Saccharification and liquefaction bifunctional recombinant yeast strain, construction method and application

Abstract

This invention relates to the field of microbial fermentation, and particularly to a recombinant yeast strain with dual functions of saccharification and liquefaction, its construction method, and its applications. This invention provides a recombinant yeast strain with dual functions of saccharification and liquefaction. Through the co-expression of high-activity α-amylase and saccharifying enzyme genes, it exhibits superior fermentation capabilities for both cooked and raw materials. Under both cooked and raw material fermentation conditions, it can increase the fermentation alcohol content of existing strains and reduce the addition of exogenous enzymes, enabling cost reduction and increased production of ethanol from bio-based raw materials, meeting the needs of large-scale industrial production.

Description

Technical Field

[0001] This invention relates to the field of microbial fermentation, and in particular to a saccharification-liquefaction bifunctional recombinant yeast strain, its construction method, and its application. Background Technology

[0002] Saccharomyces cerevisiae, with its excellent robustness, genetic operability, and safety, is the most widely used strain in the brewing and fermentation industry for ethanol production. Traditional fuel ethanol production uses corn starch as a raw material through microbial fermentation. Currently, the mainstream process for producing ethanol from cooked grains employs simultaneous saccharification and fermentation technology. After exogenously adding α-amylase to liquefy corn starch at high temperatures, saccharifying enzymes and yeast are simultaneously added to the fermentation tank. The saccharifying enzymes further break down the dextrin obtained in the liquefaction stage into reducing sugars that can be utilized by the yeast, which then converts these reducing sugars into ethanol.

[0003] The yeast strain lacks endogenous saccharifying enzymes and α-amylase genes. When using starchy raw materials, it is necessary to add the corresponding enzymes to carry out alcoholic fermentation, which complicates the fermentation process and increases production costs. Summary of the Invention

[0004] In view of this, this invention screens saccharifying enzymes and α-amylases, and then molecularly modifies *Saccharomyces cerevisiae* M to enable it to perform saccharification and liquefaction. This achieves increased ethanol production under different fermentation conditions, reduces the need for exogenous enzymes, and thus reduces costs and increases efficiency.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] In a first aspect, the present invention provides gene elements, including an amylase gene and any of the following:

[0007] (I) The nucleotide sequence of the promoter;

[0008] (II) Genes of glycation enzymes;

[0009] The amylase is an amylase derived from Rhizopus oryzae;

[0010] The promoter includes the GAP promoter or the PGK promoter.

[0011] In some specific embodiments of the present invention, the amylase is α-amylase, and the nucleotide sequence of the gene for the amylase is shown in SEQ ID No. 10.

[0012] In some specific embodiments of the present invention, the nucleotide sequence of the gene for the glycanase is shown in SEQ ID No. 7.

[0013] In some specific embodiments of the present invention, the nucleotide sequence of the PGK promoter is shown in SEQ ID No. 8.

[0014] Secondly, the present invention also provides an expression vector comprising the aforementioned gene element.

[0015] Thirdly, the present invention also provides the application of any of the following in the construction of microorganisms with saccharification and / or liquefaction functions;

[0016] (I) The aforementioned gene element;

[0017] (II) The aforementioned expression vector.

[0018] Fourthly, the present invention also provides a host for transforming or transfecting the expression vector.

[0019] In some specific embodiments of the present invention, the host includes microorganisms or cells.

[0020] Fifthly, the present invention also provides recombinant Saccharomyces cerevisiae, which is a starting strain for transforming or transfecting the expression vector, wherein the starting strain is Saccharomyces cerevisiae.

[0021] In some specific embodiments of the present invention, the preservation number of the starting strain is CCTCC NO: M20251982.

[0022] In a sixth aspect, the present invention also provides a method for constructing the recombinant Saccharomyces cerevisiae, using the Saccharomyces cerevisiae with accession number CCTCCNO: M 20251982 as the starting strain, and transforming or transfecting the expression vector.

[0023] In a seventh aspect, the present invention also provides recombinant brewing yeast obtained by the construction method described above.

[0024] Eighthly, the present invention also provides the application of any of the following in raw material fermentation and / or cooked material fermentation;

[0025] (I) The aforementioned host;

[0026] (II) The recombinant brewing yeast described above;

[0027] (III) The recombinant brewing yeast.

[0028] In some specific embodiments of the present invention, it is facilitated to achieve coupling of strain growth and fermentation.

[0029] In a ninth aspect, the present invention also provides the use of any one of the following in the preparation of ethanol or in increasing the alcohol content of fermentation;

[0030] (I) The aforementioned host;

[0031] (II) The recombinant brewing yeast described above;

[0032] (III) The recombinant brewing yeast.

[0033] In a tenth aspect, the present invention also provides any of the following applications for reducing the addition of exogenous enzymes and / or reducing fermentation costs during fermentation;

[0034] (I) The aforementioned host;

[0035] (II) The recombinant brewing yeast described above;

[0036] (III) The recombinant brewing yeast.

[0037] This invention provides a recombinant yeast strain with dual functions of saccharification and liquefaction. Through the co-expression of high-activity α-amylase and saccharifying enzyme genes, it exhibits superior fermentation capabilities for both cooked and raw materials. Under both cooked and raw material fermentation conditions, it can increase the alcohol content of existing strains and reduce the need for exogenous enzymes, thereby achieving cost reduction and increased production of bio-based ethanol, meeting the demands of large-scale industrial production.

[0038] Biological Preservation Instructions

[0039] Classification and naming: Saccharomyces cerevisiae AMCC 30450 was deposited at the China Center for Type Culture Collection (CCTCC) on September 8, 2025, at Wuhan University, Wuhan, China, with accession number CCTCC NO: M20251982. Attached Figure Description

[0040] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0041] Figure 1 This shows the implementation flowchart of the technical solution;

[0042] Figure 2 This demonstrates the construction of plasmid maps;

[0043] Figure 3 The results of agarose gel electrophoresis verification of the M+GA strain are shown;

[0044] Figure 4 Plasmid map;

[0045] Figure 5 The results of bifunctional strain verification are shown; where lanes A show the verification results of 11 amylase genes driven by the PGK promoter (lanes 1-11), and lanes B show the verification results of 11 amylase genes driven by the GAP promoter (lanes 1-11).

[0046] Figure 6The results of fermentation of cooked food by strains M+GA and M are shown;

[0047] Figure 7 The results of the starch hydrolysis ring experiment are shown.

[0048] Figure 8 The results of fermentation of cooked food by bifunctional strains are shown;

[0049] Figure 9 Show the results of raw material fermentation;

[0050] Figure 10 The results of raw material fermentation are shown (Note: sugar + starch represent saccharifying enzyme and α-amylase). Detailed Implementation

[0051] This invention discloses a saccharification-liquefaction bifunctional recombinant yeast strain, its construction method, and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0052] Saccharifying yeast itself does not possess saccharification and liquefaction functions. By constructing a yeast strain with dual saccharification and liquefaction functions through genetic engineering, this strain can achieve coupled growth and fermentation under both raw and cooked material fermentation conditions, thereby increasing the ethanol yield of existing strains. Traditional bioethanol fermentation requires the exogenous addition of saccharifying and liquefying enzymes to process starchy raw materials. The strain constructed in this patent can reduce the need for exogenous enzymes, thus lowering fermentation costs.

[0053] The saccharification and liquefaction bifunctional recombinant yeast strain, construction method, and raw materials and reagents used in the application provided by this invention are all commercially available.

[0054] The present invention will be further illustrated below with reference to the embodiments:

[0055] Example 1 Construction of saccharification functional strains

[0056] The starting strain was *Saccharomyces cerevisiae* strain M (accession number: M 20251982). The saccharifying enzyme gene sequence, promoter, and terminator were derived from patent CN105985969B. The complete expression cassette sequence was synthesized by Anshengda Biotechnology Co., Ltd. (Suzhou) and optimized according to the codon preferences of *Saccharomyces cerevisiae* before being ligated into the PUC19 plasmid. The successfully constructed plasmid map is shown below. Figure 2 As shown.

[0057] Obtaining the target gene:

[0058] Using the PUC19-GA plasmid as a template, the GA expression cassette fragment (as shown in SEQ ID No. 7) was obtained by PCR using the corresponding primer sequences (GA-F: AAAGATACGAAATATGAAAGGCGAGGAAAATTAGAATTATTTCAATCA, as shown in SEQ ID No. 1; TTGGAGCAATC GA-R: TATGATTGACGTCATTCTGAGTTACAATGATCTTAGCGACGATTTTTTTCTAAACCGTG, as shown in SEQ ID No. 2). High-fidelity PCR in the examples used Phanta Max Super-Fidelity DNA Polymerase (purchased from Novizan). DNA gel electrophoresis excision and recovery used a gel recovery kit (purchased from OMEGA), yeast genomic DNA extraction used a yeast genomic DNA extraction kit (purchased from OMEGA), and seamless cloning used the Plus One Step Cloning Kit (purchased from Yisheng Biotechnology). Specific molecular manipulation steps were performed according to the respective reagent instructions.

[0059] Preparation and electroporation of competent states:

[0060] (1) Inoculate strain M into a test tube containing 5 mL of YPD medium (1% yeast extract, 2% peptone, 2% glucose) and culture for 12 h. The next day, inoculate 2% of the culture into an Erlenmeyer flask containing 50 mL of YPD medium and culture for about 5 h before measuring OD. 600 Incubate at 0.8-1.0 on ice for 15 min, then centrifuge at 5000 rpm for 5 min (4℃) to collect the bacterial cells.

[0061] (2) Wash the bacterial cells twice with 10% glycerol, mix them by pipetting, and collect the bacterial cells by centrifugation at 5000 rpm for 5 min (4℃).

[0062] (3) The obtained bacterial cells were suspended in 500 μL of 10% glycerol and dispensed into 100 μL competent cells for later use.

[0063] (4) Add 1-1.5 μg gRNA plasmid and 2 μg GA linear fragment to the competent cells.

[0064] (5) 2mm electric rotary cup, set to 2.5kV voltage, (breakdown time is about 5.5ms);

[0065] (6) Take 900 μL of YPD medium to wash the competent cell solution, transfer it to a 1.5 mL centrifuge tube, and incubate at 30℃ for 1 h; centrifuge at 12000 g for 1 min, collect the cells, suspend them in 200 μL of sterile water, spread 50~100 μL on a plate; incubate overnight at 30℃, and pick single bacteria.

[0066] Strain verification:

[0067] Positive transformants were screened by agarose gel electrophoresis, and the results were verified as follows: Figure 3 As shown, the M+GA strain was successfully constructed.

[0068] Example 2: Verification of saccharification function

[0069] Cooked food fermentation process:

[0070] Weigh and record the weight of each clean, dry Erlenmeyer flask. Weigh 100 g of corn and transfer it to a clean, dry 500 mL Erlenmeyer flask. Add 0.2 mL of 1.5% dilute sulfuric acid, 0.15 mL of amylase (Hunan Xinhongying Bioengineering Co., Ltd., 80,000 U), 0.8 g of magnesium sulfate heptahydrate, 1 g of yeast extract FM888, and approximately 200 g of tap water at 40 °C. Stir well, place the flask in a water bath without a lid, and stir every 5 minutes, then every 5 minutes again. Cover and bring to a boil. After 60 minutes, stir the mash with a long iron spoon to clean the inner wall. Cover and boil for another 30 minutes. Remove from the water. Quickly cool the flask to 30 °C–33 °C using a cooling water bath to complete the liquefaction process.

[0071] Add 1.00 g of urea (which can be diluted before addition) to the liquefied Erlenmeyer flask, followed by 0.35 mL of saccharifying enzyme (Hunan Xinhongying Biotechnology Co., Ltd., 110,000 U). After half an hour, maintain the temperature at 32 ℃ ± 1 ℃, and finally add 0.16 mL of fresh yeast (viable count approximately 10 million / mL). Clean the flask wall with a long sampling spoon, and add water to the final volume (320 g) on ​​an analytical balance according to the weight difference. Seal the flask with sealing film and wrap it with a rubber band three times. Weigh the flask.

[0072] Incubate the Erlenmeyer flask in a constant-temperature shaker at 170 rpm and 33 °C for 70–72 hours. After fermentation, shake well and transfer 100 mL of the fermentation mash to a 1000 mL distillation flask using a 100 mL graduated cylinder. Add 100–150 mL of tap water and 2 drops of defoaming agent, and proceed with distillation. Collect the distillate in a 100 mL volumetric flask (with an external cold water bath to control the temperature of the distillate below 25 °C). When the distillate reaches approximately 95 mL, stop distillation, remove the flask, and bring the volume to 100 mL. Shake well and use a precision alcohol meter to measure the alcohol content of the distillate.

[0073] Example 3: Screening and Enzyme Activity Assay of α-Amylase

[0074] Screening for α-amylase:

[0075] We selected 11 low-temperature α-amylase genes from different sources from Table 1 in the company's strain preservation resource library.

[0076] Table 1. α-Amylase at medium and low temperatures

[0077]

[0078] Construction of bifunctional strains:

[0079] The selected α-amylase sequences were synthesized by Anshengda Biotechnology Co., Ltd. (Suzhou) and optimized according to the codon preferences of Saccharomyces cerevisiae. These sequences were then ligated into the expression frames shown in Figure 4, which consist of the GAP / PGK promoter (as shown in SEQ ID No. 8), the α-factor (α-factor secretion signal peptide) sequence (as shown in SEQ ID No. 9), and the CYC1 terminator. Corresponding primer sequences were designed as follows:

[0080] GAP-F: CACACAATTTTGGTGGCGTTGAAATTGATGCCGGAATTTATACTGCCATTTCAAAGAAT, as shown in SEQ ID No. 3; GAP-R: TTACGTGTCATTTATTATGGGTTCAGAAATAATGTGTTAAGAGCGACCTCATGCTATA, as shown in SEQ ID No. 4;

[0081] PGK-F: AAACAATAGGCAAGAAGTAGGCGAGAGCCGACATACGAGAAGGAAGTGTTTCCCTC, as shown in SEQ ID No. 5;

[0082] PGK-R: CTTTTACTAGCATATCAATATCCGTTTCATTGAAAAGTGGTCAAATTAAAGCCTTCGAG, as shown in SEQ ID No. 6;

[0083] Eleven different α-amylases and fragments composed of different expression cassettes were obtained by PCR. M+GA electroporation competent cells were prepared. Expression cassettes were inserted into the genome of strain M+GA using Crisper Cas9 technology to construct strains PGK-CAA, PGK-ADL, PGK-KAI, PGK-AWA, PGK-XP, PGK-AHN, PGK-BAF, PGK-AIW, PGK-B4, PGK-B5, PGK-AMR, GAP-CAA, GAP-ADL, GAP-KAI, GAP-AWA, GAP-XP, GAP-AHN, GAP-BAF, GAP-AIW, GAP-B4, GAP-B5, and GAP-AMR (genotypes are shown in Table 2; specific operational steps are as described in "Preparation and Electroporation of Competent Cells" in Example 1). Positive transformants were screened by agarose gel electrophoresis. The fragment size was approximately 1500 bp (e.g., Figure 5 (As shown).

[0084] The sequence of α-amylase from Rhizopus oryzae (NCBI protein sequence number: ADL28123.1) is shown in SEQ ID No. 10.

[0085] Table 2. Strain Genotypes

[0086]

[0087] α-Amylase activity assay:

[0088] Amylase activity medium (AAM): soluble starch 5 g / L; peptone 5 g / L; yeast extract 5 g / L; MgSO4·7H2O 0.5 g / L; FeSO4·7H2O 0.01 g / L; NaCl 0.01 g / L; agar 15 g / L.

[0089] The constructed strains PGK-CAA, PGK-ADL, PGK-KAI, PGK-AWA, PGK-XP, PGK-AHN, PGK-BAF, PGK-AIW, PGK-B4, PGK-B5, PGK-AMR, GAP-CAA, GAP-ADL, GAP-KAI, GAP-AWA, GAP-XP, GAP-AHN, GAP-BAF, GAP-AIW, GAP-B4, GAP-B5, GAP-AMR, and the control strain M+GA were activated overnight in YPD medium. Single colonies were isolated by streaking on YPD plates and spotted onto amylase activity medium. After culturing for 48 hours, the plates were stained with Lugol's solution (0.1% I2 and 1% KI). The size of the starch hydrolysis zone after staining was used to determine the α-amylase activity.

[0090] Example 4: Fermentation Verification of Ethanol Production Capacity

[0091] Raw material fermentation medium: 100 g corn steep liquor powder; 0.4 g urea; 200 μL 1.5% sulfuric acid; 0.6 g MgSO4·7H2O; 1 g yeast extract powder; water to a final volume of 320 g.

[0092] Seed culture medium composition (g / L): yeast extract 10; tryptone 20; sucrose 40; potassium dihydrogen phosphate 1; magnesium sulfate heptahydrate 1.

[0093] Following the method described in Example 3 for α-amylase activity assay, high α-amylase activity strains PGK-CAA, PGK-ADL, PGK-KAI, PGK-AWA, GAP-CAA, GAP-ADL, GAP-KAI, and GAP-AWA were selected. The fermentation performance of these strains was verified using the same cooked material fermentation process as the saccharification function assay. Based on the cooked material fermentation results, the optimal saccharification-liquefaction bifunctional strain was selected. Finally, after activation with seed culture medium, the optimal saccharification-liquefaction bifunctional strain was inoculated into the raw material fermentation medium with 0.32 mL of fresh yeast (with a viable cell count of approximately 10 million / mL). After 72 hours of fermentation, the alcohol content was measured using a handheld alcohol meter. The raw material fermentation capacity of the optimal saccharification-liquefaction bifunctional strain was verified using M+GA strain and M strain as controls.

[0094] Example 1: Fermentation results of a saccharifying enzyme functional strain

[0095] The M+GA and M strains were subjected to fermentation of cooked material without the addition of α-amylase and without the addition of saccharifying enzyme. The results are shown in Figure 6. Without the addition of saccharifying enzyme, the alcohol content of the cooked material fermented by the starting strain M was only 3.6%, but that of M+GA could reach 14.95%, which was about 3.15 times higher than that of the starting strain M.

[0096] Example 2: Preliminary screening of α-amylase and construction of bifunctional strains

[0097] The constructed strains PGK-CAA, PGK-ADL, PGK-KAI, PGK-AWA, PGK-XP, PGK-AHN, PGK-BAF, PGK-AIW, PGK-B4, PGK-B5, PGK-AMR, GAP-CAA, GAP-ADL, GAP-KAI, GAP-AWA, GAP-XP, GAP-AHN, GAP-BAF, GAP-AIW, GAP-B4, GAP-B5, GAP-AMR and the control strain M+GA were spotted into amylase activity medium and cultured for 48 hours. The plates were then stained with Lugol's solution (0.1% I2 and 1% KI). The size of the starch hydrolysis zone was as follows: Figure 7As shown, the hydrolysis zone trends of the GAP and PGK promoters are almost identical. α-amylase-derived strains from *Saccharomyces cerevisiae*, *Aspergillus oryzae*, *Rhizopus oryzae*, *Aspergillus niger*, *Aspergillus lanceolata*, and *Bacillus amyloliquefaciens* can produce starch hydrolysis zones under both promoters. Among these, strains PGK-CAA, PGK-ADL, PGK-AWA, GAP-CAA, GAP-ADL, GAP-AWA, PGK-KAI, and GAP-KAI produce relatively larger hydrolysis zones. Therefore, subsequent fermentation validation experiments focused on strains PGK-CAA, PGK-ADL, PGK-AWA, GAP-CAA, GAP-ADL, GAP-AWA, PGK-KAI, and GAP-KAI.

[0098] Example 3: Validation of the production performance of a bifunctional yeast strain

[0099] Strains PGK-CAA, PGK-ADL, PGK-AWA, GAP-CAA, GAP-ADL, GAP-AWA, PGK-KAI, and GAP-KAI were subjected to fermentation with α-amylase only, without the addition of saccharifying enzymes, using M+GA as a control. The results are shown in Figure 8. Under the condition of no saccharifying enzyme addition, the insertion of the ADL gene from Rhizopus oryzae can further increase the fermentation alcohol content of the strains. Among them, the combined expression of the PGK promoter and the ADL gene has the best effect, increasing the fermentation alcohol content by about 0.4%. This shows a higher fermentation alcohol content than the starting strain M under normal enzyme-added fermentation conditions.

[0100] Due to limitations in the liquefaction process of cooked material fermentation, it is impossible to achieve α-amylase-free fermentation. To better evaluate the fermentation performance of the strain, the screened bifunctional saccharification and liquefaction strain PGK-ADL was subjected to raw material fermentation under enzyme-free conditions and fermentation under conditions with both saccharifying and amylase reduction. Strain M and Strain M+GA were used as controls. The fermentation results are shown in Figure 9. The alcohol content of strain PGK-ADL reached 7.3% under completely enzyme-free raw material fermentation conditions, while the alcohol content of strain M+GA was 4.3%, and that of strain M was only 2.74%. This result indicates that the sequential insertion of the saccharifying and α-amylase genes endows strain M with saccharification and liquefaction functions, demonstrating its potential for enzyme-free raw material fermentation.

[0101] Finally, the constructed strain M+GA PGK-ADL was subjected to gradient enzyme addition fermentation, with M serving as a control. Figure 10 As shown, by adding only 30% saccharifying enzyme and 30% α-amylase, the M+GA PGK-ADL strain can achieve the same fermentation alcohol content as the original strain.

[0102] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A recombinant brewing yeast, characterized in that, It is the starting strain for transformation or transfection of the expression vector, and the starting strain is Saccharomyces cerevisiae; The expression vector includes gene elements; the gene elements include an amylase gene, a promoter nucleotide sequence, and a saccharifying enzyme gene; The amylase is an amylase derived from Rhizopus oryzae; The promoter is the PGK promoter; The amylase is α-amylase, and the nucleotide sequence of the gene for the amylase is shown in SEQ ID No. 10; The nucleotide sequence of the gene for the glucoamylase is shown in SEQ ID No. 7; The nucleotide sequence of the PGK promoter is shown in SEQ ID No. 8; The preservation number of the originating strain is CCTCC NO: M 20251982.

2. The application of the recombinant brewing yeast as described in claim 1 in raw material fermentation and / or cooked material fermentation.

3. The application as described in claim 2, characterized in that, Promotes the coupling of strain growth and fermentation.

4. The application of the recombinant brewing yeast as described in claim 1 in the preparation of ethanol or in increasing the alcohol content of fermentation.

5. The application of the recombinant brewing yeast as described in claim 1 in reducing the addition of exogenous enzymes and / or reducing fermentation costs during fermentation.

Images