-free plasmid large-scale extraction kit, TIANGEN: DP120-01). The plasmid concentration was measured and stored for later use to obtain the HAO1-crRNA expression plasmid.
[0270] (4) HEK293T cells (purchased from ATCC) were seeded in DMEM medium (Gibco, 11965092) supplemented with 10% FBS (v / v) containing 1% Penicillin Streptomycin (v / v) (Gibco, 15140122) and cultured in a cell culture incubator at 37°C with 5% CO2. Cells for transfection were seeded in 24-well cell culture plates the day before and observed the next day. Transfection was performed when the cell density reached approximately 80%.
[0271] The C30725 expression plasmid and the HAO1-crRNA expression plasmid were transfected into HEK293T cells. The amount of plasmid used per well in a 24-well plate was 0.3 μg of C30725 expression plasmid, 0.3 μg of HAO1-crRNA expression plasmid, and 0.3 μg of EGFP-C1 plasmid (control plasmid).
[0272] The specific transfection procedure is as follows:
[0273] The C30725 expression plasmid, HAO1-crRNA expression plasmid, and EGFP-C1 plasmid were mixed separately and then used in 25 μl of water. Dilute serum-depleted transfection medium (Yuanpei Biotechnology, L530KJ) with 2 μl of Lipofectamine 3000 (Invitrogen, L3000015) reagent, mix well by pipetting, and let stand for 5 minutes. Simultaneously, dilute 2 μl of Lipofectamine 3000 transfection reagent (Invitrogen, L3000015) with 25 μl of... Dilute and mix the serum-depleted transfection medium (Yuanpei Biotechnology, L530KJ) as reagent B, and let stand for 5 minutes.
[0274] Mix reagent A and reagent B thoroughly and let stand for 20 minutes. After standing, add the mixed reagent dropwise to the cells in the 24-well plate to be transfected, and return to a 37°C, 5% CO2 incubator. Six hours after transfection, change the culture medium to DMEM medium containing 10% FBS.
[0275] (5) Forty-eight hours after transfection, EGFP fluorescent protein expression indicated successful cell transfection. Cells expressing EGFP were sorted for editing efficiency testing. Genomic DNA was extracted from the cells (using a genomic DNA extraction kit, TIANGEN, DP304-03). Using the genome as a template, PCR amplification was performed on sequences near the target site using the PCR primers listed in the table below:
[0276] crRNA upstream primer Downstream primer HAO1-crRNA-1 GGCAGATAGTGACTTCGGTGT GCTATCCCAGATGGAGTTCGT HAO1-crRNA-2 AAAATGCTCCCCCGGCTAAT CCTGGAAAATGCTGCAATAT HAO1-crRNA-3 GAAGTCATTTGCTTGTTTGG GCCGTAGCCCCCACACATAT HAO1-crRNA-4 GATGCTCCGGAATGTTGCTG GTTAGCCTCCTTCTGTCCCT HAO1-crRNA-5 acagccaattgatttgaaaagggt ccatttgatatcttcccagc HAO1-crRNA-6 acagccaattgatttgaaaagggt ccatttgatatcttcccagc HAO1-crRNA-7 acagccaattgatttgaaaagggt ccatttgatatcttcccagc HAO1-crRNA-8 acagccaattgatttgaaaagggt ccatttgatatcttcccagc HAO1-crRNA-9 GGCAGATAGTGACTTCGGTGT GCTATCCCAGATGGAGTTCGT HAO1-crRNA-10 GGCAGATAGTGACTTCGGTGT GCTATCCCAGATGGAGTTCGT HAO1-crRNA-11 GGCAGATAGTGACTTCGGTGT GCTATCCCAGATGGAGTTCGT HAO1-crRNA-12 GGCAGATAGTGACTTCGGTGT GCTATCCCAGATGGAGTTCGT
[0277] The PCR amplification system is as follows:
[0278] 25 μL of 2×Taq Master Mix (Vazyme, P112-03); 1 μL of Primer-F (HAO1-F) (10 pmol / μL); 1 μL of Primer-R (HAO1-R) (10 pmol / μL); 1 μL of template; ddH2O to bring the total to 50 μL.
[0279] Primers were designed for identification, and after PCR amplification, the obtained PCR products were used for high-throughput deep sequencing (Qingke Biotechnology Co., Ltd.) or Sanger sequencing (Platinum Biotechnology (Shanghai) Co., Ltd.) to identify editing efficiency. Analysis showed that each crRNA mediated significant cleavage activity. Figure 2 ).
[0280] Example 3: Off-target identification of CasY7 variants and guide RNA
[0281] To evaluate the application of the CasY7 variant in human cells, 133 gene sites that may be subject to off-target cleavage and off-target prototypical spacer sequences (DNA sequences) were predicted based on the HAO1-crRNA-4 target sequence (SEQ ID NO.8) and its PAM (5'-TTA-3') sequence (see Table 2).
[0282] The C30725 variant and HAO1-crRNA-4 were used as research subjects, and HepG2 cells were transfected using the same dosage and method as in steps 1-2 of Example 2. Deep sequencing was used to detect on-target and off-target activities. Analysis showed that, compared with the control group (LNP containing only C30725 variant mRNA), the C30725 variant showed virtually no off-target cleavage activity at the predicted sites (Table 2).
[0283] This indicates that the targeted editing mediated by the C30725 variant and HAO1-crRNA-4 did not show significant off-target effects and had high fidelity.
[0284] Table 2. Possible off-target site predictions, corresponding interval sequences, and editing efficiency.
[0285]
[0286]
[0287]
[0288]
[0289]
[0290] Example 4: HAO1 gene editing in animals
[0291] To study the in vivo editing effect of the HAO1 gene-targeting composition, 6-7 week old female C57BL / 6 mice (purchased from Jiangsu Jicui Pharmaceutical Co., Ltd.) were selected as the research subjects.
[0292] Lipid nanoparticles (LNPs) encapsulating variant C30725 mRNA and HAO1-crRNA-4 were prepared using the same method as in steps 1-2 of Example 2, and administered systemically via tail vein injection at a dose of 0.2 mg / kg. Mice of similar age and sex were administered PBS buffer via tail vein injection as a negative control. Editing efficiency was assessed one week after administration. Mice were sacrificed, liver tissue was harvested, lysed, and the genome was extracted. Efficiency analysis was performed using deep sequencing. The deep sequencing results were analyzed using Crispresso software for specific site analysis to determine the editing efficiency. The analysis showed that the in vivo editing efficiency of the HAO1 gene-targeting composition was 50%, indicating that the nuclease disclosed in this invention exhibits significant genome editing efficiency in mammalian cells, demonstrating its excellent potential for therapeutic genome editing applications.
[0293] In summary, the compositions disclosed herein possess robust editing activity and highly specific therapeutic applications.
[0294] Sequence information
[0295]
[0296]
[0297]
[0298]
[0299]
[0300]
[0301]
[0302] Various modifications and variations to the products, methods, and uses described herein will be apparent to those skilled in the art without departing from the scope and spirit of this disclosure. Although this disclosure has been described in conjunction with specific embodiments, it will be understood that further modifications are possible, and the claimed disclosure should not be unduly limited to such specific embodiments. Indeed, various modifications to the manner in which this disclosure is performed, as apparent to those skilled in the art, are intended to fall within the scope of this disclosure. This application is intended to cover any variations, uses, or adaptations of this disclosure that generally follow the principles of this disclosure, and includes deviations from this disclosure that remain within the known and customary practices of the art to which this disclosure pertains and are applicable to the essential features previously shown.
Claims
1. A nuclease comprising an amino acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to SEQ ID NO.
1.
2. The nuclease of claim 1, comprising substitution at one or more of the following positions: positions 175, 176, 282, 283, 285, 416, 417, 418, 419, 420, 788, and 829 of SEQ ID NO.
1. Preferably, comprising the following mutation pattern: (i) Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420; or (ii) E176 + Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420. Preferably, comprising the following mutation pattern: Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420; A175 + E176 + Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420; E176 + Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420 + E788; or E176 + Y282 + D283 + A285 + G416 + I417 + E418 + F419 + D420 + E829. More preferably, the nuclease is selected from the following mutation pattern: Y282F + D283Q + A285T + G416L + I417Q + E418M + F419R + D420A; A175R + E176R + Y282F + D283Q + A285T + G416L + I417Q + E418M + F419R + D420A; E176R + Y282F + D283Q + A285T + G416L + I417Q + E418M + F419R + D420A + E788R; or E176R + Y282F + D283Q + A285T + G416L + I417Q + E418M + F419R + D420A + E829R.
3. A composition targeting HAOl gene for gene editing of HAOl gene, characterized in that, The composition comprises: (i) a nuclease or a first nucleic acid encoding the nuclease of claim 1 or 2; (ii) a guide RNA or a second nucleic acid encoding the guide RNA, wherein the guide RNA comprises a spacer sequence specific to a target sequence within a HAO1 gene.
4. The composition of claim 3, comprising the first nucleic acid encoding the nuclease, which is codon-optimized for expression in a eukaryotic cell.
5. The composition of claim 3 or 4, wherein the target sequence is within a promoter or an exon of the HAO1 gene, preferably, the target sequence is located in a promoter, a first exon, a second exon, or a fourth exon sequence of the HAO1 gene.
6. The composition according to claim 5, said spacer sequence having a length of 15-100 nucleotides, preferably 16 to 50 nucleotides, more preferably 17 to 30 nucleotides, more preferably 18 to 22 nucleotides, more preferably 20 nucleotides.
7. The composition according to any one of claims 3-6, said target sequence being adjacent to a protospacer adjacent motif (PAM) comprising the sequence 5'-TTN-3'.
8. The composition according to any one of claims 3-7, said target sequence being selected from the group consisting of: (i) GCCAAAGTTCAGATTTAGTTCTC (SEQ ID NO. 6); (ii) CCCCAGACCTGTAATAGTCATAT (SEQ ID NO. 7); (iii) ATTCTAGATGGAAGCTGTATCCA (SEQ ID NO. 8); (iv) GGACAGAGGGTCAGCATGCCAAT (SEQ ID NO. 9); (v) GAGACGACAGTGGACTTGCTGCA (SEQ ID NO. 10); (vi) GCCACATATGCAGCAAGTCCACT (SEQ ID NO. 11); (vii) AAACCAGTACTTTATCATTTT (SEQ ID NO. 12); (viii) ATCCTAAAATAAGAAATGCAT (SEQ ID NO. 13); (ix) GCAAAAGTCTATTAATAATT (SEQ ID NO. 14); (x) TACATCCTCACTGTTCTGTT (SEQ ID NO. 15); (a) TCAATTATTAATAGACTTTT (SEQ ID NO. 16); or (b) TTTGTCAATTATTAATAGAC (SEQ ID NO. 17).
9. The composition according to any one of claims 3-8, said spacer sequence being optionally selected from the group consisting of: (i) GCCAAAGUUCAGAUUUAGUUCUC (SEQ ID NO. 31); (ii) CCCCAGACCUGUAAUAGUCAUAU (SEQ ID NO. 32); (iii) AUUCUAGAUGGAAGCUGUAUCCA (SEQ ID NO. 33); (iv) GGACAGAGGGUCAGCAUGCCAAU (SEQ ID NO. 34); (v) GAGACGACAGUGGACUUGCUGCA (SEQ ID NO. 35); (vi) GCCACAUAUGCAGCAAGUCCACU (SEQ ID NO. 36); (vii) AAACCAGUACUUUAUCAUUUU (SEQ ID NO. 37); (xii) UUUGUCAAUUAUUAAUAGAC (SEQ ID NO. 42); (xii) UUUGUCAAUUAUUAAUAGAC (SEQ ID NO. 42); (xii) UUUGUCAAUUAUUAAUAGAC (SEQ ID NO. 42); (xii) UUUGUCAAUUAUUAAUAGAC (SEQ ID NO. 42); (xii) UUUGUCAAUUAUUAAUAGAC (SEQ ID NO. 42).
10. The composition of any one of claims 3-9, wherein the guide RNA comprises the spacer sequence and a direct repeat (DR) sequence.
11. The composition of any one of claims 3-10, wherein the direct repeat sequence has a nucleotide sequence that is at least about 50% (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to the nucleotide sequence set forth in SEQ ID NO. 3 or 4.
12. The composition of any one of claims 3-11, the guide RNA is selected from any one of SEQ ID NOS. 18-29, 43-54.
13. The composition of any one of claims 3-12, wherein the second nucleic acid encoding the guide RNA has been codon-optimized for expression in a eukaryotic cell.
14. A polynucleotide encoding the nuclease and / or guide RNA of any one of claims 3-13.
15. A vector comprising the polynucleotide of claim 14; optionally, wherein the vector encodes the guide RNA as described in any one of claims 3-13; optionally, wherein the vector is a plasmid vector, a recombinant AAV (rAAV) vector, or a recombinant lentivirus vector.
16. A ribonucleoprotein (RNP) comprising the nuclease of claim 1 or 2 and optionally the guide RNA as defined in any one of claims 3-13.
17. A lipid nanoparticle (LNP) comprising the nuclease of claim 1 or 2 or the composition of any one of claims 3-13.
18. A kit comprising the composition of any one of claims 3-13, the polynucleotide of claim 14, the vector of claim 15, or the ribonucleoprotein (RNP) of claim 16.
19. A cell comprising the composition of any one of claims 3-13, the polynucleotide of claim 14, or the vector of claim 15, and obtained after gene editing of the cell by the composition, nucleic acid, or vector.
20. The cell of claim 20, which is a eukaryotic cell; preferably, a rodent cell (e.g., a mouse cell, a rat cell), a non-human primate cell, or a human cell, preferably, comprising a hepatocyte.
21. A pharmaceutical composition comprising the composition of any one of claims 3-13, the vector of claim 15, the ribonucleoprotein (RNP) of claim 16, the lipid nanoparticle (LNP) of claim 17, or the cell of any one of claims 19-20; and a pharmaceutically acceptable carrier or excipient.
22. A formulation characterized in that, The formulation contains the composition of any one of claims 3-13, the polynucleotide of claim 14, the vector of claim 15, the ribonucleoprotein (RNP) of claim 16, the lipid nanoparticle (LNP) of claim 17, the pharmaceutical composition of claim 18, or the cell of claim 20 or 21, and a pharmaceutically acceptable carrier, diluent, or excipient.
23. A guide RNA comprising (i) a spacer sequence specific for a target sequence in a HAOl gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM) located 5' of the target sequence comprising the motif 5'-TTN-3'; and (ii) a direct repeat sequence; optionally, the target sequence is selected from any one of SEQ ID NOs. 6-17; optionally, the spacer sequence is selected from any one of SEQ ID NOs. 31-42; optionally, the guide RNA sequence is selected from any one of SEQ ID NOs. 18-29, any one of SEQ ID NOs. 43-54.
24. A method for editing a HAOl gene in a cell, the method comprising contacting a host cell with the composition of any one of claims 3-13, the polynucleotide of claim 14, the vector of claim 15, or the ribonucleoprotein (RNP) of claim 16, to genetically edit the HAOl gene in the host cell.
25. The method of claim 24, wherein the contacting occurs ex vivo, in vivo, or in vitro.
26. A method for treating hyperoxaluria in a subject, the method comprising administering to a subject in need thereof a composition for editing a HAOl gene of any one of claims 3-13, the polynucleotide of claim 14, the vector of claim 15, or the ribonucleoprotein (RNP) of claim 16, the lipid nanoparticle (LNP) of claim 17, the pharmaceutical composition of claim 18, or the cell of any one of claims 20-21 or the formulation of claim 22.
27. The method of claim 26, wherein the subject is a human patient having hyperoxaluria, optionally, the hyperoxaluria is primary hyperoxaluria type 1 (PH1).