Trace DNA modified high-throughput sequencing library and construction method thereof, and method for detecting trace DNA modification in to-be-detected sample

Abstract

The invention relates to the field of biotechnology and biomedicine, in particular to a trace DNA modified high-throughput sequencing library, a construction method thereof and a method for detecting trace DNA modification in a to-be-detected sample. Comprising the following steps: extracting a DNA sample from a to-be-detected sample; carrying out a transposition reaction on the mixed transposase complex and a DNA sample to prepare a transposition product; a DNA fragment is prepared from a transposon product through notch chain supplementation; mixing a plurality of DNA fragments with different sample tags with quality control DNA to prepare a multi-sample DNA fragment mixture; carrying out denaturation treatment on the multi-sample DNA fragment mixture to prepare a single-chain mixture; carrying out binding reaction on the mixed binding molecule-solid phase conjugate and the single-chain mixture to prepare a target chain-binding molecule-solid phase conjugate; collecting a target chain on the target chain-binding molecule-solid phase conjugate, and performing PCR amplification by taking the target chain as a template to construct a high-throughput sequencing library. The method is high in sensitivity and specificity, extremely low in sample demand quantity and beneficial to high throughput and automation.

Description

Technical Field

[0001] This application relates to the fields of biotechnology and biomedicine, and in particular to high-throughput sequencing libraries with trace DNA modifications and their construction methods, as well as methods for detecting trace DNA modifications in test samples. Background Technology

[0002] DNA modification is one of the core mechanisms of epigenetic regulation, playing a crucial role in gene expression, genome stability, cell differentiation, and the occurrence and development of diseases. In addition to the classic 5-methylcytosine (5mC), various other DNA modifications, including 5-hydroxymethylcytosine (5hmC) and N6-methyladenine (6mA), have been discovered, collectively forming a complex "epidemiological code." A comprehensive and accurate analysis of the DNA modification map is of great scientific and clinical value for understanding life processes, discovering novel disease biomarkers, and developing precision medicine strategies.

[0003] Currently, there is an increasing demand for high-quality DNA modification analysis of trace, precious, or partially degraded DNA samples (such as cfDNA, FFPE samples, and puncture biopsy tissue) in scenarios such as early cancer screening, liquid biopsy, and basic research. These samples are typically characterized by extremely low starting amounts, poor integrity, and weak target modification signals, thus placing extremely high demands on the sensitivity, throughput, cost-effectiveness, and multi-target parallel analysis capabilities of detection technologies.

[0004] Current mainstream DNA modification detection technologies, such as sulfite sequencing and its variants, antibody-based immunoprecipitation sequencing, and restriction endonuclease-binding sequencing, while feasible in principle, face common systemic limitations in practical applications, especially when processing the aforementioned challenging samples:

[0005] (1) The library construction process is cumbersome and inefficient: Most methods rely on the initial random DNA fragmentation step. Traditional mechanical fragmentation methods involve many steps, are time-consuming, and result in significant sample loss; while methods based on common restriction endonucleases have limitations such as high enzyme digestion bias and uneven coverage. Neither of these methods can meet the needs of efficient library construction for small samples.

[0006] (2) Stringent requirements for the quality and quantity of starting DNA: Traditional techniques usually require micrograms of DNA as the starting amount and have high requirements for DNA integrity, which cannot be adapted to the analysis of trace or degraded samples.

[0007] (3) Insufficient ability to perform multiple sample pooling detection: Since the fragmentation process itself does not have sample identity information, multiple samples can only be pooled after the tag is introduced by PCR amplification in the later stage. This greatly limits the number of samples that can be processed in parallel at one time, making it difficult to meet the requirements of pooling detection of large batches of samples.

[0008] In view of the above, this application is hereby submitted. Summary of the Invention

[0009] Based on this, one or more embodiments of this application provide a high-throughput sequencing library with trace DNA modification and a method for constructing the library, as well as a method for detecting trace DNA modification in a sample. The technical solutions include the following:

[0010] One or more embodiments of this application provide a method for constructing a high-throughput sequencing library with trace DNA modification, the method comprising the following steps:

[0011] DNA samples are extracted from the sample to be tested, a transposase complex and a binding molecule-solid phase conjugate are provided; wherein the transposase complex includes a transposase and a sequencing adapter and the nucleic acid sequence of the sequencing adapter contains a nucleic acid sequence of a sample tag, and the binding molecule on the binding molecule-solid phase conjugate specifically binds to the target modification on the DNA sample;

[0012] The transposase complex and the DNA sample were mixed to carry out a transposition reaction, and the reaction was terminated to prepare the transposition product.

[0013] The transposon product was nicked and filled to prepare a DNA fragment;

[0014] Multiple DNA fragments prepared from multiple test samples are mixed with quality control DNA to prepare a multi-sample DNA fragment mixture; wherein the nucleic acid sequences of the sample tags of the multiple DNA fragments are different;

[0015] The mixture of multiple DNA fragments was denatured to prepare a single-stranded mixture;

[0016] The target chain-binding molecule-solid phase coupling is prepared by mixing the bound molecule-solid phase coupling compound and the single chain mixture in a binding reaction; and,

[0017] The target strand is collected from the target strand-binding molecule-solid phase conjugate, and PCR amplification is performed using the target strand as a template to construct a high-throughput sequencing library.

[0018] In some embodiments of this application, the construction method satisfies one or more of the conditions shown in (A) to (B) below:

[0019] (A) Methods for terminating the reaction include:

[0020] Add digestion buffer 1 to the transposition reaction system to initiate the first digestion reaction; and,

[0021] Then, stop buffer 1 is added to the obtained first digestion product to carry out the first termination reaction;

[0022] The digestion buffer 1 includes SDS (sodium dodecyl sulfate), and the termination buffer 1 includes PMSF (phenylmethyl sulfonyl fluoride).

[0023] (B) The transposase is selected from Tn5 transposase, MuA transposase, IS5 transposase, IS91 transposase, Vibrio harlequinae transposase, Tn10 transposase, Tn3 transposase, VST1 transposase, Tn7 transposase, Rag1 / Rag2 transposase and their active mutants.

[0024] In some embodiments of this application, the method for terminating the reaction satisfies one or more of the conditions shown in (A1) to (A4):

[0025] (A1) The digestion buffer 1 comprises pH 6-9, 1-1000 mM Tris-HCl buffer, 1-1000 mM EDTA-NaOH, 0.01-10% SDS (w / v), and 0.01-10 mg / mL proteinase K;

[0026] (A2) The conditions for the first digestion reaction include: temperature of 20-75℃ and time of 1-120 min;

[0027] (A3) The termination buffer 1 comprises 1-100 mM MgCl2, 1-100 mM PMSF and 0.01%-1% (v / v) TX-100 (polyoxyethylene octylphenyl ether).

[0028] (A4) The conditions for the first termination reaction include: a temperature of 20-75°C and a time of 1-120 min; or / and,

[0029] The transposable reaction satisfies one or more of the conditions shown in (B1) to (B2) below:

[0030] (B1) The reaction system for the transposition reaction includes: 13-16 μL of the DNA sample, 4 μL of 5× transposition activation solution, and 0.03-5 μL of transposase complex solution; wherein the concentration of DNA in the DNA sample is 0.01-100 ng / μL, the 5× transposition activation solution includes 1-100 mM TAPS-NaOH and 1-100 mM MgCl2, and the transposase complex solution contains 1-96 Tn5-T5 transposases and 1-16 Tn5-T7 transposases, with the concentration of each transposase complex being 1-1000 μM;

[0031] (B2) The reaction conditions for the transposition reaction include: temperature of 20-60℃ and time of 1-120 min.

[0032] In some embodiments of this application, the method for collecting the target chain on the target chain-binding molecule-solid phase coupling includes:

[0033] The target chain-binding molecule-solid phase conjugate was washed, and digestion buffer 2 was added for a second digestion reaction; and,

[0034] Add termination buffer 2 to the obtained second digestion product to carry out the second termination reaction, and collect the reaction solution;

[0035] The digestion buffer 2 includes proteinase K, and the termination buffer 2 includes PMSF.

[0036] In some embodiments of this application, the method for collecting the target chain on the target chain-binding molecule-solid phase coupling satisfies one or more of the following conditions (C1) to (C5):

[0037] (C1) The digestion buffer 2 comprises pH 7.0-9.0, 1-100 mM Tris-HCl buffer, 1-100 mM EDTA-NaOH and 0.01-1 mg / mL proteinase K;

[0038] (C2) The conditions for the second digestion reaction include: temperature of 20-75℃ and time of 1-120 min;

[0039] (C3) The termination buffer 2 comprises 1-10 mM PMSF and 1-100 mM MgCl2;

[0040] (C4) The conditions for terminating the second reaction include: a temperature of 20-75℃ and a time of 1-120 min;

[0041] (C5) Washing is performed using the first sample washing buffer and / or the second sample washing buffer;

[0042] The first sample washing buffer comprises 1-100 mM Na3PO4, 10-500 mM NaCl and 0.01%-1% TX-100, pH 6.0-9.0;

[0043] The second sample washing buffer consists of 1-100 mM Tris-HCl, pH 7.0-9.0.

[0044] In some embodiments of this application, the reaction satisfies one or more of the following conditions (D1) to (D2):

[0045] (D1) The conditions for the combination reaction include: temperature of 4-37 ℃ and time of 1-24 h;

[0046] (D2) The system for the binding reaction includes: 50 μL of 10× IP buffer, 1-500 μL of binding molecule-solid phase conjugate suspension, and 1-500 μL of single-stranded mixture. The concentration of the binding molecule-solid phase conjugate in the binding molecule-solid phase conjugate suspension is 0.01-100 μg / μL, and the concentration of the DNA strand in the single-stranded mixture is 0.01-100 ng / μL.

[0047] In some embodiments of this application, the construction method satisfies one or more of the following conditions (E1) to (E11):

[0048] (E1) The method for extracting the DNA sample includes any one or more of the following methods: organic phenol-chloroform method, solid phase extraction method, Chelex-100 boiling water method, salting out method, centrifugal column method, magnetic microparticle method, silica membrane method, fully automated nucleic acid extractor method, microfluidic chip method and direct amplification method.

[0049] (E2) The target modification includes one or more of the following modifications: DNA modification including but not limited to methylation, hydroxymethylation, formylation, carboxylation, phosphorylation-sulfurization, acetylation, hydroxyacetylation, carboxyethylation, phosphorylation, glycosylation, nitrosylation, alkylation, carboxymethylation, chloroethylation, epoxyethylation, dimethylation, polymethylation, hypomethylation, demethylation, oxidative demethylation, deamination modification, crosslinking modification, hydroxylamine modification, azide modification, biotin labeling, alkynyl labeling, fluorination modification, bromination modification, iodination modification, and nitration modification. Thiol group modification, methoxy group modification, ethoxy group modification, phosphoryl thioate modification, amination modification, arylation modification, allylation modification, acetylation modification, hydroxylation, oxidative damage modification, photochemical modification, cross-linking modification, terminal group modification, artificial nucleotide substitution modification, photorepair derivatization modification, trans-hydroxyl group modification, depyrimidinization modification, adenosine deamination modification, purine deamination modification, polysaccharide bonding modification, isomerization modification, deoxyribose backbone modification, hydroxyalkylation, lipidation, aromatic cyclization modification, chelation modification, nanotag modification, and single-molecule fluorescent probe modification;

[0050] (E3) The solid phase in the combined molecule-solid phase coupling includes magnetic beads;

[0051] (E4) The quality control DNA includes one or more of the following: exogenous chromosomes, artificially synthesized nucleic acid molecules, quantitatively spiked nucleic acids, artificial adapters, synthetic oligonucleotide mixtures, host cell exogenous insert fragments, and copy number normalized reference templates; or / and, the quality control DNA includes at least one quality control DNA with methylation modification and at least one quality control DNA without methylation modification;

[0052] (E5) Gap completion was performed using Klenow enzyme;

[0053] (E6) Denaturation treatment shall be performed using one or more of the following methods: heat denaturation, alkali denaturation, denaturant treatment and helicase method;

[0054] (E7) The amplified product is purified by one or more of the following methods: phenol / chloroform extraction, column purification, gel electrophoresis recovery, magnetic bead purification, enzymatic purification, ethanol precipitation, ultrafiltration and reverse phase chromatography;

[0055] (E8) PCR amplification is performed using one or more of DNA polymerase and reverse transcriptase; the DNA polymerase includes one or more of Taq DNA polymerase, KAPA high-fidelity polymerase, Q5 DNA polymerase, KOD DNA polymerase, pfu DNA polymerase and Tth DNA polymerase;

[0056] (E9) PCR amplification methods include one or more of the following: quantitative real-time PCR, digital PCR, and droplet digital PCR;

[0057] (E10) Purification methods for high-throughput sequencing libraries include one or more of the following: SPRI magnetic bead purification based on fragment size selection, agarose gel electrophoresis gel extraction, polyacrylamide gel electrophoresis gel extraction, and size-selective centrifugation column based on membrane filtration.

[0058] (E11) The sample to be tested includes any one or more of the following: tissues, organs and cells in a normal physiological state, tissues, organs and cells in a pathological state, body fluids, and secretions.

[0059] In some embodiments of this application, the bound molecule-solid phase coupling satisfies one or more of the following conditions (E3-1) to (E3-4):

[0060] (E3-1) The magnetic beads include nano-magnetic beads and / or micro-magnetic spheres;

[0061] (E3-2) The magnetic beads include one or more of the following magnetic beads: carboxyl magnetic beads, amino magnetic beads, oleylamine modified magnetic beads, silanol magnetic beads, sulfonic acid magnetic microspheres, thiol magnetic microspheres, PEG modified magnetic beads, unmodified iron oxide magnetic beads, monodisperse silica-coated magnetic beads, epoxy-coated magnetic beads, monodisperse mesoporous silica-coated magnetic beads, gold-coated magnetic nanoparticles, streptavidin-modified magnetic beads, polylysine-modified magnetic beads, nickel magnetic beads, magnetic polystyrene microspheres, and silica magnetic microspheres;

[0062] (E3-3) The binding molecule in the binding molecule-solid phase conjugate is an antibody or an antigen-binding fragment;

[0063] (E3-4) The bound molecule and solid phase in the bound molecule-solid phase coupling are coupled by one or more of the following methods: direct coupling, indirect coupling, and biotin-avidin coupling; or by one or more of the following methods: carbodiimide-mediated condensation reaction, Schiff base reaction, and click chemistry reaction; or / and,

[0064] The sample to be tested satisfies one or more of the following conditions (E11-1) to (E11-3):

[0065] (E11-1) The sample to be tested includes plasma;

[0066] (E11-2) The volume of the sample to be tested is 10-5000 μL;

[0067] (E11-3) The DNA sample mentioned includes cfDNA.

[0068] One or more embodiments of this application provide a high-throughput sequencing library constructed using the method described above for constructing a high-throughput sequencing library with trace DNA modification.

[0069] One or more embodiments of this application provide a method for detecting trace amounts of DNA modification in a sample to be tested, the detection method comprising the following steps:

[0070] A high-throughput sequencing library was constructed using the described construction method; and sequencing was performed.

[0071] In some embodiments of this application, the sequencing method includes one or more of first-generation sequencing, second-generation sequencing, and third-generation sequencing.

[0072] Compared with traditional technologies, this application has the following advantages:

[0073] (1) High sensitivity and specificity

[0074] By employing a dual strategy of "mild transposase fragmentation" and "sample indexing / tag-based combined detection," and using binding molecules-solid phase conjugates to pre-enrich target DNA modification signals before library construction, background interference and batch effects are significantly reduced. Using the method described in this application, the capture rate of DNA methylated fragments on free chromatin can be improved, while the capture rate of unmethylated fragments is controlled at an extremely low level. The capture specificity is high, significantly superior to current technologies.

[0075] (2) The sample size requirement is extremely low.

[0076] The combined use of transposases and binding molecules-solid phase conjugates can significantly reduce the minimum starting amount for library construction of a single sample (both sample size and DNA content in the sample are reduced), greatly reducing the need for sample size and solving the problem of insufficient sample size in large-scale clinical testing.

[0077] (3) Facilitates high throughput and automation

[0078] This application pre-labels multiple test samples with unique samples before merging them into a library, greatly improving experimental throughput, saving experimental time and reagent consumption, and minimizing testing costs. The operational process facilitates full automation, further enhancing the adaptability of this technology to real-world clinical testing scenarios. Attached Figure Description

[0079] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0080] Figure 1 This is a schematic diagram of a high-throughput detection method for DNA modification based on a transposase-based sample tagging strategy.

[0081] Figure 2 This is a comparison chart (IGV visualization) showing the enrichment of cfDNA methylation signals detected in the same 8 independent plasma samples using the multi-sample pooling strategy (high-throughput detection) described in this application and the conventional low-throughput detection strategy.

[0082] Figure 3 This is a comparison chart (signal heatmap) showing the enrichment of cfDNA methylation signals detected in the same 8 independent plasma samples using the multi-sample pooling strategy (high-throughput detection) described in this application and the conventional low-throughput detection strategy.

[0083] Figure 4 This is a comparison chart (average signal intensity) of cfDNA methylation signal enrichment detected in the same 8 independent plasma samples using the multi-sample pooling strategy (high-throughput detection) described in this application and the conventional low-throughput detection strategy.

[0084] Figure 5 The Pearson correlation of enriched cfDNA methylation signals in the peak region was obtained by using the multi-sample pooling strategy (high-throughput detection) and conventional low-throughput detection strategies described in this application in eight independent plasma samples.

[0085] Figure 6a and Figure 6b This study compares the capture efficiency and specificity quality control results obtained using the multi-sample mixing strategy (high-throughput detection) described in this application and the conventional low-throughput detection strategy. Detailed Implementation

[0086] The present application will be further described in detail below with reference to the accompanying drawings, embodiments, and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0087] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the specification of this application is for descriptive purposes only and is not intended to be limiting of the application.

[0088] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0089] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").

[0090] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0091] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.

[0092] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0093] In this document, terms such as “preferred,” “better,” “more suitable,” and “ideal” are merely used to describe implementation methods or examples that achieve better results, and should be understood not to limit the scope of protection of this application.

[0094] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0095] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0096] In this application, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.

[0097] In this application, the technical features described in an open-ended manner include both closed technical solutions consisting of the listed features and open technical solutions that include the listed features.

[0098] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0099] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0100] In this application, %(w / w) and wt% both represent weight percentage, %(v / v) refers to volume percentage, and %(w / v) refers to mass-volume percentage.

[0101] All references to this application are incorporated herein by reference as if each document were individually incorporated herein by reference. Unless they conflict with the purpose and / or technical solution of this application, all cited references are incorporated herein by reference in their entirety and for all purposes. When references are cited in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. Examples and preferred embodiments of the cited technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.

[0102] A first aspect of this application provides a method for constructing a high-throughput sequencing library modified with trace amounts of DNA, the method comprising the following steps:

[0103] DNA samples are extracted from the sample to be tested, a transposase complex and a binding molecule-solid phase conjugate are provided; wherein the transposase complex includes a transposase and a sequencing adapter and the nucleic acid sequence of the sequencing adapter contains a nucleic acid sequence of a sample tag, and the binding molecule on the binding molecule-solid phase conjugate specifically binds to the target modification on the DNA sample;

[0104] The transposase complex and the DNA sample were mixed to carry out a transposition reaction, and the reaction was terminated to prepare the transposition product.

[0105] The transposon product was nicked and filled to prepare a DNA fragment;

[0106] Multiple DNA fragments prepared from multiple test samples are mixed with quality control DNA to prepare a multi-sample DNA fragment mixture; wherein the nucleic acid sequences of the sample tags of the multiple DNA fragments are different;

[0107] The mixture of multiple DNA fragments was denatured to prepare a single-stranded mixture;

[0108] The target chain-binding molecule-solid phase coupling is prepared by mixing the bound molecule-solid phase coupling compound and the single chain mixture in a binding reaction; and,

[0109] The target strand is collected from the target strand-binding molecule-solid phase conjugate, and PCR amplification is performed using the target strand as a template to construct a high-throughput sequencing library.

[0110] In some embodiments of this application, the construction method satisfies one or more of the conditions shown in (A) to (B) below:

[0111] (A) Methods for terminating the reaction include:

[0112] Add digestion buffer 1 to the transposition reaction system to initiate the first digestion reaction; and,

[0113] Then, stop buffer 1 is added to the obtained first digestion product to carry out the first termination reaction;

[0114] The digestion buffer 1 includes SDS (sodium dodecyl sulfate), and the termination buffer 1 includes PMSF (phenylmethyl sulfonyl fluoride).

[0115] (B) The transposase is selected from Tn5 transposase, MuA transposase, IS5 transposase, IS91 transposase, Vibrio harlequinae transposase, Tn10 transposase, Tn3 transposase, VST1 transposase, Tn7 transposase, Rag1 / Rag2 transposase and their active mutants.

[0116] In some embodiments of this application, the method for terminating the reaction satisfies one or more of the conditions shown in (A1) to (A4):

[0117] (A1) The digestion buffer 1 comprises pH 6-9 (e.g., 6, 6.5, 7, 7.5, 8, 8.5, 9), 1-1000 mM (e.g., 1, 5, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000 mM) Tris-HCl buffer, and 1-1000 mM EDTA-NaOH, 0.01-10% SDS (w / v), and 0.01-10 mg / mL proteinase K; the concentration of EDTA-NaOH in the digestion buffer 1 is, for example, 1, 5, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000 mg / mL proteinase K; The concentrations of SDS (mM) are, for example, 0.01%, 0.1%, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, and the concentrations of proteinase K are, for example, 0.01, 0.1, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10 mg / mL;

[0118] (A2) The conditions for the first digestion reaction include: temperature of 20-75℃ and time of 1-120 min; the temperature of the first digestion reaction is 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75℃, and the time of the first digestion reaction is 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 min.

[0119] (A3) The termination buffer 1 comprises 1-100 mM MgCl2, 1-100 mM PMSF, and 0.01%-1% (v / v) TX-100 (polyoxyethylene octylphenyl ether); the concentration of MgCl2 in the termination buffer 1 is, for example, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 mM; the concentration of PMSF is, for example, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 mM; and the concentration of TX-100 is, for example, 0.01%, 0.05%, 0.1%, 0.5%, 1%.

[0120] (A4) The conditions for the first termination reaction include a temperature of 20-75℃ and a time of 1-120 min; the temperature of the first termination reaction is, for example, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75℃, and the time of the first termination reaction is, for example, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 min.

[0121] In some embodiments of this application, the transposable reaction satisfies one or more of the conditions shown in (B1) to (B2) below:

[0122] (B1) The transposition reaction system comprises: 13-16 μL of the DNA sample (e.g., 13, 14, 15, 16 μL), 4 μL of 5× transposition activation solution, and 0.03-5 μL of transposase complex solution (e.g., 0.03, 0.05, 0.1, 0.5, 1, 2, 3, 4, 5 μL); wherein the concentration of DNA in the DNA sample is 0.01-100 ng / μL (e.g., 0.01, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 ng / μL), and the 5× transposition activation solution comprises 1-100 ng / μL. TAPS-NaOH in mM (e.g., 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 mM) and TAPS-NaOH in 1-100 mM (e.g., 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 mM) MgCl2, wherein the transposase complex solution contains 1-96 types (e.g., 1, 2, 3, 4, 5, ... 90, 91, 92, 93, 94, 95, 96) of Tn5-T5 transposases and 1-16 types (e.g., 1, 2, 3, 4, 5, ... 12, 13, 14, 15, 16) of Tn5-T7 transposases, and the concentration of each transposase complex is 1-1000 μM (e.g., 1, 5, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000 μM);

[0123] (B2) The reaction conditions for the transposition reaction include: temperature of 20-60℃ (e.g., 20, 25, 30, 35, 40, 45, 50, 55, 60℃) and time of 1-120 min (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 min).

[0124] In some embodiments of this application, the method for collecting the target chain on the target chain-binding molecule-solid phase coupling includes:

[0125] The target chain-binding molecule-solid phase conjugate was washed, and digestion buffer 2 was added for a second digestion reaction; and,

[0126] Add termination buffer 2 to the obtained second digestion product to carry out the second termination reaction, and collect the reaction solution;

[0127] The digestion buffer 2 includes proteinase K, and the termination buffer 2 includes PMSF.

[0128] In some embodiments of this application, the method for collecting the target chain on the target chain-binding molecule-solid phase coupling satisfies one or more of the following conditions (C1) to (C5):

[0129] (C1) The digestion buffer 2 comprises pH 7-9 (e.g., 6, 6.5, 7, 7.5, 8, 8.5, 9), 1-100 mM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 mM) Tris-HCl buffer, and 1-100 mM EDTA-NaOH and 0.01-1 mg / mL proteinase K; the concentration of EDTA-NaOH is, for example, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 mM, and the concentration of proteinase K is, for example, 0.01, 0.1, 0.5, 0.6, 0.7, 0.8, 0.9, 1 mg / mL;

[0130] (C2) The conditions for the second digestion reaction include: temperature of 20-75℃ and time of 1-120 min; the temperature of the second digestion reaction is 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75℃, and the time of the second digestion reaction is 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 min.

[0131] (C3) The termination buffer 2 comprises 1-10 mM PMSF and 1-100 mM MgCl2;

[0132] (C4) The conditions for the second termination reaction include: a temperature of 20-75℃ and a time of 1-120 min; the temperature of the second termination reaction is, for example, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75℃, and the time of the second termination reaction is, for example, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 min;

[0133] (C5) Washing is performed using the first sample washing buffer and / or the second sample washing buffer;

[0134] The first sample washing buffer comprises 1-100 mM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 mM) Na3PO4, 10-500 mM (e.g., 10, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 mM) NaCl, and 0.01%-1% (e.g., 0.01%, 0.05%, 0.1%, 0.5%, 1%) TX-100, pH 6-9 (e.g., 6, 6.5, 7, 7.5, 8, 8.5, 9);

[0135] The second sample washing buffer comprises 1-100 mM (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 mM) Tris-HCl, pH 7-9 (e.g., 6, 6.5, 7, 7.5, 8, 8.5, 9).

[0136] In some embodiments of this application, the reaction satisfies one or more of the following conditions (D1) to (D2):

[0137] (D1) The conditions for the binding reaction include: a temperature of 4-37 °C (e.g., 4, 5, 10, 15, 20, 25, 30, 35, 37 °C) and a time of 1-24 h (e.g., 1, 22, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 h);

[0138] (D2) The system for the binding reaction comprises: 50 μL of 10×IP buffer, 1-500 μL of a suspension of the binding molecule-solid phase conjugate (e.g., 1, 10, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 μL), and 1-500 μL of a mixture of single chains (e.g., 1, 10, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500 μL), wherein the concentration of the binding molecule-solid phase conjugate in the suspension is 0.01-100 μL. The concentration of DNA strands in the single-stranded mixture is 0.01-100 ng / μL (e.g., 0.01, 0.5, 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 ng / μL).

[0139] In some embodiments of this application, the construction method satisfies one or more of the following conditions (E1) to (E11):

[0140] (E1) The method for extracting the DNA sample includes any one or more of the following methods: organic phenol-chloroform method, solid phase extraction method, Chelex-100 boiling water method, salting out method, centrifugal column method, magnetic microparticle method, silica membrane method, fully automated nucleic acid extractor method, microfluidic chip method and direct amplification method.

[0141] (E2) The target modification includes one or more of the following modifications: DNA modification including but not limited to methylation, hydroxymethylation, formylation, carboxylation, phosphorylation-sulfurization, acetylation, hydroxyacetylation, carboxyethylation, phosphorylation, glycosylation, nitrosylation, alkylation, carboxymethylation, chloroethylation, epoxyethylation, dimethylation, polymethylation, hypomethylation, demethylation, oxidative demethylation, deamination modification, crosslinking modification, hydroxylamine modification, azide modification, biotin labeling, alkynyl labeling, fluorination modification, bromination modification, iodination modification, and nitration modification. Thiol group modification, methoxy group modification, ethoxy group modification, phosphoryl thioate modification, amination modification, arylation modification, allylation modification, acetylation modification, hydroxylation, oxidative damage modification, photochemical modification, cross-linking modification, terminal group modification, artificial nucleotide substitution modification, photorepair derivatization modification, trans-hydroxyl group modification, depyrimidinization modification, adenosine deamination modification, purine deamination modification, polysaccharide bonding modification, isomerization modification, deoxyribose backbone modification, hydroxyalkylation, lipidation, aromatic cyclization modification, chelation modification, nanotag modification, and single-molecule fluorescent probe modification;

[0142] (E3) The solid phase in the combined molecule-solid phase coupling includes magnetic beads;

[0143] (E4) The quality control DNA includes one or more of the following: exogenous chromosomes, artificially synthesized nucleic acid molecules, quantitatively spiked nucleic acids, artificial adapters, synthetic oligonucleotide mixtures, host cell exogenous insert fragments, and copy number normalized reference templates; or / and, the quality control DNA includes at least one quality control DNA with methylation modification and at least one quality control DNA without methylation modification;

[0144] (E5) Gap completion was performed using Klenow enzyme;

[0145] (E6) Denaturation treatment shall be performed using one or more of the following methods: heat denaturation, alkali denaturation, denaturant treatment and helicase method;

[0146] (E7) The amplified product is purified by one or more of the following methods: phenol / chloroform extraction, column purification, gel electrophoresis recovery, magnetic bead purification, enzymatic purification, ethanol precipitation, ultrafiltration and reverse phase chromatography;

[0147] (E8) PCR amplification is performed using one or more of DNA polymerase and reverse transcriptase; the DNA polymerase includes one or more of Taq DNA polymerase, KAPA high-fidelity polymerase, Q5 DNA polymerase, KOD DNA polymerase, pfu DNA polymerase and Tth DNA polymerase;

[0148] (E9) PCR amplification methods include one or more of the following: quantitative real-time PCR, digital PCR, and droplet digital PCR;

[0149] (E10) Purification methods for high-throughput sequencing libraries include one or more of the following: SPRI magnetic bead purification based on fragment size selection, agarose gel electrophoresis gel extraction, polyacrylamide gel electrophoresis gel extraction, and size-selective centrifugation column based on membrane filtration.

[0150] (E11) The sample to be tested includes any one or more of the following: tissues, organs and cells in a normal physiological state, tissues, organs and cells in a pathological state, body fluids, and secretions.

[0151] In some embodiments of this application, the bound molecule-solid phase coupling satisfies one or more of the following conditions (E3-1) to (E3-4):

[0152] (E3-1) The magnetic beads include nano-magnetic beads and / or micro-magnetic spheres;

[0153] (E3-2) The magnetic beads include one or more of the following magnetic beads: carboxyl magnetic beads, amino magnetic beads, oleylamine modified magnetic beads, silanol magnetic beads, sulfonic acid magnetic microspheres, thiol magnetic microspheres, PEG modified magnetic beads, unmodified iron oxide magnetic beads, monodisperse silica-coated magnetic beads, epoxy-coated magnetic beads, monodisperse mesoporous silica-coated magnetic beads, gold-coated magnetic nanoparticles, streptavidin-modified magnetic beads, polylysine-modified magnetic beads, nickel magnetic beads, magnetic polystyrene microspheres, and silica magnetic microspheres;

[0154] (E3-3) The binding molecule in the binding molecule-solid phase conjugate is an antibody or an antigen-binding fragment;

[0155] (E3-4) The bound molecule and the solid phase in the bound molecule-solid phase coupling are coupled by one or more of the following methods: direct coupling, indirect coupling and biotin-avidin coupling, or by one or more of the following methods: carbodiimide-mediated condensation reaction, Schiff base reaction and click chemistry reaction.

[0156] In some embodiments of this application, the sample to be tested satisfies one or more of the following conditions (E11-1) to (E11-3):

[0157] (E11-1) The sample to be tested includes plasma;

[0158] (E11-2) The volume of the sample to be tested is 10-5000 μL (e.g., 1, 5, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 μL).

[0159] (E11-3) The DNA sample mentioned includes cfDNA.

[0160] A second aspect of this application provides a high-throughput sequencing library constructed using the method described above for constructing a high-throughput sequencing library modified with trace amounts of DNA.

[0161] A third aspect of this application provides a method for detecting trace amounts of DNA modification in a sample to be tested, the method comprising the following steps:

[0162] A high-throughput sequencing library was constructed using the described construction method; and sequencing was performed.

[0163] In some embodiments of this application, the sequencing method includes one or more of first-generation sequencing, second-generation sequencing, and third-generation sequencing.

[0164] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0165] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0166] To address the shortcomings of traditional technologies, this application aims to provide a highly sensitive, low-starting-amount, and high-throughput method for detecting DNA modifications. The core of this application lies in optimizing the transposase reaction system to achieve efficient DNA fragmentation and adapter ligation, and innovatively combining multiple samples into a single process for subsequent steps by pre-labeling each sample with a unique tag.

[0167] The most groundbreaking advantage of this method lies in fundamentally solving the challenge of achieving safe and efficient parallel detection of precious samples. By integrating a multi-sample indexing system into the initial step of transpozyme library construction, precise sample identification is achieved simultaneously with DNA fragmentation, enabling sample mixing with low cross-contamination and high traceability, laying a crucial foundation for large-scale parallel detection. At the same time, the streamlined and optimized library construction process significantly improves efficiency for low starting amounts of DNA, and the fully automated process, achieved through an automated platform, ensures stable and efficient detection of large-scale, trace-volume samples.

[0168] Furthermore, this application designs a flexibly configurable modular targeted enrichment strategy that is highly compatible with specific capture elements for different DNA modification types, thereby supporting parallel analysis of multiple modification biomarkers in a single process. This highly integrated technical approach forms a complete automated solution, ultimately achieving high-sensitivity, high-precision, and low-cost high-throughput parallel detection of multiple DNA modification biomarkers in large-scale, trace-volume samples.

[0169] The method described in this application is shown in the following example.

[0170] 1. Reagents

[0171] (1) 5× transposable activating solution: 50 mM TAPS-NaOH, 50 mM MgCl2;

[0172] (2) Tn5 transposase complex solution, wherein the in vitro assembly steps of the Tn5 transposase complex include:

[0173] The Tn5 protein obtained from the purified pTXB1-Tn5 plasmid was assembled in the following reaction system including the adapter (25 µM Tn5, 25 µM adapter, 100× Cocktails (a mixture of phosphatase inhibitors)). After the assembly reaction, the Tn5 transposase complex was collected by centrifugation. The reaction conditions were 25℃ for 1.5 hours, the reaction volume was 50 µL, and the centrifugation conditions were 300 rpm.

[0174] Table 1

[0175]

[0176] (3) Digestion buffer 1: pH=8.0, 60 mM Tris-HCl buffer and 60 mM EDTA-NaOH, 0.25% SDS (w / v), 0.6 mg / mL proteinase K;

[0177] (4) Termination buffer 1: 4 mM PMSF, 0.36% TX-100, 50 mM MgCl2;

[0178] (5) Antibody-magnetic bead conjugates, including antibody-magnetic bead conjugates that specifically bind to the following DNA modifications: methylation;

[0179] (6) First sample washing buffer: 10 mM Na3PO4 (pH=7.0), 150 mM NaCl, 0.05% (v / v) TX-100;

[0180] (7) Second sample washing buffer: 10 mM Tris-HCl, pH=7.4;

[0181] (8) Digestion buffer 2: pH=8.0, 60 mM Tris-HCl buffer and 60 mM EDTA-NaOH, 0.6 mg / mL proteinase K;

[0182] (9) Termination buffer 2: 4 mM PMSF, 50 mM MgCl2;

[0183] (10) Quality control DNA mixture, consisting of the following components:

[0184] Table 2

[0185]

[0186] The corresponding nucleic acid sequence of Filler DNA:

[0187] 1 CpG (SEQ ID NO.17):

[0188] GAGGTGATAAAAATTAACTGCTTAACTGTCAATGTAATACAAGTTGTTTGATCTTTGCAATGATTCTTATCAGAAACCATATAGTAAATTAGTTACACACAGGAAATTTTTAATATTATTATTATCATTCATTATGTATTAAAATTAGAGTTGTGGCTTGGCTCTGCTAACACGTTGCTCATAGGAGATATGGTAGAGCC;

[0189] 5CpG(SEQ ID NO.18):

[0190] CATGTCCAGAGCTCATTCGAAGCAGATATTTCTGGATATTGTCATAAAACAATTTAGTGAATTTATCATCGTCCACTTGAATCTGTGGTTCATTACGTCTTAACTCTTCATATTTAGAAATGAGGCTGATGAGTTCCATATTTGAAAAGTTTTCATCACTACTTAGTTTTTTGATAGCTTCAAGCCAGAGTTGTCTTTTTCTATCTACTCTCATACAACCAATAAATGCTGAAATGAATTCTAAGCGGAGATCGCCTAGTGATTTTAAAC;

[0191] 10CpG(SEQ ID NO.19):

[0192] CTGACCATTTCCATCATTCCAGTCGAACTCACACACAACACCATATGCATTTAAGTCGCTTGAAATTGCTATAAGCAGAGCATGTTGCGCCAGCATGATTAATACAGCATTTAATACAGAGCCGTGTTTATTGAGTCGGTATTCAGAGTCTGACCAGAAATTATTAATCTGGTGAAGTTT TTCCTCTGTCATTACGTCATGGTCGATTTCAATTTCTATTGATGCTTTCCAGTCGTAATCAATGATGTATTTTTTGATGTTTGACATCTGTTCATATCCTCACAGATAAAATCGCCTCACACTGGAGGGCAAAGAAGATTTCCAATAATCAGAACAAGTCGGCTCCTGTTTAGTTAC;

[0193] 15CpG(SEQ ID NO.20):

[0194] ATGTATCCATTGAGCATTGCCGCAATTTCTTTTGTGGTGATGTCTTCAAGTGGAGCATCAGGCAGACCCCTCCTTATTGCTTTAATTTTGCTCATGTAATTTATGAGTGTCTTCTGCTTGATTCCTCTGCTGGCCAGGATTTTTTCGTAGCGATCAAGCCATGAATGTAACGTAACGGAATTATCACTGTTGATTCTCGCTGTCAGAGGCTTGTGTTTGTGTCCTGAAAATAACTCAATGTTGGCCTGTATAGCTTCAGTGATTGCGATTCGCCTGTCTCTGCCTAATCCAAACTCTTTACCCGTCCTTGGGTCCCTGTAGCAGTAATATCCATTGTTTCTTATATAAAGGTTAGGGGGTAAATCCCGGCGCTCATGACTTCGCCTTCTTCCCATTTCTGATCCTCTTCAAAAGGCCACCTGTTACTGGTCGATTTAAGTCAACCTTTACCGCTGATTCGTG;

[0195] 21LCpG(SEQ ID NO.21):

[0196] CGGAGTAGAAGATGGTAGAAATCAATAATCAACGTAAGGCGTTCCTCGATATGCTGGCGTGGTCGGAGGGAACTGATAACGGACGTCAGAAAACCAGAAATCATGGTTATGACGTCATTGTAGGCGGAGAGCTATTTACTGATTACTCCGATCACCCTCGCAAACTTGTCACGCTAAACCCAAAACTCAAATCAACAGGCGCCGGACGCTACCAGCTTCTTTCCCGTTGGTGGGATGCCTACCGCAAGCAGCTTGGCCTGAAAGACTTCTCTCCGAAAAGTCAGGACGCTGTGGCATTGCAGCAGATTAAGGAGCGTGGCGCTTTACCTATGATTGATCGTGGTGATATCCGTCAGGCAATCGACCGTTGCAGCAATATCTGGGCTTCACTGCCGGGCGCTGGTTATGGTCAGTTCGAGCATAAGGCTGACAGCCTGATTGCAAAATTCAAAGAAGCGGGCGGAACGGTCAGAGAGATTGATGTATGAGCAGAG;

[0197] 22SCpG (SEQ ID NO.22):

[0198] ATCAGCAGAGTGTTAATCTCCTGCATGGTTTCATCGTTAACCGGAGTGATGTCGCGTTCCGGCTGACGTTCTGCAGTGTATGCAGTATTTTCGACAATGCGCTCGGCTTCATCCTTGTCATAGATACCAGCAAATCCGAAGGCCAGACGGGCACACTGAATCATGGCTTTATGACGTAACATCCGTTTGGGATGCGACTGCCACGGCCCCGTGATTTCTCTGCCTTCGCGAGTTTTGAATGGTTCGCGGCGGCATTCATCCATCCATTCGGTAA;

[0199] Nucleic acid sequence of the corresponding Spike in DNA:

[0200] Me (SEQ ID NO. 23): CAAGACCTCGTCGAGGTTTCTCTCTCTGAAAAAGTGCTTTTGCTGCGTTTCCATGCTCTCGGAAGGAACTTGGCTGAAT;

[0201] unMe (SEQ ID NO.24): AGTGAACTTCGCAGGCAAGAAAAGCCTTACATCGATTCAAATTATGCTGCTGACTATTATCATGATAGTGAAGCTGGGAGTCGTAATGGACA;

[0202] (11) qPCR primer Me mixture:

[0203] 10 μM Me F (SEQ ID NO. 25): 5'-CAAGACCTCGTCGAGGTTTCTCT-3';

[0204] 10 μM Me R (SEQ ID NO. 26): 5'-ATTCAGCCAAGTTCCTTCCGAG-3';

[0205] (12) qPCR primer unMe mixture:

[0206] 10 μM unMe F (SEQ ID NO. 27): 5'-AGTGAACTTCGCAGGCAAGAA -3';

[0207] 10 μM unMe R (SEQ ID NO. 28): 5'-TGTCCATTACGACTCCCAGCTT-3';

[0208] (13) Primer mixture for one round of PCR:

[0209] 10 μM adapter primer F (SEQ ID NO.29):

[0210] 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCGTCGGCAGCGTC -3';

[0211] 10 μM adapter primer R (SEQ ID NO.30):

[0212] 5'-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTCTCGTGGGCTCGGCTGTCCC -3';

[0213] (14) Second-round PCR primer mixture:

[0214] 10 μM Truseq P5 primers (SEQ ID NO.31):

[0215] 5'-AATGATACGGCGACCACCGAGATCTACAC AACGTGAT ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3';

[0216] 10 μM Truseq P7 primer (SEQ ID NO.32):

[0217] 5'- CAAGCAGAAGACGGCATACGAGAT CGAGTAAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3'.

[0218] 2. Method

[0219] This embodiment is based on cfDNA (circulating cell-free DNA) extracted from 8 plasma samples. A high-throughput library construction method based on sample tag encoding was performed using the kit provided in Example 1. The overall experimental procedure is as follows: Figure 1 As shown in the figure. Among them, 8 plasma samples were collected from 8 gastric cancer patients at the hospital.

[0220] For the same 8 plasma samples, this embodiment simultaneously employed a low-throughput library construction method. The difference between this low-throughput method and the high-throughput method based on sample tag encoding lies solely in that the samples are not pre-labeled with unique tags before being combined for subsequent experimental steps; instead, the 8 plasma samples are tested independently. The low-throughput group serves as a positive control for the high-throughput group (in this application).

[0221] The specific process of the high-throughput database construction method based on sample label encoding is as follows:

[0222] 1. Sample preparation

[0223] Eight plasma samples were collected, with no hemolysis. cfDNA was extracted using a Serum / Plasma Circulating DNA Kit, with 100 μL of plasma and 16 μL of elution per sample. The remaining steps were performed according to the manufacturer's instructions.

[0224] 2. Transposase reaction

[0225] The reaction system was prepared on ice, as shown in Table 3 below.

[0226] Table 3

[0227]

[0228] Table 4

[0229]

[0230] Mix the liquid thoroughly using a pipette, then place it in a PCR instrument for reaction. The reaction conditions are shown in Table 5.

[0231] Table 5

[0232]

[0233] After the transposase reaction is complete, add 2 μL of digestion buffer 1, gently tap to mix, and then place in a PCR instrument for reaction. The reaction conditions are shown in Table 6.

[0234] Table 6

[0235]

[0236] After the reaction is complete, add 5 μL of stop buffer 1, gently tap to mix, and then place in a PCR instrument for reaction. The reaction conditions are shown in Table 7.

[0237] Table 7

[0238]

[0239] This application involves directly adding digestion buffer 1 to the transposase reaction tube, primarily to stop the transposase reaction. Further addition of stop buffer 1 aims to terminate the reaction of proteinase K in digestion buffer 1. This operation within the same reaction tube effectively avoids loss of the extracted trace amounts of DNA.

[0240] 3. DNA gap repair

[0241] After the transposase reaction in step 2 is completed, the components in Table 8 are added, using the NEB Klenow fragment (3´→5´ exo-).

[0242] Table 8

[0243]

[0244] The mixture was shaken and centrifuged briefly, then placed in a PCR instrument for reaction. The reaction conditions are shown in Table 9.

[0245] Table 9

[0246]

[0247] 4. Mixing and thermal denaturation of DNA samples

[0248] For 8 plasma samples, steps 1 to 3 were performed respectively to obtain 8 chain reaction systems. After the chain reaction was completed, the 8 chain reaction systems (total 280 μL) were mixed into 1.5 mL centrifuge tubes, 3 μL of quality control DNA mixture was added, and 25 μL of ddH2O was added to bring the total volume to 308 μL.

[0249] The filler DNA amplification system for quality control DNA is shown in Table 10. The reagents purchased were KAPA HiFi high-fidelity enzyme + dNTPs, catalog number KK2501.

[0250] Table 10

[0251]

[0252] Shake well and centrifuge briefly, then place in a PCR instrument for reaction. The reaction conditions are shown in Table 11.

[0253] Table 11

[0254]

[0255] The Spike in DNA amplification system for quality control DNA is shown in Table 12. The reagents purchased were KAPA HiFi high-fidelity enzyme + dNTPs, catalog number KK2501.

[0256] Table 12

[0257]

[0258] Shake well and centrifuge briefly, then place in a PCR instrument for reaction. The reaction conditions are shown in Table 13.

[0259] Table 13

[0260]

[0261] The sequences of the quality control DNA amplification primers used in this implementation are shown in Table 14.

[0262] Table 14

[0263]

[0264] Partially methylated fragments in the quality control DNA were obtained by adding methylation to unmethylated fragments. The reaction system is shown in Table 15. The reagent purchased was Thermo Fisher Scientific CpG methyltransferase kit, catalog number EM0821.

[0265] Table 15

[0266]

[0267] Shake well and centrifuge briefly, then place in a PCR instrument for reaction. The reaction conditions are shown in Table 16.

[0268] Table 16

[0269]

[0270] The total volume of the above mixture is 308 μL. Incubate the mixture in a metal bath at 95°C for 15 min for heat denaturation, and immediately place it in an ice-water mixture for 15 min. Transfer 28 μL to a new 0.2 mL PCR tube as the IC group tube, and the remainder as the IP group tube.

[0271] 5. Antibody magnetic bead incubation

[0272] Add the antibody magnetic bead incubation system to the IP group tubes, invert to mix, and incubate at 4 ℃ for more than 17 hours. The components of the system for incubation with added antibody magnetic beads are shown in Table 17.

[0273] Table 17

[0274]

[0275] The anti-5-mc antibody in the antibody magnetic beads was purchased from Abcam (catalog number ab10805), and the conjugated magnetic beads were purchased from Thermo Invitrogen Dynabeads M-270 (catalog number 14301). The antibody-conjugated magnetic beads were prepared using the following conjugation process:

[0276] Weigh 1 mg (0.001 g) of M-270 magnetic beads, resuspend them in 1 mL of buffer A, vortex for 30 s, and incubate for 5-10 min. The components of buffer A are shown in Table 18.

[0277] Table 18

[0278]

[0279] Place the magnetic beads on a magnetic rack and let stand for 2-3 minutes. Discard the supernatant and keep the magnetic beads.

[0280] Add 1 mL of buffer A to resuspend, and vortex thoroughly for 30 seconds on a vortex mixer;

[0281] Place the beads on a magnetic rack and let them stand for 2-3 minutes. Discard the supernatant and keep the magnetic beads.

[0282] Add 20 μL of buffer A to resuspend the magnetic beads and prepare a magnetic bead suspension for later use;

[0283] Add 20 μL of magnetic bead suspension to 20 μL of antibody solution (where the antibody concentration is 1 μg / μL) and mix gently.

[0284] Immediately add 20 μL of buffer B (for activating the coupling reaction), mix well, and incubate at 4 °C for 36-48 h using a rotary incubator; the components of buffer B are shown in Table 19.

[0285] Table 19

[0286]

[0287] After incubation, remove the tube and centrifuge gently, ensuring no residue remains on the cap; place it on a magnetic rack and let it stand for 2-3 minutes, then collect the supernatant into a new centrifuge tube.

[0288] The antibody magnetic beads were rinsed four times with 1 mL of 0.1% BSA / PBS. After each wash, the antibody-magnetic bead conjugate was resuspended and adsorbed with a magnetic rack for 2-3 min. The supernatant was then discarded, and the antibody-magnetic bead conjugate was retained.

[0289] Resuspend the antibody-magnetic bead conjugate in 60 μL of buffer C and store at 4 °C for later use; the components of buffer C are shown in Table 20.

[0290] Table 20

[0291]

[0292] 6. Wash away non-specific binding fragments on the magnetic beads.

[0293] After incubation, the system was briefly centrifuged and placed on ice on a magnetic rack for 5 min. The supernatant was removed. 160 μL of the first sample wash buffer was added, the cap was closed, and the mixture was shaken to mix. The system was then briefly centrifuged and placed on ice on a magnetic rack for 5 min. The supernatant was removed. This process was repeated twice. 200 μL of the second sample wash buffer was added for one wash. After completion, the centrifuge tubes were placed at room temperature.

[0294] 7. Fracturing and Neutralization

[0295] Remove the IC tube and add 12 μL of digestion buffer 2 (mainly for digesting antibodies and releasing target nucleic acids) together with the IP tube, and gently tap to mix.

[0296] Place the centrifuge tubes into the PCR instrument and react according to the procedure in Table 21. Pause the PCR instrument every 5 minutes, remove the centrifuge tubes, and gently tap to mix.

[0297] Table 21

[0298]

[0299] Add 5 μL of stop buffer 2 to the centrifuge tube and gently tap to mix. Place the centrifuge tube into the PCR instrument and react according to the program in Table 22. Pause the PCR instrument every 5 minutes, remove the centrifuge tube, and gently tap to mix.

[0300] Table 22

[0301]

[0302] 8. qPCR quality control

[0303] Add 33 μL of ddH2O to the IP tube, vortex to mix, and centrifuge briefly. Add 5 μL of ddH2O to the IC tube, vortex to mix, and centrifuge briefly. Construct the qPCR reaction system in an 8-tube array according to the system in Table 23. Reagents purchased: KAPA SYBR Fast qrCRkit, catalog number KK4601.

[0304] Table 23

[0305]

[0306] Place the centrifuge tubes into a qPCR instrument and react according to the procedure in Table 24.

[0307] Table 24

[0308]

[0309] 9. Library amplification and purification

[0310] (1) One round of PCR amplification

[0311] Add the components from Table 25 to the IP group tube.

[0312] Table 25

[0313]

[0314] Place the centrifuge tubes into the PCR instrument and react according to the procedure in Table 26.

[0315] Table 26

[0316]

[0317] (2) First round of library purification

[0318] After equilibrating the magnetic beads at room temperature for 30 min, vortex the AMPure XP magnetic beads to mix them. Add 60 μL of AMPure XP magnetic beads to the product, vortex to mix, and then briefly centrifuge. Incubate at room temperature for 5 min. Place the product on a magnetic rack to separate the magnetic beads and liquid. After the solution becomes clear, carefully remove the supernatant. Then add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads. Move the centrifuge tube in different directions on the magnetic rack to clean the magnetic beads. Carefully remove the supernatant. Repeat the washing steps for a total of two rinses. Keep the PCR tube in the magnetic rack at all times. Open the cap and air dry the magnetic beads until there is no obvious reflection on the surface. Remove the PCR tube from the magnetic rack, add 34 μL of ddH2O, vortex to mix, and place at room temperature for 5 min. Briefly centrifuge the PCR tube and place it on the magnetic rack to stand. After the solution becomes clear, carefully transfer 33 μL of the solution to a new EP tube, being careful not to touch the magnetic beads.

[0319] (3) Second round of PCR amplification

[0320] Add the components listed in Table 27 to the purified product tube from the previous round.

[0321] Table 27

[0322]

[0323] Place the centrifuge tubes into the PCR instrument and react according to the procedure in Table 28.

[0324] Table 28

[0325]

[0326] (4) Second-round library purification

[0327] After equilibrating the magnetic beads at room temperature for 30 min, vortex the AMPure XP magnetic beads to mix. Add 40 μL of AMPure XP magnetic beads to the product, vortex to mix, and briefly centrifuge. Incubate at room temperature for 5 min. Place the product on a magnetic rack to separate the magnetic beads and liquid. Once the solution is clear, carefully remove the supernatant. Then add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads. Move the centrifuge tube in different directions on the magnetic rack to wash the magnetic beads. Carefully remove the supernatant. Repeat the washing steps twice in total. Keep the PCR tube on the magnetic rack at all times. Open the cap and air-dry the magnetic beads until there is no obvious reflection on the surface. Remove the PCR tube from the magnetic rack, add 22 μL of ddH2O, vortex to mix, and incubate at room temperature for 5 min. Briefly centrifuge the PCR tube and place it on the magnetic rack to stand until the solution is clear. Carefully transfer 20 μL of the solution to a new EP tube to obtain the library to be sequenced. See [link to detailed procedure] for more information. Figure 1 .

[0328] (5) qPCR quality control

[0329] For each primer pair in the IP and IC groups, ensure the threshold is set at the exponential phase of the amplification curve, and determine the intersection point of the PCR curve and the threshold to obtain the cycle threshold (Ct) value for IP and IC samples. Use these Ct values ​​to calculate the recovery rate and reaction specificity of Spike-in DNA according to the following steps:

[0330] 1) Calculate the recovery rate of methylated and unmethylated Spike-in DNA: Since only 10% of the samples are included as internal controls (IC), the Ct values ​​obtained need to be corrected before calculation. The correction formula and calculation formula are as follows:

[0331] Adjusted IC Ct = IC Ct - log[2 (10)]

[0332] Recovery rate (Percentage of recovery) = 2 (Adjusted IC Ct - IP Ct) × 100

[0333] 2) Calculate reaction specificity: The reaction specificity is calculated using the recovery rate described above, using the following formula:

[0334] Specificity = 1 - [% unmethylated DNA recovery / % methylated DNA recovery]

[0335] Evaluation criteria: Based on previous research, the general standards for quality control are that the recovery rate of unmethylated Spike-in DNA should be less than 1%, the recovery rate of methylated Spike-in DNA should be greater than 20%, and the reaction specificity should be no less than 99%.

[0336] (6) Sequencing data processing: First, the GNU Parallel tool was used to process high-throughput sequencing data in parallel. Based on the barcode (unique label for each sample), paired-end sequencing data belonging to eight independent samples were separated from the mixed data. The adapter removal software Cutadapt was used to remove sequencing adapters from the sequencing data. The mapping software Bowtie2 was used for reference genome localization. Samtools and Picard were used for sequencing read quality screening and removal of duplicate reads. cfDNA methylation modification site signal information can be visualized using IGV.

[0337] The results are as follows Figure 2As shown, the multi-sample pooling (high-throughput) method provided in the above embodiments can efficiently capture plasma circulating cell-free DNA (cfDNA) methylation modifications, and its distribution pattern on the genome is highly consistent with that obtained by single-sample independent processing (low-throughput) detection.

[0338] like Figure 3 , Figure 4 As shown, the methylation enrichment is depicted based on the normalized signal of the sample in the peak region. The results show that the clustering features of the methylation signal intensity obtained by the multi-sample mixed processing (high-throughput) method and the single-sample independent processing (low-throughput) method are highly similar, showing a highly consistent signal intensity distribution pattern.

[0339] like Figure 5 Correlation analysis of the methylation signal values ​​obtained by the two methods showed that the Pearson correlation was generally greater than 0.8, indicating the reliability of the high-throughput DNA modification detection method provided in this application.

[0340] like Figure 6a As shown, the recovery rates of unmethylated Spike-in DNA were both less than 0.3% for both multi-sample parallel processing and single-sample independent processing methods, while the recovery rates of methylated Spike-in DNA were both greater than 60%.

[0341] like Figure 6b As shown, the specificity of methylated fragment capture was greater than 99.5%.

[0342] The above results demonstrate that the multi-sample parallel processing (high-throughput) strategy provided in this embodiment can efficiently capture plasma circulating cell-free DNA (cfDNA) methylation modifications, with no significant difference in data quality compared to the method obtained through single-sample independent processing (low-throughput). Even with only 100 μL of plasma as an initial sample, the plasma cell-free DNA modification library obtained by the method in this application has significantly higher quality than industry standards.

[0343] Overall, compared with the traditional approach, the embodiments of this application have the following beneficial effects:

[0344] This embodiment of the method is the first to utilize Tn5 transposase to introduce sample tags into cell-free DNA derived from plasma as low as 10-5000 μL, merging multiple test samples for specific capture and library construction. This method utilizes Tn5 transposases carrying different combinations of tags to pre-tag different samples with sample-specific tags, combined with a highly optimized detection strategy, to efficiently and conveniently achieve high-throughput, high-sensitivity detection of large-scale samples. Compared to other methods that use mechanical action or restriction endonucleases to break down nucleic acids, treat samples with bisulfite, and ligate tags using PCR, our proposed method can achieve low-starting-volume, unbiased, high-throughput detection of DNA-modified fragments. The advantage of this invention also lies in its integration with an automated platform, achieving full-process automation and enabling the construction of high-quality libraries for thousands of samples within one day after antibody incubation. Specifically, the core advantages of the kit and method described in this invention are as follows:

[0345] (1) High sensitivity and specificity

[0346] By employing a dual strategy of "mild transposase fragmentation" and "sample indexing and merging detection," we pre-enriched target DNA modification signals using immobilized affinity vectors before library construction, significantly reducing background interference and batch effects. Using this method, we achieved a capture rate of over 50% for DNA methylated fragments on free chromatin, below 0.5% for unmethylated fragments, and a capture specificity of over 99%, significantly outperforming existing technologies (currently, other technologies typically achieve a capture rate of 20% or higher for DNA methylated fragments, below 1% for unmethylated fragments, and a capture specificity of over 95%).

[0347] (2) The sample size requirement is extremely low.

[0348] The optimized ultra-high activity transposase reaction system, combined with efficient specific affinity capture, can reduce the minimum starting amount of a single sample to less than 1 ng of DNA. It can perform high-quality library construction for cfDNA from plasma sources as low as 10-5000 μL, greatly reducing the requirement for sample volume and solving the bottleneck of insufficient sample volume in large-scale clinical testing (current technologies generally require 1-10 mL of plasma for the detection of DNA modifications on plasma free chromatin).

[0349] (3) High throughput and automation

[0350] The operable transposase pre-labels multiple test samples with unique samples before merging them into a library, significantly increasing experimental throughput, saving experimental time and reagent consumption, and minimizing testing costs. The optimized workflow enables full automation, further enhancing the adaptability of this technology to real-world clinical testing scenarios.

[0351] The technical features of the above-described embodiments and examples can be combined in any suitable manner. For the sake of brevity, not all possible combinations of the technical features in the above-described embodiments and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0352] The embodiments described above are merely illustrative of several implementation methods of this application, intended to facilitate a detailed understanding of the technical solutions of this application, but should not be construed as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the scope of protection of this application. Furthermore, it should be understood that after reading the above teachings of this application, those skilled in the art can make various alterations or modifications to this application, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided in this application through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this patent application should be determined by the content of the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. A method for constructing a high-throughput sequencing library with trace DNA modification, characterized in that, The construction method includes the following steps: DNA samples are extracted from the sample to be tested, a transposase complex and a binding molecule-solid phase conjugate are provided; wherein the transposase complex includes a transposase and a sequencing adapter and the nucleic acid sequence of the sequencing adapter contains a nucleic acid sequence of a sample tag, and the binding molecule on the binding molecule-solid phase conjugate specifically binds to the target modification on the DNA sample; The transposase complex and the DNA sample were mixed to carry out a transposition reaction, and the reaction was terminated to prepare the transposition product. The transposon product was nicked and filled to prepare a DNA fragment; Multiple DNA fragments prepared from multiple test samples are mixed with quality control DNA to prepare a multi-sample DNA fragment mixture; wherein the nucleic acid sequences of the sample tags of the multiple DNA fragments are different; The mixture of multiple DNA fragments was denatured to prepare a single-stranded mixture; The target chain-binding molecule-solid phase coupling is prepared by mixing the bound molecule-solid phase coupling compound and the single chain mixture in a binding reaction; and, The target strand is collected from the target strand-binding molecule-solid phase conjugate, and PCR amplification is performed using the target strand as a template to construct a high-throughput sequencing library.

2. The method for constructing a high-throughput sequencing library with trace DNA modification according to claim 1, characterized in that, The construction method satisfies one or more of the following conditions (A) to (B): (A) Methods for terminating the reaction include: Add digestion buffer 1 to the transposition reaction system to initiate the first digestion reaction; and, Then, stop buffer 1 is added to the obtained first digestion product to carry out the first termination reaction; Wherein, the digestion buffer 1 includes SDS, and the termination buffer 1 includes PMSF; (B) The transposase is selected from Tn5 transposase, MuA transposase, IS5 transposase, IS91 transposase, Vibrio harlequinae transposase, Tn10 transposase, Tn3 transposase, VST1 transposase, Tn7 transposase, Rag1 / Rag2 transposase and their active mutants.

3. The method for constructing a high-throughput sequencing library with trace DNA modification according to claim 2, characterized in that, The method for terminating the reaction satisfies one or more of the conditions shown in (A1) to (A4): (A1) The digestion buffer 1 comprises pH 6-9, 1-1000 mM Tris-HCl buffer, 1-1000 mM EDTA-NaOH, 0.01-10% SDS (w / v), and 0.01-10 mg / mL proteinase K; (A2) The conditions for the first digestion reaction include: temperature of 20-75℃ and time of 1-120 min; (A3) The termination buffer 1 comprises 1-100 mM MgCl2, 1-100 mM PMSF and 0.01%-1% (v / v) TX-100; (A4) The conditions for the first termination reaction include: a temperature of 20-75°C and a time of 1-120 min; or / and, The transposable reaction satisfies one or more of the conditions shown in (B1) to (B2) below: (B1) The reaction system for the transposition reaction includes: 13-16 μL of the DNA sample, 4 μL of 5× transposition activation solution, and 0.03-5 μL of transposase complex solution; wherein, the concentration of DNA in the DNA sample is 0.01-100 ng / μL, the 5× transposition activation solution includes 1-100 mM TAPS-NaOH and 1-100 mM MgCl2, and the transposase complex solution contains 1-96 Tn5-T5 transposases and 1-16 Tn5-T7 transposases, with the concentration of each transposase complex being 1-1000 μM; (B2) The reaction conditions for the transposition reaction include: temperature of 20-60℃ and time of 1-120 min.

4. The method for constructing a high-throughput sequencing library with trace DNA modification according to claim 1, characterized in that, The method for collecting the target chain on the target chain-binding molecule-solid phase coupling includes: The target chain-binding molecule-solid phase conjugate was washed, and digestion buffer 2 was added for a second digestion reaction; and, Add termination buffer 2 to the obtained second digestion product to carry out the second termination reaction, and collect the reaction solution; The digestion buffer 2 includes proteinase K, and the termination buffer 2 includes PMSF.

5. The method for constructing a high-throughput sequencing library with trace DNA modification according to claim 4, characterized in that, The method for collecting the target chain on the target chain-binding molecule-solid phase coupling satisfies one or more of the following conditions (C1) to (C5): (C1) The digestion buffer 2 comprises pH 7.0-9.0, 1-100 mM Tris-HCl buffer, 1-100 mM EDTA-NaOH and 0.01-1 mg / mL proteinase K; (C2) The conditions for the second digestion reaction include: temperature of 20-75℃ and time of 1-120 min; (C3) The termination buffer 2 comprises 1-10 mM PMSF and 1-100 mM MgCl2; (C4) The conditions for terminating the second reaction include: a temperature of 20-75℃ and a time of 1-120 min; (C5) Washing is performed using the first sample washing buffer and / or the second sample washing buffer; The first sample washing buffer comprises 1-100 mM Na3PO4, 10-500 mM NaCl and 0.01%-1% TX-100, pH 6.0-9.0; The second sample washing buffer consists of 1-100 mM Tris-HCl, pH 7.0-9.

0.

6. The method for constructing a high-throughput sequencing library with trace DNA modification according to claim 1, characterized in that, The reaction satisfies one or more of the following conditions (D1) to (D2): (D1) The conditions for the combination reaction include: temperature of 4-37 ℃ and time of 1-24 h; (D2) The system for the binding reaction includes: 50 μL of 10×IP buffer, 1-500 μL of binding molecule-solid phase conjugate suspension, and 1-500 μL of single-stranded mixture. The concentration of the binding molecule-solid phase conjugate in the binding molecule-solid phase conjugate suspension is 0.01-100 μg / μL, and the concentration of the DNA strand in the single-stranded mixture is 0.01-100 ng / μL.

7. The method for constructing a high-throughput sequencing library with trace DNA modification according to any one of claims 1 to 6, characterized in that, The construction method satisfies one or more of the following conditions (E1) to (E11): (E1) The method for extracting the DNA sample includes any one or more of the following methods: organic phenol-chloroform method, solid phase extraction method, Chelex-100 boiling water method, salting out method, centrifugal column method, magnetic microparticle method, silica membrane method, fully automated nucleic acid extractor method, microfluidic chip method and direct amplification method. (E2) The target modification includes one or more of the following modifications: DNA modification including but not limited to methylation, hydroxymethylation, formylation, carboxylation, phosphorylation-sulfurization, acetylation, hydroxyacetylation, carboxyethylation, phosphorylation, glycosylation, nitrosylation, alkylation, carboxymethylation, chloroethylation, epoxyethylation, dimethylation, polymethylation, hypomethylation, demethylation, oxidative demethylation, deamination modification, crosslinking modification, hydroxylamine modification, azide modification, biotin labeling, alkynyl labeling, fluorination modification, bromination modification, iodination modification, and nitration modification. Thiol group modification, methoxy group modification, ethoxy group modification, phosphoryl thioate modification, amination modification, arylation modification, allylation modification, acetylation modification, hydroxylation, oxidative damage modification, photochemical modification, cross-linking modification, terminal group modification, artificial nucleotide substitution modification, photorepair derivatization modification, trans-hydroxyl group modification, depyrimidinization modification, adenosine deamination modification, purine deamination modification, polysaccharide bonding modification, isomerization modification, deoxyribose backbone modification, hydroxyalkylation, lipidation, aromatic cyclization modification, chelation modification, nanotag modification, and single-molecule fluorescent probe modification; (E3) The solid phase in the combined molecule-solid phase coupling includes magnetic beads; (E4) The quality control DNA includes one or more of the following: exogenous chromosome, artificially synthesized nucleic acid molecule, quantitatively spiked nucleic acid, artificial adapter, synthetic oligonucleotide mixture, host cell exogenous insert fragment and copy number normalized reference template, or / and, the quality control DNA includes at least one quality control DNA with methylation modification and at least one quality control DNA without methylation modification; (E5) Gap completion was performed using Klenow enzyme; (E6) Denaturation treatment shall be performed using one or more of the following methods: heat denaturation, alkali denaturation, denaturant treatment and helicase method; (E7) The amplified product is purified by one or more of the following methods: phenol / chloroform extraction, column purification, gel electrophoresis recovery, magnetic bead purification, enzymatic purification, ethanol precipitation, ultrafiltration and reverse phase chromatography; (E8) PCR amplification is performed using one or more of DNA polymerase and reverse transcriptase; the DNA polymerase includes one or more of Taq DNA polymerase, KAPA high-fidelity polymerase, Q5 DNA polymerase, KOD DNA polymerase, pfu DNA polymerase and Tth DNA polymerase; (E9) PCR amplification methods include one or more of the following: quantitative real-time PCR, digital PCR, and droplet digital PCR; (E10) Purification methods for high-throughput sequencing libraries include one or more of the following: SPRI magnetic bead purification based on fragment size selection, agarose gel electrophoresis gel extraction, polyacrylamide gel electrophoresis gel extraction, and size-selective centrifugation column based on membrane filtration. (E11) The sample to be tested includes any one or more of the following: tissues, organs and cells in a normal physiological state, tissues, organs and cells in a pathological state, body fluids, and secretions.

8. The method for constructing a high-throughput sequencing library with trace DNA modification according to claim 7, characterized in that, The combined molecule-solid phase coupling satisfies one or more of the following conditions (E3-1) to (E3-4): (E3-1) The magnetic beads include nano-magnetic beads and / or micro-magnetic spheres; (E3-2) The magnetic beads include one or more of the following magnetic beads: carboxyl magnetic beads, amino magnetic beads, oleylamine modified magnetic beads, silanol magnetic beads, sulfonic acid magnetic microspheres, thiol magnetic microspheres, PEG modified magnetic beads, unmodified iron oxide magnetic beads, monodisperse silica-coated magnetic beads, epoxy-coated magnetic beads, monodisperse mesoporous silica-coated magnetic beads, gold-coated magnetic nanoparticles, streptavidin-modified magnetic beads, polylysine-modified magnetic beads, nickel magnetic beads, magnetic polystyrene microspheres, and silica magnetic microspheres; (E3-3) The binding molecule in the binding molecule-solid phase conjugate is an antibody or an antigen-binding fragment; (E3-4) The bound molecule and solid phase in the bound molecule-solid phase coupling are coupled by one or more of the following methods: direct coupling, indirect coupling, and biotin-avidin coupling; or by one or more of the following methods: carbodiimide-mediated condensation reaction, Schiff base reaction, and click chemistry reaction; or / and, The sample to be tested satisfies one or more of the following conditions (E11-1) to (E11-3): (E11-1) The sample to be tested includes plasma; (E11-2) The volume of the sample to be tested is 10-5000 μL; (E11-3) The DNA sample mentioned includes cfDNA.

9. The high-throughput sequencing library constructed by the method of constructing a high-throughput sequencing library with trace DNA modification according to any one of claims 1 to 8.

10. A method for detecting trace amounts of DNA modification in a sample to be tested, characterized in that, The detection method includes the following steps: A high-throughput sequencing library is constructed using the construction method described in any one of claims 1 to 8; and sequencing is performed.

Images