N-acetyl amino acid racemase mutant with improved racemization activity and application of N-acetyl amino acid racemase mutant
By performing site-directed mutagenesis on N-acetylamino acid racemic enzymes, especially the I293L and T21A/I293L mutations, its racemic activity for N-acetyl-L-tryptophan was improved, solving the problem of low D-tryptophan production efficiency in existing technologies and achieving more efficient D-tryptophan preparation.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-18
- Publication Date
- 2026-03-31
AI Technical Summary
Existing N-acetyl amino acid racemic enzymes have low racemic activity for the substrate N-acetyl-L-tryptophan, resulting in low D-tryptophan production efficiency and high cost.
The racemic activity of N-acetylamino acid racemase was enhanced by site-directed mutagenesis, specifically by mutating isoleucine at position 293 of the amino acid sequence to leucine (I293L) and threonine at position 21 to alanine (T21A/I293L).
The mutant N-acetyl amino acid racemic enzyme significantly improved the racemic activity of N-acetyl-L-tryptophan, catalyzing the efficiency and yield of D-tryptophan and reducing production costs.
Smart Images

Figure SMS_1
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering and relates to an N-acetylamino acid racemic enzyme mutant with enhanced racemic activity and its applications. Background Technology
[0002] N-acetylated amino acid racemase (NAAAR) catalyzes the racemic reaction of N-acetylated amino acids. Using N-acetylated amino acids as a starting material, it can react simultaneously with L- or D-aminoacylases to dynamically resolve and produce L- or D-amino acids. Theoretically, the reaction yield can reach 100% under the racemic action of N-acetylated amino acid racemase. D-tryptophan is an important amino acid with significant applications in biomedicine, food, and agriculture. It can serve as a precursor for the synthesis of the drug tadalafil, and also as a non-nutritive sweetener, feed additive, and plant growth promoter. N-acetyl-L-tryptophan can be converted to N-acetyl-D-tryptophan by N-acetylated amino acid racemase. Further hydrolysis of N-acetyl-D-tryptophan by D-aminoacylase yields D-tryptophan. A drawback of this method for preparing D-tryptophan is the low racemic activity of N-acetylated amino acid racemase for the substrate N-acetyl-L-tryptophan. Summary of the Invention
[0003] The purpose of this invention is to provide a mutant of N-acetylamino acid racemic enzyme with enhanced racemic activity to address the shortcomings of existing N-acetylamino acid racemic enzymes. This mutant can improve the racemic activity of N-acetylamino acid racemic enzyme for N-acetyl-L-tryptophan, and can be further used in combination with D-aminoacylase to prepare D-tryptophan. The enhanced racemic activity of N-acetylamino acid racemic enzyme can improve the reaction efficiency of D-tryptophan preparation and reduce the production cost of D-tryptophan.
[0004] Therefore, the first aspect of the present invention provides an N-acetylamino acid racemic enzyme mutant, the sequence of which is obtained by mutating the amino acid sequence of the original N-acetylamino acid racemic enzyme as shown in SEQ ID NO.1 from the N-terminus to position 293 and / or position 21 of the C-terminus; it is an N-acetylamino acid racemic enzyme mutant with enhanced racemic activity.
[0005] According to some preferred embodiments of the present invention, the mutant is N-acetylamino acid racemic enzyme mutant No. 1, whose sequence is the original N-acetylamino acid racemic enzyme sequence as shown in SEQ ID NO. 1, with the isoleucine at position 293 from the N-terminus to the C-terminus mutated to leucine. In this invention, it is simply referred to as single mutant I293L.
[0006] In a specific embodiment of the present invention, the amino acid sequence of the N-acetylamino acid racemic enzyme mutant No. 1 is shown in SEQ ID NO. 2.
[0007] According to some preferred embodiments of the present invention, the mutant is a mutant of N-acetylamino acid racemic enzyme No. 2, whose sequence is the original N-acetylamino acid racemic enzyme sequence as shown in SEQ ID NO. 1, with isoleucine at position 293 from the N-terminus to the C-terminus mutated to leucine and threonine at position 21 mutated to alanine. In the present invention, it is simply referred to as the double mutant T21A / I293L.
[0008] In a specific embodiment of the present invention, the amino acid sequence of the N-acetylamino acid racemic enzyme mutant No. 2 is shown in SEQ ID NO. 3.
[0009] The second aspect of the present invention provides a nucleotide molecule encoding the mutant described in the first aspect of the present invention.
[0010] In some preferred embodiments of the present invention, the nucleotide sequence encoding the N-acetylamino acid racemic enzyme mutant is the original N-acetylamino acid racemic enzyme sequence as shown in SEQ ID NO.4, with the A at position 877 from the 5' end to the 3' end mutated to C and the T at position 879 mutated to G.
[0011] In some preferred embodiments of the present invention, the nucleotide sequence encoding the N-acetylamino acid racemic enzyme mutant is the original N-acetylamino acid racemic enzyme sequence as shown in SEQ ID NO.4, with the following mutations from the 5' end to the 3' end: position 61 A is mutated to G, position 63 C is mutated to A, position 877 A is mutated to C, and position 879 T is mutated to G.
[0012] A third aspect of the present invention provides an expression cassette, recombinant vector, or recombinant microorganism containing the nucleotide molecules described in the second aspect of the present invention.
[0013] The fourth aspect of the present invention provides the application of mutants as described in the first aspect of the present invention, mutants encoded by nucleotide molecules as described in the second aspect of the present invention, or mutants obtained from expression cassettes, recombinant vectors, or recombinant microorganisms as described in the third aspect of the present invention in the catalytic preparation of D-tryptophan. This can be understood as a method for catalytically preparing D-tryptophan using mutants as described in the first aspect of the present invention, mutants encoded by nucleotide molecules as described in the second aspect of the present invention, or mutants obtained from expression cassettes, recombinant vectors, or recombinant microorganisms as described in the third aspect of the present invention.
[0014] According to the present invention, the application includes catalytic preparation of D-tryptophan, increasing the yield of catalytic preparation of D-tryptophan, and improving the efficiency of D-tryptophan preparation.
[0015] In this invention, the terms "protein" and "protein protein" can be used interchangeably.
[0016] This invention provides a mutant of N-acetylamino acid racemic enzyme with enhanced racemic activity, obtained through site-directed mutagenesis, exhibiting high enzyme activity for N-acetyl-L-tryptophan. Research results show that the N-acetylamino acid racemic enzyme mutant protein provided by this invention possesses high enzyme activity; the racemic activity of the mutant I293L for N-acetyl-L-tryptophan is 1.43 times that of the original N-acetylamino acid racemic enzyme, and the racemic activity of the double mutant T21A / I293L is 4.89 times that of the original N-acetylamino acid racemic enzyme. Applying this N-acetylamino acid racemic enzyme mutant to the catalytic preparation of D-tryptophan demonstrates higher efficiency. Detailed Implementation
[0017] To facilitate understanding of the present invention, it will be described in detail below. However, before describing the present invention in detail, it should be understood that the present invention is not limited to the specific embodiments described. It should also be understood that the terminology used herein is for describing specific embodiments only and is not intended to be restrictive.
[0018] Unless otherwise defined, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may also be used in the practice or testing of this invention, preferred methods and materials are now described.
[0019] Example
[0020] The present invention will be specifically described below through specific embodiments. Unless otherwise specified, the experimental methods described below are standard laboratory methods. Unless otherwise specified, the experimental materials described below are commercially available.
[0021] Example 1:
[0022] 1) Saturation mutagenesis and screening of N-acetylamino acid racemic enzymes
[0023] Using the pET-28a(+) recombinant plasmid containing the gene for N-acetylamino acid racemase (PDB accession number: 5FJU; amino acid sequence as shown in SEQ ID NO.1) (as shown in SEQ ID NO.4) [SEQ ID NO.4 is located between pET-28a sequence A (SEQ ID NO.5) and pET-28a sequence B (SEQ ID NO.6)] from Amycolatopsis sp. as a template, full plasmid PCR amplification was performed using primer 293F (ATGNNKGAAACCGGCCTGGGTCGTG) as the forward primer and primer 293R (GTCGCCGCACCAAACCGGGATAC) as the reverse primer. Site-directed saturation mutagenesis was performed on isoleucine at position 293 of the N-acetylamino acid racemase. PCR amplification system: 1 μL template, 1 μL each of forward and reverse primers, 7 μL ddH2O, 10 μL 2×PhantaMax Master Mix polymerase, total reaction volume 20 μL. PCR reaction conditions: 95℃ pre-denaturation, 3 min; 95℃ denaturation, 15 s; 56℃ annealing, 30 s; 72℃ extension, 6 min, 16 cycles; 72℃ final extension, 10 min; storage at 16℃. KLD ligation was performed on the PCR products and incubated at room temperature for 2 h. The KLD ligation system consisted of 1 μL of PCR product, 6 μL of ddH2O, 2 μL of 5X KLD buffer (1 μL of 10×CuterSmartbuffer, 1 μL of 10 mM ATP), and 1 μL of KLD Mix (0.45 μL of T4 DNA ligase, 0.4 μL of T4 polynucleotide kinase, and 0.15 μL of Dpn I). The KLD ligation products were transformed into *E. coli* BL21(DE3) (Shanghai Sangon Biotech Co., Ltd.), plated on LB agar plates containing 50 μg / mL kanamycin, and incubated at 37℃ for 16 h.
[0024] Single colonies were picked from a plate and inoculated into 3 mL of LB medium containing kanamycin (50 μg / mL). The culture was incubated at 37°C and 200 rpm for 16 hours. Then, a 1% inoculation ratio was performed into 10 mL of lactose-induced medium (1% peptone, 0.5% yeast extract, 0.5% glycerol, 0.05% glucose, 0.2% α-lactose, 25 mM Na₂HPO₄, 25 mM KH₂PO₄, 50 mM NH₄Cl, 5 mM Na₂SO₄, 2 mM Mg₂SO₄) to induce expression. After incubation at 28°C and 200 rpm for 24 hours, 1.5 mL of culture was collected by centrifugation. The cells were washed twice with water and resuspended in 450 μL of lysis buffer (50 mM Tris-HCl, 2 mM EDTA, pH 10). In 8.0), freeze at -70℃ for 15 min, then thaw at room temperature. Add 50 μL of mixed enzyme (10 μg / μL lysozyme, 0.5 U / μL totipotent nuclease) and lyse at room temperature for 30 min. Add 25 μL of 10% Triton X-100 and centrifuge for 5 min to obtain the supernatant as crude enzyme lysate.
[0025] Prepare N-acetyl amino acid racemic enzyme reaction solution: 25 mM N-acetyl-L-tryptophan, 50 mM Tris-HCl buffer (pH 8.0), 1 mM cobalt chloride.
[0026] HPLC detection conditions 1: Poroshell 120 Chiral-T 2.7μm 4.6×150mm chiral column; 1mM NaH2PO4-H3PO4, 50% methanol (pH 3.0) mobile phase; 28℃ column temperature; 280nm detection wavelength; flow rate 0.4mL / min; 10μL injection volume.
[0027] Take 1 mL of enzyme reaction solution and add 50 μL of the above ultrasonic lysis crude enzyme solution. React at 37℃ for 15 min, then take a sample and add it to 100 μL of 2M HCl to terminate the reaction. Centrifuge at 12000 rpm for 2 min, take the supernatant, dilute appropriately, and then detect the N-acetyl-D-tryptophan content under HPLC detection condition 1.
[0028] Preliminary screening of the catalytic activity of single colonies on saturated mutant plates yielded a colony with 106% increased enzyme activity. Sequencing revealed that the mutation involved a codon change at position 293 to CTG, and a change from isoleucine to leucine at position 293 (I293L).
[0029] 2) Preliminary comparison of two-site mutations and enzyme activities of N-acetylamino acid racemic enzymes
[0030] We have disclosed in CN 118291436 that the mutation at position 21 of the N-acetylamino acid racemase can improve the catalytic activity of the enzyme. Here, we further mutated the threonine at position 21 of the obtained I293L mutant to alanine.
[0031] Using primer 20R (ACGGAACGGCGCAACCAG) as the forward primer and primer 21A (GCAAGCTTTGGCACCGCGAGC) as the reverse primer, a plasmid containing the N-acetylamino acid racemic enzyme I293L mutant was used as a template for whole-plasmid PCR amplification. The PCR amplification system consisted of 1 μL template, 1 μL each of forward and reverse primers, 7 μL ddH2O, 10 μL 2×PhantaMax Master Mix polymerase, and a total reaction volume of 20 μL. PCR reaction conditions were as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 56℃ annealing for 30 s, 72℃ extension for 6 min, 16 cycles; 72℃ final extension for 10 min; and storage at 16℃. The PCR product was then subjected to KLD ligation and incubated at room temperature for 2 hours. The KLD ligation system consisted of 1 μL of PCR product, 6 μL of ddH2O (double-distilled water), 2 μL of 5X KLD buffer (1 μL of 10×CuterSmart buffer and 1 μL of 10mM ATP), and 1 μL of KLD Mix (0.45 μL of T4 DNA ligase, 0.4 μL of T4 polynucleotide kinase, and 0.15 μL of Dpn I). The KLD-ligated PCR product was transformed into *E. coli* DH5α (Shanghai Sangon Biotech Co., Ltd.), plated on LB agar plates containing 50 μg / mL kanamycin, and incubated at 37°C for 16 hours. Single colonies were picked from the plates for colony PCR identification and sequencing verification, yielding the N-acetylamino acid racemic enzyme double mutant T21A / I293L.
[0032] Unmutated plasmid and T21A / I293L double mutant plasmid were transformed into Escherichia coli BL21(DE3) (Shanghai Sangon Biotech Co., Ltd.). Single colonies were picked and inoculated into 3 mL of LB medium containing kanamycin (50 μg / mL) and cultured at 37℃ and 200 rpm for 16 hours. Then, expression was induced by inoculating 1% of the culture into 50 mL of lactose-induced medium containing kanamycin (50 μg / mL) and culturing at 28℃ and 200 rpm for 24 hours. 2.5 mL of culture was collected by centrifugation, the cells were washed twice with water and resuspended, and the volume of the bacterial suspension was adjusted to 1 mL. The bacterial suspension was then sonicated and the supernatant was collected by centrifugation.
[0033] Take 1 mL of N-acetylamino acid racemic enzyme reaction solution, add 50 μL of the above sonicated supernatant, react at 37℃ for 15 min, then take a sample and add 100 μL of 2M HCl to terminate the reaction. Centrifuge at 12000 rpm for 2 min, take the supernatant, dilute appropriately, and detect the N-acetyl-D-tryptophan content by HPLC under HPLC condition 1. Preliminary comparison of enzyme activity (before purification after cell lysis) shows that the enzyme activity of the T21A / I293L double mutant is 4.8 times that of the unmutated N-acetylamino acid racemic enzyme.
[0034] 3) Enzyme purification and specific activity assay
[0035] The N-acetylamino acid racemic enzyme mutant I293L and the double mutant T21A / I293L were isolated and purified, and their specific enzyme activity was measured.
[0036] After induction, 50 mL of culture was centrifuged to collect bacterial cells. The cells were washed twice with water and resuspended to a volume of 20 mL. The bacterial suspension was then sonicated and centrifuged again to collect the supernatant. 2 mL of buffer (0.5 M Tris-HCl, 1 M NaCl, pH 8.0) was added to the supernatant to obtain the crude enzyme solution. The crude enzyme solution was loaded onto a Q Spharose FF column (1.0 × 10 cm). After washing with 10 mL of washing buffer (50 mM Tris-HCl, 100 mM NaCl, pH 8.0), a gradient elution was performed using 50 mM Tris-HCl buffer from 100 mM to 500 mM NaCl. The eluent was collected fractionally and analyzed by SDS-PAGE to obtain a single band of N-acetylamino acid racemic enzyme. The final purified enzyme solution was obtained by ultrafiltration using a 3 kDa ultrafiltration membrane.
[0037] Enzyme activity assay: The reaction solution consisted of 25 mM N-acetyl-L-tryptophan, 50 mM Tris-HCl buffer (pH 8.0), 1 mM cobalt chloride, and an appropriate amount of enzyme; the reaction temperature was 37℃, and the reaction time was 15 min. One unit of enzyme activity is defined as the amount of enzyme required to generate 1 μmol of N-acetyl-D-tryptophan in 1 min under these conditions. Specific enzyme activity is the enzyme activity per mg of protein.
[0038] The results of the enzyme activity assay after purification are shown in Table 1.
[0039] Table 1. N-acetylamino acid racemic enzyme activity
[0040]
[0041] As shown in Table 1, the enzyme activity of the I293L mutant is 1.43 times that of the original enzyme, and the enzyme activity of the T21A / I293L double mutant is 4.89 times that of the original enzyme (after enzyme purification).
[0042] Example 2:
[0043] Prepare the reaction solution for N-acetyl amino acid racemic enzyme and D-aminoacylase: 100 mM N-acetyl-L-tryptophan, 50 mM Tris-HCl buffer (pH 8.0), 1 μM zinc sulfate, and 1 mM cobalt chloride.
[0044] Take 4 mL of the above dual-enzyme reaction solution, add 100 μg of the purified unmutated N-acetylamino acid racemic enzyme or T21A / I293L double mutant from Example 1, and then add 30 U of D-aminoacylase. Incubate at 37°C for 1 hour. Take 100 μL of the sample and add it to 900 μL of 0.1 M HCl to terminate the reaction. After centrifugation at 12000 rpm for 2 min, take the supernatant, dilute appropriately, and detect the D-tryptophan content by HPLC.
[0045] HPLC detection conditions 2: Inertsil C8-3 5μm 4.6×250mm column; 1mM NaH2PO4-H3PO4, 45% methanol (pH 3.0) mobile phase; 28℃ column temperature; 280nm detection wavelength; flow rate 1mL / min; 20μL injection volume.
[0046] During the reaction with D-aminoacylase, the D-tryptophan concentration in the sample catalyzed by the unmutated N-acetylamino acid racemic enzyme was 0.72 g / L after 1 hour, while the D-tryptophan concentration in the sample catalyzed by the T21A / I293L double mutant was 3.32 g / L. Under the same mass of N-acetylamino acid racemic enzyme, the T21A / I293L double mutant produced D-tryptophan faster and had higher enzyme reaction efficiency than the original enzyme.
[0047] It should be noted that the embodiments described above are only for explaining the present invention and do not constitute any limitation on the present invention. The present invention has been described with reference to typical embodiments, but it should be understood that the words used therein are descriptive and explanatory terms, not limiting terms. Modifications can be made to the present invention within the scope of the claims, and revisions can be made to the present invention without departing from the scope and spirit of the present invention. Although the present invention described herein relates to specific methods, materials, and embodiments, it does not mean that the present invention is limited to the specific examples disclosed herein; on the contrary, the present invention can be extended to all other methods and applications with the same function.
Claims
1. A mutant of N-acetyl amino acid racemase, the sequence of which is obtained by mutating the amino acid sequence of SEQ ID NO. 1 of the original N-acetyl amino acid racemase from the 293rd and / or the 21st position from the N-terminal to the C-terminal.
2. The mutant according to claim 1, wherein The mutant is No. 1 mutant of N-acetyl amino acid racemase, the sequence of which is obtained by mutating the amino acid sequence of SEQ ID NO. 1 of the original N-acetyl amino acid racemase from isoleucine at the 293rd position from the N-terminal to the C-terminal to leucine.
3. The mutant according to claim 1, wherein The mutant is No. 2 mutant of N-acetyl amino acid racemase, the sequence of which is obtained by mutating the amino acid sequence of SEQ ID NO. 1 of the original N-acetyl amino acid racemase from isoleucine at the 293rd position from the N-terminal to the C-terminal to leucine and threonine at the 21st position to alanine.
4. A nucleotide molecule encoding the mutant of claim 2 or 3.
5. An expression cassette, a recombinant vector or a recombinant microorganism containing the nucleotide molecule of claim 4.
6. Use of the mutant of claim 2 or 3 or the mutant encoded by the nucleotide molecule of claim 4 or the mutant prepared by the expression cassette, the recombinant vector or the recombinant microorganism of claim 5 in catalyzing the preparation of D-tryptophan.
7. Use according to claim 6, characterized in that, The use includes catalyzing the preparation of D-tryptophan, improving the yield of catalyzing the preparation of D-tryptophan and improving the efficiency of preparing D-tryptophan.