SGOL1 gene molecular marker related to disease resistance character of Tibetan sheep and application of SGOL1 gene molecular marker

Abstract

The invention provides an SGOL1 gene molecular marker related to disease resistance characters of Tibetan sheep and application of the SGOL1 gene molecular marker, and belongs to the technical field of molecular biology detection. The SGOL1 gene molecular marker is located at the 275269347th basic group on a first chromosome of an international sheep reference genome Oarv4.0 version; the variation type is T / C, and when the basic group of the site is T, the genotype is TT or TC; and when the basic group of the site is C, the genotype is CC. By detecting the genotype of the SNP site, the content of IL-1alpha, IL-1beta, TNF-alpha, TNF-beta, IL-1Ra and IL-10 of a Tibetan sheep individual can be judged, and a new SNP molecular marker resource is provided for non-diagnostic Tibetan sheep immune trait marker-assisted selection.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection technology, and in particular relates to a molecular marker of the SGOL1 gene associated with disease resistance traits in Tibetan sheep and its application. Background Technology

[0002] Tibetan sheep, as a unique livestock genetic resource of the Qinghai-Tibet Plateau, have, through long-term natural selection, not only exhibited remarkable adaptability to the high-altitude, oxygen-deficient environment but also demonstrated strong resistance to specific pathogens of the plateau. Understanding their disease resistance genetic mechanisms is crucial for breeding new breeds with high disease resistance, reducing the use of veterinary drugs, and developing sustainable animal husbandry.

[0003] An animal's disease resistance is largely determined by the regulatory capacity of its immune system. Cytokines, as messenger molecules that transmit information between immune cells, play a central role in initiating, regulating, and terminating inflammatory and immune responses. In particular, pro-inflammatory cytokines such as interleukin-1α (IL-1α), interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α) are key mediators in the body's initial response to pathogen invasion. Meanwhile, tumor necrosis factor-β (TNF-β), interleukin-1 receptor antagonists (IL-1Ra), and interleukin-10 (IL-10) are important immunomodulatory and anti-inflammatory factors, crucial for preventing excessive inflammatory responses and maintaining immune homeostasis. The levels of these key cytokines in vivo directly reflect the strength and balance of the body's immune response and are key intrinsic phenotypic indicators for assessing an individual's disease resistance potential.

[0004] Single nucleotide polymorphisms (SNPs) are ideal molecular markers for studying the genetic basis of complex traits. Current techniques have been used to search for SNPs associated with disease resistance phenotypes in Tibetan sheep, but these studies have largely focused on pattern recognition receptors and antigen-presenting genes, lacking a systematic approach for screening and applying SNP markers targeting the precise and quantifiable intermediate phenotype of cytokine levels. Summary of the Invention

[0005] In view of this, the purpose of this invention is to provide a molecular marker of the SGOL1 gene associated with disease resistance traits in Tibetan sheep and its application.

[0006] This invention provides a molecular marker for the SGOL1 gene associated with disease resistance in Tibetan sheep. The SGOL1 gene marker is located at nucleotide 275,269,347 on chromosome 1 of the International Sheep Reference Genome Oar_v4.0. Tibetan sheep individuals with the T / C variant and genotype CC have significantly lower levels of IL-1α and IL-1Ra than those with genotypes TT or TC. Tibetan sheep individuals with genotype CC have significantly lower levels of L-1β, TNF-α, and TNF-β than those with genotype TT. Tibetan sheep individuals with genotype CC have significantly higher levels of IL-10 than those with genotype TT.

[0007] This invention provides the application of the reagent for detecting the SGOL1 gene molecular marker in the preparation of a kit for detecting disease resistance traits in Tibetan sheep.

[0008] Preferably, the reagent comprises a primer pair for amplifying the SGOL1 gene molecular marker in the application, the nucleotide sequences of which are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0009] This invention provides a kit for detecting disease resistance traits in Tibetan sheep, comprising primer pairs for amplifying the SGOL1 gene molecular marker used in the application, the nucleotide sequences of which are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0010] Preferably, it also includes PCR reaction reagents.

[0011] This invention provides the application of the kit in the marker-assisted selection of disease resistance traits in Tibetan sheep for non-diagnostic purposes.

[0012] This invention provides the application of the kit in the assisted breeding of disease resistance traits in Tibetan sheep.

[0013] Compared with the prior art, the present invention has the following beneficial effects: The SGOL1 gene molecular marker provided by this invention, associated with disease resistance in Tibetan sheep, is located at nucleotide 275,269,347 on chromosome 1 of the International Sheep Reference Genome Oar_v4.0. The variant type is T / C, named g275269347T>C, and three genotypes exist. When nucleotide 275269347 on chromosome 1 is T, the genotype is TT or TC; when nucleotide 275269347 on chromosome 1 is C, the genotype is CC. Different gene markers can be used to identify the genotype. Association analysis between genotype and the levels of IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra, and IL-10 revealed that Tibetan sheep individuals with the CC genotype had significantly lower levels of IL-1α and IL-1Ra than those with the TT and TC genotypes (p<0.05), Tibetan sheep individuals with the CC genotype had significantly lower levels of IL-1β, TNF-α, and TNF-β than those with the TT genotype (p<0.05), and Tibetan sheep individuals with the TT genotype had significantly lower levels of IL-10 than those with the CC genotype (p<0.05). The SNP sites described herein are SNP markers related to IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra, and IL-10 in Tibetan sheep. By detecting the bases at the 275,269,347th nucleotide site on chromosome 1 of Tibetan sheep, the levels of IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra, and IL-10 in an individual Tibetan sheep can be determined. This invention provides a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes. Attached Figure Description

[0014] Figure 1 The agarose gel electrophoresis results of the amplified products of the g275269347T>C SNP site on chromosome 1 of Tibetan sheep are shown in the figure. M is the marker and 1-3 are the amplified products. Figure 2 The peak diagram and sequence are obtained after purification and sequencing of the amplified product. Detailed Implementation

[0015] This invention provides a molecular marker for the SGOL1 gene associated with disease resistance in Tibetan sheep. The SGOL1 gene marker is located at nucleotide 275,269,347 on chromosome 1 of the International Sheep Reference Genome Oar_v4.0. The marker is located on the SGOL1 gene with a T / C variant. Tibetan sheep individuals with genotype CC have significantly lower levels of IL-1α and IL-1Ra than those with genotypes TT or TC. Tibetan sheep individuals with genotype CC have significantly lower levels of L-1β, TNF-α, and TNF-β than those with genotype TT. Tibetan sheep individuals with genotype CC have significantly higher levels of IL-10 than those with genotype TT.

[0016] This invention provides the application of the reagent for detecting the SGOL1 gene molecular marker in the preparation of a kit for detecting disease resistance traits in Tibetan sheep.

[0017] In this invention, the reagent comprises a primer pair for amplifying the SGOL1 gene molecular marker in the application, and the nucleotide sequences of the primer pair are shown in SEQ ID No. 2 and SEQ ID No. 3, as follows: F: 5'-GAGGATGTAGCCTATCCCTT-3' (SEQ ID No. 2); R: 5'-TTACATTCCCACAGTGCAAG-3' (SEQ ID No. 3).

[0018] This invention provides a kit for detecting disease resistance traits in Tibetan sheep, comprising primer pairs for amplifying the SGOL1 gene molecular marker used in the application, the nucleotide sequences of which are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0019] In this invention, the kit also includes PCR reaction reagents. This invention does not have a specific limitation on the type of PCR reaction reagents, and any commercially available PCR reaction reagents in the art can be used. In the specific implementation of this invention, the PCR reaction reagents preferably use Gold Mix (green).

[0020] The present invention also provides the application of the kit in the marker-assisted selection of disease resistance traits in Tibetan sheep for non-diagnostic purposes.

[0021] This invention also provides the application of the kit in the assisted breeding of disease resistance traits in Tibetan sheep.

[0022] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0023] Example 1

[0024] 1. Sample collection

[0025] The samples were collected from Tibetan sheep populations under natural grazing conditions, including 77 samples from Gannan Tibetan Autonomous Prefecture in Gansu Province, 45 samples from Yushu Tibetan Autonomous Prefecture in Qinghai Province, and 45 samples from Shigatse City in Tibet Autonomous Region. 5 mL of blood samples were collected from 167 fasting Tibetan sheep in clean, anticoagulant vacuum blood collection tubes. The tubes were allowed to stand for 30 min, then centrifuged at 3500 rpm for 15 min. The supernatant was collected into clean PE tubes, sealed, and stored at -20°C as serum samples for the detection of pro-inflammatory and anti-inflammatory factors. Separately, 5 mL of blood samples were collected in blood collection tubes containing EDTA-K2 anticoagulant. After collection, the samples were quickly mixed, placed in a sampling box with ice packs for temporary storage, and then transported back to the laboratory and frozen at -20°C for DNA extraction.

[0026] 2. Main reagents and instruments

[0027] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomics extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL1000 markers, agarose, and nucleic acid dyes were purchased from Beijing Solarbio Science & Technology Co., Ltd.; the gold-labeled mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and the PCR instrument was purchased from BioRad. The IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra, and IL-10 detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0028] 3 Methods

[0029] 3.1 Detection of IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra and IL-10

[0030] The assay was performed using the enzyme-linked immunosorbent assay (ELISA) method according to the test kit from Nanjing Jiancheng Biotechnology Research Institute. The assay steps were as follows: (1) Serial dilution of the standard according to the instructions; (2) Add 100 μL of antibody to each well, coat for 2 hours, discard the liquid and spin dry; (3) Add 300 μL of diluted washing buffer to each well, shake for 30 seconds, discard the washing buffer and pat dry with absorbent paper, repeat 5 times; (4) Add 200 μL of blocking buffer to each well, gently shake to mix, let stand at room temperature for 30 minutes, discard the liquid and spin dry; (5) Add 300 μL of diluted washing buffer to each well, shake for 30 seconds, discard the washing buffer and pat dry with absorbent paper, repeat 5 times; (6) Add 25 μL of coating buffer, 25 μL of serum sample and 50 μL of standard to each well, gently shake to mix; (7) Add 100 μL of antibody to each well. (8) Gently shake HRP to mix, let stand at room temperature for 60 min, then discard the liquid and spin dry; (9) Add 300 μL of diluted washing solution to each well, shake for 30 s, then discard the washing solution and pat dry with absorbent paper, repeat 5 times; (10) Add 100 μL of color developing solution to each well, gently shake to mix, and develop color for 15 min; (11) Add 100 μL of stop solution to each well to stop the reaction (at this time, the blue color immediately turns yellow); (12) Zero the blank well and measure the OD value of each well at a wavelength of 450 nm; (13) Make a standard curve using the OD value of the standard and obtain the curve formula, then substitute the OD measured by the sample test tube into the calculation formula to obtain the result.

[0031] 3.2 Extraction of genomic DNA from blood

[0032] Genomic DNA was extracted from blood samples using the blood genome extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The concentration and purity of the extracted DNA were detected by ultraviolet spectrophotometer. A concentration >20 ng / μL and an OD260 / OD280 between 1.7 and 1.9 were sufficient for the experiment. The DNA was stored at -20℃ for later use.

[0033] 3.3 Primer Design

[0034] Based on the gene sequence of chromosome 1 in the Oar_v4.0 version of the international sheep genome (GenBank accession number: NC_019458.2), a pair of specific primers containing the g275269347T>C SNP site was designed using Primer Premier 5.0 software.

[0035] Primer sequences: F: 5'-GAGGATGTAGCCTATCCCTT-3' (SEQ ID No. 2); R: 5'-TTACATTCCCACAGTGCAAG-3' (SEQ ID No. 3).

[0036] The amplified fragment was 452 bp in length, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0037] 3.4 PCR amplification and sequencing

[0038] PCR amplification system 25μL: Gold Mix (green) 22μL, upstream and downstream primers 1μL each, template 1μL.

[0039] PCR amplification program: 98℃ for 2 min; 98℃ for 10 s, 58℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.

[0040] The PCR products were detected by 1.5% agarose gel electrophoresis. After passing the agarose gel electrophoresis test, the PCR products were sequenced using direct sequencing, which was completed by Beijing Qingke Biotechnology Co., Ltd.

[0041] The sequencing results of PCR products were compared using the bioanalysis software MEGA 6.0, and the sequencing peak diagrams were analyzed to complete the typing.

[0042] 4. Statistical Analysis

[0043] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. The frequency of the g275269347T>C gene, genotype frequency, effective allele count (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test were calculated using Popgen32 software. The polymorphism information content (PIC) was calculated using PIC software. The association between different genotypes in Tibetan sheep and IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. Results are expressed as mean ± standard error.

[0044] 5 Results

[0045] 5.1 PCR amplification and sequencing results

[0046] The amplification products of the g275269347T>C SNP site on chromosome 1 of Tibetan sheep were detected using 1.5% agarose gel electrophoresis (see [link to article]). Figure 1 The bands were clear and free of impurities, indicating good specificity. The PCR product fragment size was 452 bp, which is in line with the expected size, and the next step of the experiment can be carried out.

[0047] The peak chromatogram and sequence obtained after purification and sequencing of the PCR product are shown below. Figure 2The amplified nucleotide sequence is shown in SEQ ID No. 1, and the SNP marker is located at position 290 of the nucleotide sequence shown in SEQ ID No. 1, as follows: GAGGATGTAGCCTATCCCTTCTCCAGGCGATCTTTCTGACCCAGGAATCAAACCAGGGTCACCTGCATTGCAGGAGGATTCTTTACCAGCTGAGCTACCAGGGAAGCCCTCTGAAGGGCATAGCAATGGACACGATAAACAAGA TTAAAAGACAACCCTCAGAATGAGAAAAAAATAATTGCAAACAAAACTGACAAAGGATTAATCTGCAAATATACAAGCAGCTCACACAGTCCAATACCAGAAAAACAGAAGACCTAAACAGACTTTCCTCTAAAGACGACATAAA T AGATGGCCAGCAAATGCATGAGAAGATTCTCGACATGCTCATGATCAGAGTGCGGTATCACCGCACACCAGGCAGCAAGGCCATCATTAAAAAAATCTACAACCAATACATTCTGCAGAGATGTGGAGAAAAGGGAGCCCTCTTGCACTGTTGGGAATGTAA Depend on Figure 2 It can be seen that the g275269347T>C SNP site has a TC mutation, and there are three genotypes: TT, TC, and CC.

[0048] 5.2 Statistical Analysis Results

[0049] Genotype and allele frequencies of the g275269347T>C SNP locus on chromosome 1 of Tibetan sheep were analyzed from a population genetics perspective. Table 1 shows that at the g275269347T>C SNP locus, the CC genotype had the highest frequency and was the dominant genotype, while the C allele frequency was 89.2%, also indicating a dominant allele. The χ² fitness test showed that the SNP locus significantly deviated from Hardy-Weinberg equilibrium (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.192, and the PIC was 0.174, indicating low polymorphism.

[0050] Table 1. Polymorphism of SNP site g275269347T>C on chromosome 1 of Tibetan sheep

[0051] 5.3 Association analysis between different genotypes and IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra, and IL-10

[0052] The association between different genotypes of Tibetan sheep and the levels of IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. The results showed that Tibetan sheep with the CC genotype had significantly lower levels of IL-1α and IL-1Ra than those with the TT and TC genotypes (p<0.05). Tibetan sheep with the CC genotype had significantly lower levels of IL-1β, TNF-α, and TNF-β than those with the TT genotype (p<0.05). Tibetan sheep with the TT genotype had significantly lower levels of IL-10 than those with the CC genotype (p<0.05). This indicates that the g275269347T>C SNP site on chromosome 1 of Tibetan sheep is a SNP marker associated with IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra, and IL-10. The results are shown in Table 2.

[0053] Table 2. Correlation analysis between different genotypes and the relative levels (concentrations) of IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra, and IL-10.

[0054] Note: Different lowercase letters in the intercalation of data in the same row indicate significant differences (P < 0.05).

[0055] As can be seen from the above embodiments, the genotype of the SNP molecular markers related to the disease resistance traits of Tibetan sheep provided by the present invention is significantly correlated with the levels of IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra, and IL-10. By detecting the bases at this SNP site, the levels of IL-1α, IL-1β, TNF-α, TNF-β, IL-1Ra, and IL-10 in individual Tibetan sheep can be determined, providing a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes.

[0056] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A SGOL1 gene molecular marker related to Tibetan sheep disease resistance traits, characterized in that, The SGOL1 gene molecular marker is located at base 275269347 on chromosome 1 of the international sheep reference genome Oar_v4.0 version; the variation type is T / C, the IL-1α and IL-1Ra of the Tibetan sheep individual with genotype CC are significantly lower than those of the individual with genotype TT or TC, the L-1β, TNF-α and TNF-β of the Tibetan sheep individual with genotype CC are significantly lower than those of the individual with genotype TT; the IL-10 of the Tibetan sheep individual with genotype CC is significantly higher than that of the individual with genotype TT.

2. Application of the reagent for detecting the SGOL1 gene molecular marker in claim 1 in the preparation of a kit for detecting the disease resistance trait of Tibetan sheep.

3. Use according to claim 2, characterized in that, The reagent comprises a primer pair for amplifying the SGOL1 gene molecular marker in the application of claim 1, and nucleotide sequences of the primer pair are shown in SEQ ID No. 2 and SEQ ID No.

3.

4. A kit for detecting resistance to disease in Tibetan sheep, characterized by, The kit comprises a primer pair for amplifying the SGOL1 gene molecular marker in the application of claim 1, and nucleotide sequences of the primer pair are shown in SEQ ID No. 2 and SEQ ID No.

3.

5. The kit of claim 4, wherein The kit further comprises PCR reaction reagents.

6. Application of the kit in claim 4 or 5 in marker-assisted selection of the disease resistance trait of Tibetan sheep for non-diagnostic purposes.

7. Application of the kit in claim 4 or 5 in the assisted breeding of the disease resistance trait of Tibetan sheep.

Images