Single-molecule protein detection method based on digital PCR (Polymerase Chain Reaction)

Abstract

The invention relates to the technical field of digital PCR detection, in particular to a single-molecule protein detection method based on digital PCR. The detection method comprises the following steps: fusing digital PCR and immune PCR, capturing an antibody through magnetic bead coupling, binding the captured antigen with a detection antibody of a nucleic acid fragment through streptavidin-biotin coupling to form a double-antibody sandwich structure, amplifying a fluorescence signal by using digital PCR amplification, and calculating to obtain the target protein concentration of a sample to be detected. Therefore, quantitative detection of the single-molecule protein is realized, and the detection limit reaches 0.395 fg / ml. The detection method is accurate in quantification and excellent in sensitivity, the detection cost can be greatly reduced, the detection efficiency is improved, the detection process is simplified, and the high requirement for equipment precision is reduced.

Description

Technical Field

[0001] This invention relates to the field of digital PCR detection technology, and in particular to a method for detecting single-molecule proteins based on digital PCR. Background Technology

[0002] Proteins, as key macromolecules in living organisms, play a central role in carrying out life activities. Abnormalities in protein expression or function can lead to diseases and even cancer. Studying protein expression helps us understand the physiological state and pathological changes of cells, comprehend the effects of external factors such as drugs or the environment on cells, further deepen our understanding of physiological and pathological processes, and the occurrence, development, and treatment response of diseases.

[0003] In bodily fluids, proteins with diagnostic and therapeutic potential are often present in extremely small amounts and are susceptible to interference from other substances in the body. Therefore, methods for detecting these proteins require extremely high sensitivity and specificity. Currently, mainstream technologies for protein detection include enzyme-linked immunosorbent assay (ELISA), electrophoresis, mass spectrometry, and electrochemical detection.

[0004] While SimoA (Single Molecule Immunoassay) technology is currently considered the gold standard for digital ELISA, boasting extremely high sensitivity and broad application prospects, it also has some drawbacks and limitations as an emerging technology: SimoA requires expensive equipment, consumables, and reagents, limiting its application in laboratories or regions with limited budgets and hindering its widespread adoption; compared to conventional ELISA, SimoA is more complex to operate, requiring specialized training and skilled operators; due to the large volume of data generated by SimoA, complex data analysis methods and high computing power are needed to process and interpret the data; although SimoA has achieved automation in some aspects, manual steps are still required, which affects its throughput and reproducibility.

[0005] In recent years, sensitive protein detection methods based on digital PCR amplification and nucleic acid conjugation techniques have provided a valuable tool for analyzing proteins in biological samples. Digital PCR (dPCR) is a nucleic acid molecule detection technique that uses microfluidic technology or chips to divide the sample reaction solution into many independent units. By dispersing the sample containing the target nucleic acid sequence into a large number of tiny reaction units, it enables individual detection and absolute quantification of nucleic acid molecules in each unit.

[0006] In immunological research, antibody detection of antigens is a fundamental method, and immunoPCR (Immuno-PCR) is a new technique developed based on this. ImmunoPCR combines the specificity of antigen-antibody reactions with the high sensitivity and amplification capability of PCR technology. The basic process includes two main parts: ① Immunological reaction: Similar to the ELISA assay, specific antibodies bind to antigens on a solid phase to form antigen-antibody complexes. ② PCR amplification: Specific DNA is indirectly adsorbed onto the solid phase via ligand-mediated amplification, and then the DNA is amplified in large quantities using PCR technology. The amount of PCR products is directly proportional to the amount of antigen on the solid phase, thus achieving quantitative detection of the antigen.

[0007] Existing technologies report quantitative detection techniques for single-molecule proteins based on a combination of immunoPCR and digital PCR. These techniques improve detection sensitivity, efficiency, and throughput while reducing detection costs. However, the applicant discovered during the research process that using functional group-labeled antibodies can lead to excessively high null control (NTC) results, thus affecting the interpretation of positive values, especially in the detection of low-concentration positive samples, where the interpretation of results is more accurate. For example, for a sample with a concentration of 10 copies / ul, when the NTC is 200 copies / ul, it is impossible to determine whether a value of 210 copies / ul is usable; however, when the NTC is 15 copies / ul, 25 copies / ul can be determined as a usable value.

[0008] Another report describes the use of immunoPCR combined with droplet digital PCR to amplify double-antibody sandwich immune complexes. However, due to the unstable physical structure of the droplets, they are prone to fusion and breakage, and are even more likely to break when they encounter magnetic beads. Furthermore, the droplets are greatly affected by temperature, and uneven temperatures inside and outside the droplets can affect the amplification results. The entire experimental process requires control over the formation and stability of the droplets. In addition, the droplet amplification reaction is relatively sensitive to pH and ionic environment. Therefore, this method requires higher precision in experimental operation, equipment, and personnel skills, which increases the cost of detection.

[0009] To address some of the current problems with single-molecule detection technologies, there is an urgent need in this field to develop faster, more convenient, and lower-cost digital protein detection technologies to meet the demand for highly sensitive, accurate, and rapid quantitative protein detection. Summary of the Invention

[0010] To address the problems existing in the prior art, this invention provides a single-molecule protein detection method based on digital PCR, which improves the sensitivity and accuracy of existing detection methods and reduces detection costs.

[0011] This invention is a "digital" immunoassay technology that integrates digital PCR and immunoPCR. Antibodies are captured by magnetic beads, and after capturing the antigen, it binds to the detection antibody that is conjugated to a nucleic acid fragment by streptavidin-biotin to form a double-antibody sandwich structure. The fluorescence signal is amplified by digital PCR, and the detection is calculated based on the Poisson distribution principle, thereby realizing the quantitative detection of single protein molecules.

[0012] See the schematic diagram of the detection principle. Figure 1 .

[0013] The specific technical solution of the present invention is as follows:

[0014] This invention provides a method for detecting single-molecule proteins based on digital PCR, comprising the following steps:

[0015] (1) The capture antibody magnetic beads, the target protein of the sample to be tested, and the detection antibody specifically bind to form a double antibody sandwich immune complex; the detection antibody is a detection antibody labeled with nucleic acid; the capture antibody and the detection antibody can respectively recognize different antigenic epitopes of the same target protein;

[0016] (2) The double antibody sandwich immune complex was added to the digital PCR reaction system as a template for amplification. The amplification results were analyzed and the target protein concentration of the sample to be tested was calculated.

[0017] Preferably, in the single-molecule protein detection method of the present invention, after adding the double-antibody sandwich immune complex as a template to the digital PCR reaction system, it is then loaded onto a microchamber chip with a microwell array for amplification, the amplification results are analyzed, and the target protein concentration of the sample to be tested is calculated.

[0018] The microchamber chip with microwell array described in this invention is any chip in the art that has a microwell array and is suitable for digital PCR; preferably, the microchamber chip with microwell array described in this invention is selected from the microchamber chip disclosed in Chinese Patent CN117899955A.

[0019] In step (1) of the above single-molecule protein detection method, the capture antibody specifically binds to the target protein and is then incubated with the nucleic acid-labeled detection antibody to form a double-antibody sandwich immune complex; or the capture antibody magnetic beads, the target protein of the test sample, and the nucleic acid-labeled detection antibody are incubated together; or the nucleic acid-labeled detection antibody is first incubated with the target protein of the test sample, and then incubated with the capture antibody-labeled magnetic beads; the capture antibody and the detection antibody can recognize different antigenic epitopes of the same target protein respectively; as long as the final product is a double-antibody sandwich immune complex, it is acceptable.

[0020] The sample to be tested can be blood, sweat, urine, saliva, cerebrospinal fluid, bronchoalveolar lavage fluid, various tissue lysates, cell suspensions prepared from various tissues, cultured cells, etc., or any artificially prepared protein reagents, plant tissue suspensions, virus culture media, bacterial suspensions, fungal suspensions, etc.

[0021] Each magnetic bead in this invention has approximately 100,000 to 300,000 capture antibodies on its surface. When natural or artificial samples with very few target molecules are diluted, each magnetic bead captures only a single protein molecule. Subsequently, a detection antibody with a known sequence nucleic acid fragment binds to it, forming a typical double-antibody sandwich structure. The detection antibody, after being amplified by digital PCR, is placed in a digital PCR reader to generate a fluorescent signal.

[0022] In the reaction system, the antigen concentration needs to be adjusted appropriately. Dilution can be performed if necessary to control the sample concentration at 10. 3 ~10 5 copies / ul, preferably 10 4 Copies / ul. Excessive concentration increases the probability of capturing multiple antigen molecules; it should be controlled by dilution to a level sufficient to ensure that most magnetic beads capture single-molecule antigens.

[0023] The magnetic beads of the present invention are modified with active functional groups that can covalently couple with capture antibodies, such as hydroxyl, carboxyl, amino, mercapto, succinimide ester and sulfonyl (such as toluenesulfonyl) and their derivative groups.

[0024] Capture antibodies can be classified according to their specificity as either polyclonal or monoclonal antibodies. They can also be classified according to their origin, such as from animals like mice, rabbits, sheep, or alpacas.

[0025] Antibodies can also be classified as polyclonal or monoclonal antibodies based on their specificity. They can also originate from animals such as mice, rabbits, sheep, or alpacas.

[0026] In step (1) of the single-molecule protein detection method of the present invention, the nucleic acid-labeled detection antibody is obtained by labeling the nucleic acid onto the detection antibody using streptavidin-biotin.

[0027] This invention, through comparative experiments using different functional modification groups (amino, carboxyl, p-toluenesulfonyl, thiol, streptavidin, biotin, succinimide ester), found that when the detection antibody is conjugated to nucleic acid via streptavidin-biotin, the NTC test results of the double-antibody sandwich immune complex formed with capture antibody magnetic beads show that using streptavidin-biotin as a conjugate results in the lowest background concentration. This is beneficial for judging results from low-concentration samples, avoiding false positives caused by free nucleic acid residues in the system, and thus improving the specificity and sensitivity of the detection, reducing false positives, and ensuring the stability and repeatability of the detection results.

[0028] The structural diagram of the nucleic acid labeling detection antibody of the present invention is shown below. Figure 2 As shown.

[0029] The nucleic acid used in the method of the present invention is a single-stranded nucleic acid or a double-stranded nucleic acid; preferably a single-stranded nucleic acid, and more preferably the nucleotide sequence of the single-stranded nucleic acid is shown in SEQ ID NO.1.

[0030] Furthermore, in the single-molecule protein detection method provided by the present invention, the detection antibody for the labeled nucleic acid is prepared by the following method:

[0031] 1) Biotinylation of detection antibody: Prepare biotin-NHS solution, mix detection antibody and biotin at a mass ratio of (5-20):1, add biotin-NHS solution to detection antibody and react at room temperature in the dark, dialyze, and collect biotinylated detection antibody solution in dialysis bag;

[0032] 2) Biotinylation of nucleic acids: Random primer buffer is added to the nucleic acid template, heat denaturation is performed, biotin-labeled mixture is added, and incubation is carried out for ≤20 hours to obtain biotin-labeled nucleic acids;

[0033] 3) By fully combining streptavidin and biotin, the biotinylated nucleic acid is combined with the biotinylated detection antibody.

[0034] The order of steps 1)-2) above does not matter and can be achieved.

[0035] The single-molecule protein detection method provided by this invention, wherein the capture antibody in step (1) is coupled to a magnetic bead, and each magnetic bead captures only a single protein molecule. The magnetic beads have a diameter of 50 nm to 4.5 μm.

[0036] In step (1) of the above method, the incubation conditions for capturing the antibody to specifically bind to the test protein are: temperature 25-37℃, preferably 37℃; time 10min-2h, preferably 10min-30min.

[0037] In step (1), the incubation conditions between the nucleic acid-labeled detection antibody and the test protein are: temperature 25-37℃, preferably 37℃; time 10min-2h, preferably 10min-30min.

[0038] In the single-molecule protein detection method provided by the present invention, the chip surface with micropore array in step (2) has 3,500 to 20000 small pores with a diameter of 10 to 45 μm; after the double antibody sandwich immune complex is loaded into the microchamber chip, it is sealed with oil phase to physically isolate the micropores.

[0039] The digital PCR detection process of this invention mainly includes sample dispersion, PCR amplification, fluorescence signal acquisition, and data analysis. Experimental results are obtained by performing single-molecule-level PCR fluorescence amplification in a large-scale parallel microreactor, ultimately statistically analyzing the total number of reaction units and the number of positive reaction units, and calculating the initial concentration of DNA template molecules based on the Poisson distribution formula, thereby achieving absolute quantification.

[0040] Digital PCR technology, in a limiting dilution mode, randomly disperses the sample template into hundreds to millions of independent reaction units. Each reaction unit may contain zero, one, or more template molecules, and the template molecule dispersion follows a Poisson distribution. After PCR amplification, units with fluorescent signals are recorded as 1, and those without fluorescent signals are recorded as 0; that is, reaction units are defined as positive and negative based on the presence or absence of fluorescence signals. By statistically analyzing the total number of reaction units and the number of positive reaction units, the initial concentration of template molecules can be calculated using the Poisson distribution formula.

[0041] The calculation steps are as follows:

[0042] Step 1: Calculate the mass (in grams) of the single protein corresponding to each nucleic acid:

[0043] The mass of the single protein corresponding to each nucleic acid = (target protein) molecular weight × N A

[0044] N A N is Avogadro's constant. A =6.022×10 23 mol -1

[0045] Step 2: Calculate the mass of each μL target protein (in g / μL):

[0046] Mass of target protein per μL = Mass of single protein molecule corresponding to each nucleic acid × Original nucleic acid concentration. Note: Original concentration is calculated as: Digital PCR analysis concentration × Total loading volume 20 μL ÷ Sample volume 100 μL.

[0047] Step 3: Convert protein concentration (g / ul) to (fg / ml):

[0048] Mass of target protein per μL × 10 6 ul / ml×10 15 fg / g

[0049] In selecting known nucleic acids and their matching amplification primers and probes suitable for digital PCR, this invention selected multiple sets of nucleic acid fragments and primer-probe combinations for effect verification. Unexpectedly, it was found that the following nucleic acid combinations had the best amplification effect and the highest positive fluorescence value.

[0050] The verification combination includes a single-stranded nucleic acid, a primer pair, and a probe; the nucleotide sequence of the single-stranded nucleic acid is shown in SEQ ID NO.1; the nucleotide sequences of the primer pair are shown in SEQ ID NO.2-3; and the nucleotide sequence of the probe is shown in SEQ ID NO.4.

[0051] Furthermore, the present invention provides a kit suitable for digital PCR detection of a single protein, the kit containing the above-mentioned combination of nucleic acids with the best amplification effect, wherein the single-stranded nucleic acids are biotinylated or unbiotinylated.

[0052] Preferably, the kit further contains streptavidin and biotin. More preferably, the kit further contains an antibody. Even more preferably, the single-stranded nucleic acid in the kit is labeled onto the antibody by streptavidin-biotin. The kit of the present invention may also contain multiple nucleic acid combinations, each containing a different nucleic acid fragment, as well as primer pairs and probes for amplifying the nucleic acid fragment, for use in multi-panel testing.

[0053] Those skilled in the art will understand that the nucleic acid combination or kit described in this invention can achieve quantitative detection of single-molecule proteins based on the fusion of digital PCR and immunoPCR technologies.

[0054] In the single-molecule protein detection method of the present invention, oligonucleotides are used as templates to detect single-molecule proteins, achieving a detection efficiency of up to 10. 12 The signal amplification factor is increased to the power of 1. Compared with Simoa technology, this invention does not require a smaller cavity and a more precise optical detection system, which greatly reduces the process and material costs of instruments and chip consumables, and is conducive to the popularization and use of the technology.

[0055] In addition, compared with droplet-based digital PCR, the microchamber chip used in this invention is lower in cost and higher in accuracy. This is because the physical structure of liquid-phase segmented droplets is unstable and easily affected by environmental factors and changes in composition. Droplets are prone to fusion and breakage, while the solid-phase physical structure of the chip is stable and does not change in morphology due to changes in chemical composition, and the system has higher openness.

[0056] The proteins described in this invention include, but are not limited to, antibodies, organelle proteins, plant proteins, whey proteins, microbial proteins, hormones, and cytokines.

[0057] The flowchart of the single-molecule protein detection method of the present invention is shown below. Figure 3 For a simplified operation demonstration, see Figure 4 .

[0058] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0059] The detection method of this invention fuses digital PCR with immunoPCR. Antibodies are captured via magnetic bead conjugation and specifically bind to the target protein in the sample. This target protein then binds to a detection antibody linked to a streptavidin-biotin-conjugated nucleic acid fragment, forming a double-antibody sandwich immune complex. Using this immune complex as a template, digital PCR amplifies the fluorescence signal. Based on the Poisson distribution principle, rapid quantitative detection of single-molecule proteins is achieved, with a detection limit of approximately 0.395 fg / ml. Furthermore, the streptavidin-biotin conjugation system significantly reduces the false positive rate of existing technologies, further improving specificity and sensitivity, and ensuring the stability and reproducibility of the results. Compared to chemiluminescence detection, which can only test a single panel, this invention's single-molecule protein detection technology can achieve multi-panel testing by altering the sequence, saving detection time and improving efficiency.

[0060] This invention breaks down the traditional boundaries between protein and nucleic acid molecular detection, allowing for the simultaneous detection of proteins and nucleic acids within the same detection system. The kit containing nucleic acid fragments and primer probes, constructed based on this method, demonstrates accurate quantification and excellent sensitivity when applied to the detection method. The antigen capture process requires minimal instrumentation, necessitating only the application of magnetic force for incubation and washing steps. This significantly reduces detection costs, improves efficiency, simplifies the process, and reduces the need for high-precision equipment. Consequently, this advanced detection technology can be widely applied in scientific research and biomedical fields, providing a powerful tool for precision medicine and in-depth bioscience research. Attached Figure Description

[0061] Figure 1 This is a schematic diagram illustrating the detection principle of the single-molecule protein detection method of the present invention.

[0062] Figure 2 This is a structural diagram of the nucleic acid labeling detection antibody of the present invention.

[0063] Figure 3 The flowchart of the single-molecule protein detection method of the present invention.

[0064] Figure 4 This is a simplified operational demonstration diagram of the detection method of the present invention.

[0065] Figure 5 This is a graph showing the NTC results of nucleic acids labeled with different modified groups.

[0066] Figure 6 This is a graph showing the screening results of nucleic acid primer-probe combinations in Example 2 of the present invention.

[0067] Figure 7 This is a graph showing the detection limit of P-tau 217 obtained using the method of the present invention in Example 4.

[0068] Figure 8 This is the standard curve diagram of the four-parameter logic function in Example 5. Detailed Implementation

[0069] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0070] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0071] Amplification buffer was purchased from Zhenzhun Biotechnology (Shanghai) Co., Ltd.

[0072] Nucleic acid fragments, primers, and probes were synthesized by Jereh Biotechnology;

[0073] The PCR amplification instrument, chip reader, microchamber chip with microwell array, and sealing oil are all from Zhenzhun Biotechnology (Shanghai) Co., Ltd., and can be purchased and obtained by those skilled in the art.

[0074] Example 1

[0075] This embodiment provides a method for preparing a double-antibody sandwich immune complex.

[0076] Magnetic beads can be used for sample and reagent separation and cleaning. Capture antibodies are immobilized on the surface of the magnetic beads through physical adsorption or chemical modification, and can bind to one binding site of the analyte antigen, thereby separating it from the sample. Detection antibodies can bind to another binding site of the analyte antigen. The binding of nucleic acid fragments to detection antibodies is achieved through chemical modification, thus enabling the coupling of the detection antibody and the nucleic acid fragment.

[0077] The available sizes of magnetic beads include 50, 100, 150, 200 nm and 0.5, 1, 3, 4.5 μm. Since the chip aperture size is 10 μm, magnetic beads ranging from 50 nm to 4.5 μm can be used for testing.

[0078] The surface of magnetic beads is modified with active functional groups that can covalently couple with antibodies, such as hydroxyl, carboxyl, amino, succinimide ester and sulfonyl (such as toluenesulfonyl) and their derivative groups.

[0079] Capture antibodies can be classified according to their specificity as either polyclonal or monoclonal antibodies. They can also be classified according to their origin, such as from animals like mice, rabbits, sheep, or alpacas.

[0080] Antibodies can also be classified as polyclonal or monoclonal antibodies based on their specificity. They can also originate from animals such as mice, rabbits, sheep, or alpacas.

[0081] 1. Capture antibody-labeled magnetic beads

[0082] (1) Activation of magnetic beads: The nano magnetic beads were suspended in 10mM (pH5.5) and activated by shaking at room temperature for 30 min, and the residual activation reagent was washed away.

[0083] (2) Capture antibody conjugation: Capture antibody was conjugated at a dose of 25 μg / mg Beads using 10 mM PBS as the conjugation buffer.

[0084] (pH 8.0), 2 hours at room temperature;

[0085] (3) Blocking: Block with 1% BSA for 45 min, or use ethanolamine or other amino-containing blocking reagents;

[0086] 2. Nucleic acid labeling for antibody detection

[0087] (1) Detection of antibody biotinylation

[0088] ① Preparation of biotin-NHS solution:

[0089] 1) Accurately weigh 1.0 mg of NHS-Biotin.

[0090] 2) Dissolve the weighed NHS-Biotin in 180 μL of sterile pure water to prepare a 5.5 mg / mL solution. Prepare the solution immediately before use to ensure its effectiveness.

[0091] ②A mixture of antibody and biotin:

[0092] 1) Calculate the required amount of biotin based on the antibody to biotin mass ratio (5:1 to 20:1).

[0093] 2) Add the calculated biotin-NHS solution to the antibody to be tested, ensuring that the total reaction volume is greater than 100 μL.

[0094] ③Reaction conditions:

[0095] Rotate the reaction at room temperature in the dark for 1 hour to ensure that biotin-NHS binds fully to the antibody.

[0096] ④ Dialysis / purification:

[0097] 1) After the reaction is complete, transfer the mixture to a dialysis bag and dialyze overnight on a shaker at 4°C with 1×PBS buffer.

[0098] 2) The next day, replace with fresh 1×PBS buffer and continue dialyzing for 5 hours to fully remove unreacted biotin-NHS.

[0099] ⑤ Collection and Preservation:

[0100] 1) After dialysis, collect the biotinylated antibody solution from the dialysis bag.

[0101] 2) Dispense the solution into sterile, low-adhesion tubes to avoid repeated freeze-thaw cycles.

[0102] 3) Store at -80℃, protected from light. For long-term storage, glycerol to a final concentration of 60% can be added to the antibody solution.

[0103] (2) Biotinylation of nucleic acids

[0104] ①Preparation of reaction mixture:

[0105] 1) Add 100 ng to 1 μg of DNA template to a centrifuge tube or PCR tube.

[0106] 2) Add an appropriate amount of ultrapure water to make the total volume reach 34μL.

[0107] ② Add random primer buffer:

[0108] 1) Add 10 μL of 5×Random Primer in Buffer.

[0109] 2) Mix thoroughly. If any droplets remain on the tube wall, quickly and briefly centrifuge to collect all the liquid at the bottom of the tube.

[0110] ③ Heat denaturation treatment:

[0111] 1) Heat in a boiling water bath for 5 minutes, or use a PCR instrument to heat at 100°C for 5 minutes.

[0112] 2) Immediately place the tube in an ice water bath to cool it for at least 2 to 3 minutes.

[0113] ④ Add biotin-labeled mixture:

[0114] 1) Add 5 μL of Biotin-Labeling Mix.

[0115] 2) Add 1 μL of Klenow Fragment and mix well. If any droplets stick to the tube wall, quickly and briefly centrifuge to collect all the liquid at the bottom of the tube.

[0116] ⑤ Incubation reaction:

[0117] 1) Incubate at 37°C for 1 hour or overnight (not exceeding 20 hours).

[0118] 2) To significantly increase the yield of biotin-labeled DNA, it is recommended to incubate at 37°C for 12–20 hours.

[0119] ⑥ Termination of reaction:

[0120] 1) Add 3 μL of labeling stop solution and mix thoroughly to terminate the labeling reaction.

[0121] 2) The labeled DNA can be stored at -20°C.

[0122] (3) Streptavidin-Biotin binding

[0123] ① In a reaction tube, biotinylated molecules and streptavidin solution are mixed in proportion. Biotin:

[0124] The molar ratio of streptavidin is 1:4. The molecule comprises a detection antibody and a nucleic acid.

[0125] ②Incubate the mixture at room temperature for 30 minutes to 1 hour to allow streptavidin and biotin to fully bind.

[0126] Gentle shaking or stirring can promote the reaction.

[0127] ③ Washing:

[0128] 1) If the sample contains many impurities or requires further purification, it can be washed after the reaction.

[0129] 2) Use PBS washing buffer containing 0.1% Tween-20 to wash 3 to 5 times. After each addition of washing buffer, mix gently and then remove the supernatant by centrifugation or other methods.

[0130] 3) After the final wash, retain an appropriate amount of binding buffer to ensure that the sample does not dry out.

[0131] This embodiment uses several different modified groups to label nucleic acids, namely amino-labeled, carboxyl-labeled, streptavidin-biotin-labeled, thiol-labeled, and p-toluenesulfonyl-labeled. NTC testing was performed according to the above experimental steps (without adding antigen, only buffer solution was added), and the test results are as follows. Figure 5 As shown.

[0132] The results show that labeling with amino, carboxyl, thiol, and p-toluenesulfonyl groups leads to an increase in grayscale values ​​(i.e., negative fluorescence values), with background concentrations ranging from 50 to 280 copies / ul. Using amino, carboxyl, thiol, and p-toluenesulfonyl groups results in poor experimental results with high background values ​​and a large error range for positive points, making it impossible to accurately distinguish positive points. However, using streptavidin-biotin labeling results in a background concentration of only 16 copies / ul, significantly lower than that of amino, carboxyl, thiol, and p-toluenesulfonyl groups. This indicates that streptavidin-biotin labeling involves less non-specific binding to other molecules, resulting in lower background and a better signal-to-noise ratio. This helps reduce false positives and further improves the specificity, sensitivity, accuracy, repeatability, and result stability of the detection.

[0133] 3. Preparation of double-antibody sandwich immune complexes

[0134] Step 1 above prepared magnetic beads labeled with capture antibodies, and step 2 prepared nucleic acid labeled detection antibodies.

[0135] The magnetic beads labeled with capture antibodies specifically bind to the target protein, and are then incubated with the detection antibody labeled with nucleic acid. The mixture is washed three times with washing buffer (the magnetic beads in the tube need to be adsorbed by a magnetic stick when discarding the liquid) to obtain a double antibody sandwich immune complex. After optimization testing of the incubation conditions, the optimal incubation temperature was determined to be 37°C and the optimal incubation time was determined to be 10-30 minutes.

[0136] Table 1. Test results at different incubation temperatures and times.

[0137]

[0138] Another preparation method is to incubate the capture antibody magnetic beads, the target protein of the sample to be tested, and the detection antibody labeled with nucleic acid together, gently and continuously shaking at room temperature for about 10 minutes, and wash three times with washing buffer (when discarding the liquid, the magnetic beads in the tube need to be adsorbed by a magnetic rod) to obtain the double antibody sandwich immune complex.

[0139] Another preparation method is as follows: First, the detection antibody labeled with nucleic acid is incubated with the target protein of the sample to be tested, and then incubated with magnetic beads labeled with capture antibody. Gently and continuously shake for about 10 minutes at room temperature, and wash three times with washing buffer (when discarding the liquid, the magnetic beads in the tube need to be adsorbed by a magnetic rod) to obtain the double antibody sandwich immune complex.

[0140] Example 2

[0141] This embodiment provides a kit for detecting p-Tau 217 in Alzheimer's disease.

[0142] The kit in this embodiment contains magnetic beads labeled with capture antibody prepared according to the method of Example 1, a p-Tau 217 capture antibody (Thermo 44-744) for detecting streptavidin-biotin-coupled nucleic acid (TANI) prepared according to the method of Example 1, a detection antibody (Thermo MA5-46894), p-Tau 217 standard, amplification buffer, and primers / probes. The nucleic acids and primers / probes in this kit were obtained through screening multiple combinations of nucleic acid primers / probes.

[0143] This example only shows the screening and comparison results of some nucleic acid primer-probe combinations.

[0144] First set of nucleic acid sequences:

[0145] CCGGATTGCCACCACTATTTTTCATAGCTTGAATTGCTACAGCTTGTGCATCATGAGATGTTACTTCGGCTGCATGTGTCG(SEQ ID NO.1)

[0146] Primers and probes:

[0147] F:CCGGATTGCCACCACTATTT(SEQ ID NO.2)

[0148] R: CGACACATGCAGCCGAAGTA (SEQ ID NO.3)

[0149] P: TGAATTGCTACAGCTTGTGCA (SEQ ID NO.4)

[0150] Second set of nucleic acid sequences:

[0151] CCTCTTCTTTGCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAAC(SEQ ID NO.5)

[0152] Primers and probes:

[0153] F: CCTCTTTCTTTTGCAGCAATGC (SEQ ID NO.6)

[0154] R: GTTGTCATGGATGACCTTGGC (SEQ ID NO.7)

[0155] P: TCCTGCACCACCAACTGCTTAGCACC (SEQ ID NO.8)

[0156] Third group of nucleic acid sequences:

[0157] AGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTG GAGACAGCCGCTC(SEQ ID NO.9)

[0158] Primers and probes:

[0159] F: AGATTTGGACCTGCGAGCG (SEQ ID NO.10)

[0160] R: GAGCGGCTGTCTCCACAAGT (SEQ ID NO.11)

[0161] P: TTCTGACCTGAAGGCTCTGCGCG (SEQ ID NO.12)

[0162] The PCR reaction system was prepared according to the table below. The digital PCR Mix was a purchased product, catalog number LSCK200A. The template was the designed nucleic acid sequence, synthesized by Jereh Biotechnology. The upstream and downstream primers and probes were one of the three sets of primers and probes designed above. Each set of upstream and downstream primers and probes was mixed separately with the template to screen for the sequence and primers / probes with the best detection performance.

[0163] Table 2

[0164] Element Volume (μL) 10X Digital PCR Mix 2 Upstream primer (10 μM) 1 Downstream primer (10 μM) 1 Probe (10μM) 1 template 2 Nuclease-free water 13

[0165] This embodiment requires the use of products manufactured by Zhenzhun Biotechnology (Shanghai) Co., Ltd. The digital PCR system includes an INLD100A digital PCR sample preparation instrument, an INAP100B gene amplification instrument, and an INRD200A digital PCR reader for detection. 20 μL of the prepared sample mix (as shown in the table above) is evenly distributed onto the chip using a sample loading device. The chip is then placed in the gene amplification instrument for amplification, undergoing a thermal cycling amplification reaction. The amplification program settings are shown in Table 3 below.

[0166] Table 3

[0167]

[0168] Note: PCR reaction solution with added samples or chips that have been loaded should be used for experiments immediately. If, due to special reasons, the PCR reaction solution or chips that have been loaded cannot be used for experiments in time, they should be stored at 4°C for no more than 12 hours.

[0169] For detailed experimental results, please see... Figure 6Based on the primer and probe test results, the positive values ​​of the second and third groups were low, the difference in replicates in the second group was large, and the amplification efficiency of both groups of primers and probes was low. Only the first group of primers and probes showed good amplification and a high fluorescence value. Therefore, this invention selects the nucleic acid fragment from the first group for labeling the detection antibody and selects the primer and probe combination from the first group for amplifying this nucleic acid fragment.

[0170] The primers and probes used in the P-tau217 test are:

[0171] F:CCGGATTGCCACCACTATTT(SEQ ID NO.2)

[0172] R: CGACACATGCAGCCGAAGTA (SEQ ID NO.3)

[0173] P: TGAATTGCTACAGCTTGTGCA (SEQ ID NO.4)

[0174] The probe was modified with FAM, and the quenching group was MGB.

[0175] Example 3

[0176] This embodiment provides a kit for detecting p-Tau 217 in Alzheimer's disease using Example 2, based on the single-molecule protein detection method of this invention, to detect p-Tau 217 in real samples.

[0177] 1. Requirements for processing real samples

[0178] (1) Serum: Place the whole blood sample collected in the serum separation tube at room temperature for 2 hours or at 4°C overnight, then centrifuge at 1000×g for 20 minutes and take the supernatant. Alternatively, store the supernatant at -20°C or -80°C, but avoid repeated freeze-thaw cycles.

[0179] (2) Plasma: Collect specimens using EDTA or heparin as anticoagulants, and centrifuge the specimens at 1000×g for 15 minutes at 2-8℃ within 30 minutes after collection. The supernatant can be used for testing, or the supernatant can be stored at -20℃ or -80℃, but repeated freeze-thaw cycles should be avoided.

[0180] 2. The reagent kit of Example 2 is used. The overall detection method operation flowchart and demonstration diagram are shown below. Figure 3 and Figure 4 The specific procedures for testing each sample are as follows:

[0181] (1) Dilute the standard to different concentrations (1 fg / ml, 5 fg / ml, 10 fg / ml);

[0182] (2) Take 10 μL of magnetic bead solution and add it to a 1.5 ml EP tube to make an antigen capture tube;

[0183] (3) Add 100 μL of the diluted standard to the capture antigen tube; incubate at 37°C for 10 min, then wash 3 times with washing buffer;

[0184] (4) Use a magnetic rack to attract the magnetic beads in the tube and discard the solution in the test tube;

[0185] (5) Add the detection antibody that has passed the streptavidin-biotin-coupled nucleic acid to the test tube, incubate at 37°C for 10 min, and then wash 3 times with washing buffer;

[0186] (6) Use a magnetic rack to attract the magnetic beads in the tube and discard the solution in the test tube;

[0187] (7) Add the PCR reaction system solution to the magnetic bead tubes (as shown below) and inject it into the microchamber chip with microporous array.

[0188] Then, add an oil seal;

[0189]

[0190] (8) Place it in a PCR instrument for amplification. The program is: 95℃ for 2 min, 95℃ for 30 s, 58℃ for 45 s, 30 cycles.

[0191] (9) Place the amplified chip into a digital PCR reader for analysis and obtain the results.

[0192] Table 4. Results of determination of p-Tau 217 standard at different concentrations

[0193]

[0194] Calculation steps:

[0195] Calculate the mass (in grams) of the single protein molecule corresponding to each nucleic acid:

[0196] The mass of the single protein corresponding to each nucleic acid = (target protein) molecular weight × N A

[0197] N A N is Avogadro's constant. A =6.022×10 23 mol -1

[0198] 1. Calculate the mass of each μL target protein (in g / μL):

[0199] Mass of target protein per μL = Mass of single protein molecule corresponding to each nucleic acid × Nucleotide concentration

[0200] Note: Original concentration calculation method: Digital PCR analysis concentration × total loading volume 20ul ÷ sample volume 100ul

[0201] 2. Convert protein concentration (g / ul) to (fg / ml):

[0202] Mass of target protein per μL × 10 6 ul / ml×10 15 fg / g

[0203] Taking the data in Table 4, where the standard is 1 fg / ml, as an example, the average value of the analytical results is 43.45 copies / ul, and the molecular weight of p-Tau217 is 70,000 Da.

[0204] a. Calculate the mass (in grams) of a single p-Tau 217 molecule corresponding to each nucleic acid:

[0205] The mass of a single p-Tau 217 molecule corresponding to each nucleic acid is 70000 × (6.022 × 10⁻⁶). 23 mol -1 )

[0206] =1.162×10 -19

[0207] b. Calculate the mass of each μL p-Tau 217 (in g / μL):

[0208] The mass of each ul of p-Tau 217 = 1.162 × 10 -19 ×8.69=1.01×10 -18

[0209] Note: Original concentration calculation method: 43.45 (system analysis result) × 20 (reaction system volume) ÷ 100 (amount of antigen added) = 8.69 copies / ul

[0210] c. Convert protein concentration (g / ul) to (fg / ml):

[0211] Final result = 1.01 × 10 -18 ×10 3 ul / ml×10 15 fg / g = 1.01 fg / ml

[0212] Example 4

[0213] This embodiment provides a method based on Example 3 for determining the detection limit of p-Tau217 for Alzheimer's disease using the kit from Example 2.

[0214] Concentration gradient testing was performed, with the original antigen concentration of 2800 copies / ul being serially diluted 10-fold and 100-fold respectively for testing, and the limit of detection was determined; the lowest detection limit was 17 copies / ul, and the concentration conversion based on the technique described in Example 3 was 0.395 fg / ml; results Figure 7 .

[0215] Example 5

[0216] This embodiment provides a comparative experiment between the method of the present invention and existing technical methods.

[0217] 1. Traditional ELISA test

[0218] Since the detection range of traditional ELISA kits is 0.78–50 pg / mL, only traditional ELISA kits will be used to test AD patient samples. The detection steps are as follows:

[0219] (1) Preparation of standard gradient working solutions: Add 1 mL of universal diluent to the lyophilized standard, let stand for 15 minutes until it is completely dissolved, and then mix gently (concentration is 50 pg / mL). Then dilute according to the following concentrations: 50 pg / mL, 25 pg / mL, 12.5 pg / mL, 6.25 pg / mL, 3.12 pg / mL, 1.56 pg / mL, 0.78 pg / mL, and 0 pg / mL.

[0220] (2) Sample addition: Add 100 μl of sample or standard of different concentrations to each well, and add 100 μL of universal diluent to the blank well. Cover with sealing film and incubate at 37°C for 1 hour.

[0221] (3) Add biotinylated antibody: Remove the ELISA plate, discard the liquid, and do not wash. Add 100 μL of biotinylated antibody working solution directly to each well, cover with the sealing film, and incubate at 37°C for 1 hour.

[0222] (4) Add enzyme conjugate working solution: Add 100 μL of enzyme conjugate working solution to each well, cover with sealing film, and incubate at 37°C for 30 minutes. Wash plate: Discard the liquid and wash the plate 5 times according to the washing method in step 4. Add substrate: Add 90 μL of substrate (TMB) to each well, cover with sealing film, and incubate at 37°C in the dark for 15 minutes. Add stop solution: Remove the microplate, add 50 μL of stop solution directly to each well, and immediately measure the OD value of each well at a wavelength of 450 nm. The results are shown in Table 5. The standard curve of the four-parameter logic function is shown in Table 5. Figure 8 .

[0223] Table 5. Results of Standard Curve Measurement

[0224] Concentration (pg / ml) 50 25 12.5 6.25 3.12 1.56 0.78 0 OD value 2.23 1.53 0.91 0.62 0.43 0.23 0.19 0.06 Correct OD value 2.29 1.47 0.97 0.56 0.37 0.17 0.13 -

[0225] 2. Simoa test

[0226] According to p-Tau 217 ( The ALZpath Assay kit instructions are available from Quanterix. Sample testing was conducted on the HD-X platform.

[0227] 3. Testing of the single-molecule protein detection technology of this invention

[0228] (1) Add 50 μL of the detection samples of p-tau181 and p-tau217 to a magnetic bead tube (10 μL); incubate at 37°C for 10 min, and then wash 3 times with washing buffer;

[0229] (2) Use a magnetic rack to attract the magnetic beads in the tube and discard the solution in the test tube;

[0230] (3) Add 50 μL of the corresponding detection antibody to each test tube, incubate at 37°C for 10 min, and then wash three times with washing buffer.

[0231] (4) Use a magnetic rack to attract the magnetic beads in the tube and discard the solution in the test tube;

[0232] (5) Add the PCR reaction system solution to the magnetic bead tube (as shown in Table 6), inject it into the chip (same as in Example 3), and then seal it with oil.

[0233] Table 6

[0234] Element Volume (μL) 10X Digital PCR Mix 2 Primer-probe mix (10µM) 1 Nuclease-free water 17

[0235] (6) Place it in the PCR machine for amplification. The program is: 95℃ for 2 min, 95℃ for 30 s, 58℃ for 45 s, 30 cycles.

[0236] (7) Place the amplified chip into a digital PCR reader for analysis and obtain the results.

[0237] The results obtained by the three methods described above are summarized in Table 7.

[0238] Table 7 Comparison of Measurement Results of Three Technologies

[0239]

[0240] Based on the results in the table, we can conclude that:

[0241] ① The detection limit of this invention is 0.395 fg / ml. Since the content of p-tau 217 in normal human bodies is extremely low, and the p-tau 217 level in individuals with mild cognitive impairment is lower than that of patients, it cannot be detected in traditional ELISA kits. Therefore, it cannot effectively monitor the p-tau 217 level in normal individuals and cannot predict the progression of Alzheimer's disease in advance. ② The results of the digital single-molecule protein detection technology are consistent with those of Simoa. ③ The digital single-molecule protein detection technology only requires an amplification instrument and a chip to complete the test, eliminating the need for expensive instruments like those used in HD-X. ④ This invention can achieve the determination of multiple antigens in a single test. ⑤ The entire detection time of this invention is 1 hour, which is 2 hours shorter than that of traditional ELISA, significantly reducing the detection time.

[0242] Example 6

[0243] This embodiment provides the method for detecting Aβ40 antigen and Aβ42 antigen as described in Example 3.

[0244] 1. The sequence of the nucleic acid fragment linked to Aβ40 was detected as follows:

[0245] AGCATCTCATTCTCTCAAGCCTACAAGACGCATGACATCAGTGTAGGTAGTTAGTA CGACT(SEQ IDNO.13)

[0246] Primer probe a (for detecting Aβ42) is

[0247] F:AGCATCTCATTCTCTCAAG(SEQ ID NO.14)

[0248] R:AGTCGTACTAACTACCTACA(SEQ ID NO.15)

[0249] P: CCTACAAGACGCATGACATCAG (SEQ ID NO.16)

[0250] The probe was modified with FAM, and the quenching group was MGB.

[0251] 2. The sequence of the nucleic acid fragment linked to Aβ42 was detected.

[0252] CTAAGTAGTGGATTCGCTACTATCACTTCCTGCAATGATGACTGGACTATGTGATTG TGTA(SEQ IDNO.17)

[0253] Primer probe b (for detecting Aβ40) is

[0254] F: CTAAGTAGTGGATTCGCTA (SEQ ID NO.18)

[0255] R: TACACAATCACATAGTCCA (SEQ ID NO.19)

[0256] P: CTATCACTTCCTGCAATGATGAC (SEQ ID NO. 20)

[0257] The probe was modified with HEX, and the quenching group was MGB.

[0258] 3. Two double-antibody sandwich immune complexes, respectively capturing Aβ40 antigen and Aβ42 antigen, were prepared according to the method in Example 1. The sample concentration was controlled at 10. 3 -10 5 copies / ul.

[0259] 4. Two immune complexes were added as templates to the digital PCR reaction system, loaded onto a detection chip containing a microwell array, and an oil phase was added to physically isolate the microwells. Amplification was performed using a PCR instrument. The amplified chip was then placed in a digital PCR reader for photographic analysis, and quantitative detection was achieved by counting the number of microwells emitting fluorescent signals.

[0260] According to the experimental procedure, serum samples from 3 AD patients and 3 benign control patients were measured. Based on the measurement results, the Aβ42 / Aβ40 content in the above samples can be calculated.

[0261] The results are shown in Table 8. As can be seen from Table 8, the method of this application can be used to determine different antigens, and two different antigens can be determined simultaneously in the same test, which shortens the test time and improves the test efficiency.

[0262] The testing method was as follows: 50 μL of Aβ42 and Aβ40 detection samples were added to 10 μL magnetic bead tubes respectively; after incubation at 37°C for 10 min, the tubes were washed three times with washing buffer; the magnetic beads in the tubes were adsorbed using a magnetic rack, and the solution in the tubes was discarded; simultaneously, 50 μL of the corresponding detection antibodies for Aβ42 and Aβ40 were added to the tubes, and after incubation at 37°C for 10 min, the tubes were washed three times with washing buffer; the magnetic beads in the tubes were adsorbed using a magnetic rack, and the solution in the tubes was discarded; the PCR reaction system was added to the magnetic bead tubes, injected into the chip, and sealed with oil; PCR amplification was performed using the following program: 95°C for 2 min, 95°C for 30 s, 58°C for 45 s, for 30 cycles. The amplified chip was then analyzed using a digital PCR reader to obtain the results.

[0263] Table 8 Results of Aβ42 / Aβ40 Detection in Human Serum Samples

[0264]

[0265] As can be seen, the kit detected that the Aβ42 / Aβ40 level in the serum of normal individuals was significantly higher than that in AD patients, which is consistent with the generally accepted results in the field. This indicates that the technology of the present invention can accurately measure the Aβ42 / Aβ40 level and clearly distinguish between AD patients and normal individuals. In addition, the method of the present invention can also monitor Aβ42 / Aβ40 in patients who have cognitive impairment but have not been diagnosed with AD, and predict the progression of AD disease.

[0266] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for detecting single-molecule proteins based on digital PCR, characterized in that, Includes the following steps: (1) The capture antibody magnetic beads, the target protein of the sample to be tested, and the detection antibody specifically bind to form a double antibody sandwich immune complex; the detection antibody is a detection antibody labeled with nucleic acid; the capture antibody and the detection antibody can respectively recognize different antigenic epitopes of the same target protein; (2) The double-antibody sandwich immune complex was added to the digital PCR reaction system for amplification. The amplification results were analyzed and the target protein concentration of the sample to be tested was calculated.

2. The single-molecule protein detection method according to claim 1, characterized in that, The nucleic acid detection antibody described in step (1) is obtained by labeling the nucleic acid onto the detection antibody using streptavidin-biotin.

3. The method for detecting single-molecule proteins according to claim 2, characterized in that, The nucleic acid is a single-stranded nucleic acid or a double-stranded nucleic acid; preferably a single-stranded nucleic acid, and more preferably the nucleotide sequence of the single-stranded nucleic acid is shown in SEQ ID NO.

1.

4. The method for detecting single-molecule proteins according to claim 2, characterized in that, The detection antibody for the labeled nucleic acid was prepared by the following method: 1) Biotinylation of detection antibody: Prepare biotin-NHS solution, mix detection antibody and biotin at a mass ratio of (5-20):1, add biotin-NHS solution to detection antibody and react at room temperature in the dark, dialyze, and collect biotinylated detection antibody solution in dialysis bag; 2) Biotinylation of nucleic acids: Primer buffer is added to the nucleic acid template, heat denaturation is performed, biotin-labeled mixture is added, and incubation is carried out for ≤20 hours to obtain biotin-labeled nucleic acids; 3) By fully combining streptavidin and biotin, the biotinylated nucleic acid is combined with the biotinylated detection antibody.

5. The method for detecting single-molecule proteins according to any one of claims 1 to 4, characterized in that, The capture antibody described in step (1) is coupled to magnetic beads, and each magnetic bead captures a single protein molecule.

6. The method for detecting single-molecule proteins according to claim 5, characterized in that, In step (1), the incubation conditions for capturing the antibody to specifically bind to the target protein are a temperature of 25–37°C and a time of 10 min–2 h. In step (1), the incubation conditions for the detection antibody labeled with nucleic acid and the protein to be tested are 25-37°C for 10 min-2 h.

7. The method for detecting single-molecule proteins according to claim 5, characterized in that, Step (2) After adding the double antibody sandwich immune complex as a template to the digital PCR reaction system, it is then loaded onto a microchamber chip with a microwell array. The surface of the microchamber chip with the microwell array has 3,500 to 20000 small pores with a diameter of 10 to 45 μm. After the double antibody sandwich immune complex is loaded onto the chip, it is sealed with an oil phase to physically isolate the microwells.

8. A nucleic acid combination, characterized in that, It includes a single-stranded nucleic acid, primer pairs, and a probe; the nucleotide sequence of the single-stranded nucleic acid is shown in SEQ ID NO.1; the nucleotide sequences of the primer pairs are shown in SEQ ID NO.2-3; and the nucleotide sequence of the probe is shown in SEQ ID NO.

4.

9. A kit for detecting a single protein using digital PCR, characterized in that, Contains the nucleic acid combination of claim 8, wherein the single-stranded nucleic acid is biotinylated or not biotinylated.

10. The application of the single-molecule protein detection method according to any one of claims 1-7, the nucleic acid combination according to claim 8, or the kit according to claim 9 in the quantitative detection of proteins, wherein the protein is an antibody, organelle protein, plant protein, whey protein, microbial protein, hormone, or cytokine.

Images