Colletotrichum wild strain and vaccine strain identification nucleic acid detection method and primer probe combination

By designing a triple qPCR detection method with specific primer and probe combinations, the problem of existing technologies being unable to distinguish between wild-type Bacillus anthracis strains and vaccine strains has been solved, achieving efficient and accurate identification. It is applicable to a variety of nucleic acid amplification platforms and supports rapid detection and accurate quantification.

CN121759622APending Publication Date: 2026-03-31SHIHEZI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610044607.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-14
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Current detection technologies cannot distinguish between wild-type anthrax Bacillus strains and the two vaccine strains, making it difficult to trace the source of the outbreak and assess contamination.

Method used

We designed specific primer and probe combinations to perform triple qPCR detection of the sap, pXO1, and pXO2 genes of Bacillus anthracis. By simultaneously detecting these genes in the same reaction system, we were able to distinguish between wild-type anthrax strains and vaccine strains.

Benefits of technology

It enables efficient and accurate differentiation between wild-type anthrax strains and vaccine strains in the same reaction, avoids signal crosstalk, has high specificity and sensitivity, is applicable to a variety of nucleic acid amplification platforms, and supports rapid detection and accurate quantification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759622A_ABST
    Figure CN121759622A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of anthrax detection / monitoring, and particularly discloses an anthrax wild strain and vaccine strain identification nucleic acid detection method. Comprising the following steps: S1, screening differential fragments of bacillus anthracis and designing primers and probes: designing primer and probe combinations for sap, pXO1 and pXO2 genes by referring to a whole genome sequence of the bacillus anthracis in a database; s2, gene cloning and standard substance preparation; s3, determining a reaction system of triple qPCR; and S4, carrying out qPCR (quantitative polymerase chain reaction) amplification detection. According to the fluorescent quantitative PCR detection method disclosed by the invention, the specific three genomes are screened and verified to cooperate as the identification marker, and the matched specific primer and probe sequences with high specificity and sensitivity are designed, so that the method can be used for efficiently identifying the bacillus anthracis wild strain and the vaccine strain; the method has the advantage of realizing efficient and specific synchronous amplification and detection of three target genes in the same reaction system.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of anthrax detection / monitoring technology, and more specifically, to a nucleic acid detection method and primer-probe combination for differentiating between wild-type anthrax strains and vaccine strains. Background Technology

[0002] Anthrax is an acute, contagious zoonotic infectious disease caused by Bacillus anthracis, which seriously endangers human and animal health. It is a natural focal infectious disease and a Class B infectious disease under the "Law of the People's Republic of China on the Prevention and Control of Infectious Diseases." For confirmed anthrax cases in animals, strict adherence to the "Technical Specifications for Anthrax Prevention and Control" is required for bloodless culling and harmless disposal. Susceptible animals must undergo preventative immunization. Currently, two attenuated anthrax vaccines are used in China: Anthrax Spore Vaccine No. II and non-capsulated Anthrax Spore Vaccine. After immunization, the vaccine strain can survive and multiply briefly in the animal's body and can still form spores in the environment after being excreted, causing environmental pollution. It is particularly important to note that current detection technologies struggle to distinguish between wild-type anthrax strains and vaccine strains in the environment, posing a significant challenge to epidemic tracing and pollution assessment.

[0003] Related diagnostic techniques include PCR, qPCR, LAMP, RPA isothermal amplification, antibody ELISA detection, and quantum dot fluorescence immunoassay, but existing diagnostic techniques cannot distinguish between wild-type anthrax Bacillus anthracis strains and the two vaccine strains. Summary of the Invention

[0004] To address the problem that existing diagnostic techniques cannot distinguish between wild-type anthrax Bacillus thuringiensis strains and two vaccine strains, this application provides a nucleic acid detection method and primer-probe combination for differentiating wild-type anthrax strains from vaccine strains.

[0005] This application provides a nucleic acid detection method for differentiating between wild-type anthrax virus strains and vaccine strains, employing the following technical solution: A nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains includes the following steps: S1. Screening of differentially expressed fragments in Bacillus anthracis: Based on the whole genome sequence of Bacillus anthracis in the NCBI database, primers and probes were designed for the conserved regions of the sap, pXO1 and pXO2 genes using relevant software.

[0006] S2. Gene Cloning and Standard Preparation: Using the genome of wild-type Bacillus anthracis strain as a template, the target gene was amplified by PCR using primers obtained in S1, and observed by 1% agarose gel electrophoresis. The target fragment was recovered by gel extraction, and the recovered target fragment and pMD19-T cloning vector were incubated at 12-20℃ for 0.8-1.2 hours to construct a recombinant cloning plasmid. Subsequently, it was transformed into Trans5 α competent cells, positive clones were screened, and after sequencing verification, recombinant cloning bacteria were obtained. The recombinant cloning bacteria were then cultured and plasmids were extracted.

[0007] S3. Determining the 20μL reaction system for triple qPCR: First, determine the final concentrations of primers for the sap, pXO1, and pXO2 genes, and then determine the final concentration of the TaqMan probe; then add template and make up the difference with enzyme-free deionized water.

[0008] S4, qPCR amplification detection: using 10 prepared in S2 5 For samples of copies / µL, the first treatment was performed at 35-39℃ for 110-130s; followed by treatment at 93-97℃ for 25-35s; treatment at 93-97℃ for 4-6s; treatment at 56-60℃ for 25-35s; and then 40-50 cycles were performed.

[0009] Using the above technical approach, in S1, referencing the complete genome sequence of *Bacillus anthracis* (GCF_000008445.1) from the NCBI database, primers and probe sets were designed using Primer Premier 5 software targeting conserved regions of the *sap*, *pXO1*, and *pXO2* genes, respectively. In S2, using the genome of the wild-type *Bacillus anthracis* strain HC1 as a template, the target genes were amplified by PCR using the primers designed in S1, and observed using 1% agarose gel electrophoresis imaging. The target fragments that matched the desired fragments were recovered from the gel, and the recovered target fragments and the pMD19-T cloning vector were incubated at 16 °C for 1 hour to construct recombinant cloning plasmids pMD19-sap, pMD19-pXO1, and pMD19-pXO2, which were then transformed into Trans5 α. Competent cells were screened for positive clones, and after sequencing verification, the correct recombinant bacterial clones pMD19-sap, pMD19-pXO1, and pMD19-pXO2 were obtained. The successfully recombinant bacterial clones pMD19-sap, pMD19-pXO1, and pMD19-pXO2 were inoculated into LB broth medium and cultured. Plasmids were then extracted using an endotoxin-free plasmid extraction kit. The concentration of the extracted plasmids was measured using a nucleic acid and protein analyzer, and the plasmid copy number was calculated using the following formula: Copy number (copies / μL) = Plasmid concentration (ng / μL) × 6.022 × 10⁻⁶. 23 ×10-9 / (660 × base number), the concentrations of plasmids pMD19-sap, pMD19-pXO1, and pMD19-pXO2 were measured to be 8.52 × 10⁻⁶. 10 copies / μL, 1.68×10 11 copies / μL and 5.67×10 10 The plasmids were mixed at a ratio of 2:1:3 to achieve a mixed plasmid concentration of 2.84 × 10⁻⁶ copies / μL. 10 The samples were stored at -80℃. In S3, the final optimized qPCR reaction system was: 4 μL of 5 × super Multiple qPCR PreMix; the final primer concentrations for the sap, pXO1, and pXO2 genes were 0.2 μM, 0.2 μM, and 0.3 μM, respectively; the final TaqMan probe concentrations were 0.1 μM, 0.1 μM, and 0.15 μM, respectively; 2.5 μL of template was added, and enzyme-free deionized water was added to bring the total to 20 μL. In S4, the 10 μL samples prepared in S2 were used... 5 Samples of copies / µL were cyclically processed. By simultaneously targeting the sap gene on the chromosome of Bacillus anthracis and the pXO1 and pXO2 plasmid genes that determine its virulence, a multiplex identification detection system was constructed. This system can clearly distinguish wild-type strains containing complete virulence genomes, non-capsulated vaccine strains lacking only the pXO2 plasmid, and vaccine strain II lacking only a portion of the pXO1 plasmid gene by combining the three target detection modes in a single reaction. Therefore, a highly efficient, accurate detection effect was achieved that can complete the identification of strain virulence attributes in one step.

[0010] Preferably, step S1 includes three specific hydrolysis probes for simultaneously detecting the sap gene, pXO1 gene, and pXO2 gene in the same reaction system, wherein: the probe for detecting the sap gene is labeled with a HEX fluorescent group at the 5′ end and a BHQ1 quencher group at the 3′ end; the probe for detecting the pXO1 gene is labeled with a FAM fluorescent group at the 5′ end and a BHQ1 quencher group at the 3′ end; and the probe for detecting the pXO2 gene is labeled with a Cy5 fluorescent group at the 5′ end and a BHQ1 quencher group at the 3′ end.

[0011] By adopting the above technical solution, specific primer sequences for the sap, pXO1, and pXO2 genes are disclosed. These sequences are selected from conserved regions of their respective genes through bioinformatics comparison and screening, ensuring that the primers can stably bind to the target template. This provides a precise guiding basis for the smooth initiation of the subsequent polymerase chain reaction and specific amplification. Therefore, it achieves a stable reaction effect that obtains highly specific amplification of the expected fragment and avoids non-specific binding and amplification.

[0012] Preferably, the nucleotide sequences of the specific primer pair and hydrolysis probe for the sap gene are: CGGTACTGAAGTTGTTTCACCAGAGGG (SEQ ID NO: 3); the nucleotide sequences of the specific primer pair and hydrolysis probe for the pXO1 gene are: CGTAAGGTTTGTCCTTCACGCTACGT (SEQ ID NO: 6); and the nucleotide sequences of the specific primer pair and hydrolysis probe for the pXO2 gene are: ACGTTGTACCCATGTCGCAGCTATTAA (SEQ ID NO: 9).

[0013] By employing the above technical solution, and by disclosing the hydrolysis probe sequences labeled with different reporter fluorescent groups that are compatible with each primer pair, these probes are cleaved by the 5' exonuclease activity of Taq polymerase during the extension stage of the polymerase chain reaction, resulting in the release of fluorescent signals. This mechanism enables real-time monitoring of the amplification process, and different fluorescent channels correspond to different target genes, allowing for the simultaneous detection of three targets in one reaction tube. Furthermore, based on the specific recognition and amplification of nucleic acid sequences, this mechanism, combined with various nucleic acid amplification and signal reading technologies, gives the kit application adaptability, enabling it to be used not only on the real-time quantitative polymerase chain reaction platform, but also on digital PCR platforms, CRISPR-Cas detection platforms, or isothermal amplification detection platforms. Therefore, it achieves a detection effect that can reflect the presence of SAP, pXO1, and pXO2 genes in real time, intuitively, and specifically.

[0014] Preferably, in step S2, the prepared standard is a mixed plasmid standard containing recombinant cloning plasmids pMD19-sap, pMD19-pXO1, and pMD19-pXO2, wherein the copy number concentration of the mixed plasmid is 2.84 × 10⁻⁶. 10 copies / μL.

[0015] By employing the above technical solution, recombinant plasmids containing three target gene fragments are mixed in a specific ratio to prepare a unified standard with a known high copy number. This standard serves as a benchmark for constructing a standard curve and verifying the sensitivity and linear range of the detection system. Its uniformity and stability provide a reliable and traceable template source for subsequent optimization and performance evaluation of the reaction system. The successfully recombinant clonal bacteria pMD19-sap, pMD19-pXO1, and pMD19-pXO2 are inoculated into LB broth medium and cultured. Subsequently, plasmids are extracted using an endotoxin-free plasmid extraction kit. After measuring the concentration of the extracted plasmids using a nucleic acid protein detector, the plasmid copy number is calculated using the following formula: Copy number (copies / μL) = Plasmid concentration (ng / μL) × 6.022 × 10⁻⁶23 ×10 -9 / (660 × base number), the concentrations of plasmids pMD19-sap, pMD19-pXO1, and pMD19-pXO2 were measured to be 8.52 × 10⁻⁶. 10 copies / μL, 1.68×10 11 copies / μL and 5.67×10 10 The plasmids were mixed at a ratio of 2:1:3 to achieve a mixed plasmid concentration of 2.84 × 10⁻⁶ copies / μL. 10 The samples were stored at -80°C in copies / μL, thus obtaining a calibration effect that can accurately evaluate the performance of the detection method and ensure the accuracy and comparability of experimental results.

[0016] Preferably, in step S3, the final concentration gradients of the upstream and downstream primers for the sap gene, pXO1 gene, and pXO2 gene are 0.10, 0.20, 0.30, 0.40, 0.50, and 0.60 µM, respectively.

[0017] By adopting the above technical solution, the final primer concentration gradient from 0.10 to 0.60 µM is systematically tested during the reaction system optimization process. This gradient range covers the lower and upper limits of primer concentration required for conventional polymerase chain reactions. By comparing the amplification efficiency, specificity, and fluorescence signal intensity of the reaction at different concentrations, the optimal concentration that minimizes non-specific products such as primer dimers while ensuring high amplification efficiency can be screened. This provides experimental basis for the final primer concentration of 0.2 µM or 0.3 µM in the final reaction system. Therefore, an optimized effect with a stable reaction system, good amplification curve, and low background signal is obtained.

[0018] Preferably, in step S3, the final concentration gradient of the TaqMan probe is 0.05, 0.10, 0.15, 0.20, 0.25, and 0.30 µM.

[0019] By adopting the above technical solution, the final concentration of the hydrolysis probe is optimized in a gradient within a fixed total volume reaction system, with a test range from 0.05 to 0.30 µM. This process aims to balance the fluorescence signal intensity with the risk of reaction inhibition. Too low a probe concentration may result in a weak signal, while too high a concentration may inhibit the polymerase chain reaction or increase background fluorescence. By improving and determining the optimal working concentration of each probe, the final primer concentration in the final reaction system is determined to be 0.1 µM or 0.15 µM. This ensures that each fluorescence channel can obtain a sufficiently strong specific signal without interference in subsequent multiplex detection. Therefore, a multiplex fluorescence detection effect with high signal-to-noise ratio and clearly distinguishable detection signals for each target is obtained.

[0020] Preferably, the method has a detection sensitivity of 12-16 copies / μL for the sap gene, 25-35 copies / μL for the pXO1 gene, and 12-16 copies / μL for the pXO2 gene.

[0021] By adopting the above technical solution, and using precisely quantified mixed plasmid standards for gradient dilution testing, the method was able to stably detect the lowest concentration limit of the target template. This sensitivity data shows that the method has high detection capability for both anthrax chromosomal markers and markers of the two viral plasmids, and can cope with low pathogen content in samples. Therefore, it achieves a sensitive detection effect that is still effective for low-load samples, providing support for early diagnosis or environmental monitoring.

[0022] Preferably, the repeatability coefficient of the method is less than 1.40% within groups and less than 3.20% between groups.

[0023] By adopting the above technical solution, and conducting repeatability experiments within and between groups on the improved reaction system and conditions, the lower coefficients of variation within and between groups indicate that the method has high stability of results under the same operating conditions and at different times and among different operators. This performance index is proof of the reliability and practicality of the method. Therefore, the method achieves stable detection results, good repeatability, and suitability for standardized operation and inter-laboratory comparison.

[0024] Preferably, the primer gene sequences are designed as follows: sap gene sequence is SEQ ID NO: 10, pXO1 gene sequence is SEQ ID NO: 11, and pXO2 gene sequence is SEQ ID NO: 12.

[0025] By adopting the above technical solution, SEQ ID NO: 10: GGTTCTTTAGAAGCAAAAACAATCGAAATGGCTGACCAAACAGTTGTAGCTGATGAGCCAACAGCATTACAATTCACAGTTAAAGATGAAAACGGTACTGAAGTTGTTTCACCAGAGGGTATTGAATTTGTAACGCCAGCTGCAGAAAAAATTAATGCAAAAGGTGAAATCACTTTAGCAAAAGGTACTTCA.

[0026] SEQ ID NO: 11: TTTTCATAGTAAATTCCTCCTTAAAGTAAAAAAAGGACAAACTTCGCCCGAGTTAACAGGGCGTAAGGTTTGTCCTTCACGCTACGTACAATAGAGTATAAACAATGGAAACAAATTTTCTATCTATATAATACCATAAGATTTATATAGAATGCTATAGATGATAAGAATCCAGGATAAAAAATTGATAACATAATTCCTAATTTATTTGTTTGGTGGGAGAATT.

[0027] SEQ ID NO: 12: CATAATGTCACCAACCATCGTCATCGTCAATTTTTCGTTCTCACGATGTTTTACTGGTGCTACTGCTTCTGTACGTTGTACCCATGTCGCAGCTATTAATATAACTGCGATAAGAGGTAATACGATTGCTACATAACGAGGATTTTTTTCTTGGTTTTCTTAATAAAAGATCAGTAACTTTTCTTG.

[0028] Preferably, a primer-probe combination for identifying wild-type anthrax virus strains and vaccine strains is provided, and a nucleic acid detection kit for identifying wild-type anthrax Bacillus strains and vaccine strains is established, comprising the primer and probe set in step S1.

[0029] By adopting the above technical solution, the optimized specific primer and probe sequences, reaction system composition, reaction procedure parameters, and prepared standards are standardized and formulated to form a complete detection kit. This kit provides ready-to-use or semi-ready-to-use detection components, simplifies the user's operation steps, and reduces experimental errors caused by differences in reagent preparation. Therefore, it achieves the effect of a detection product that is easy to promote and apply, simple to operate, and has standardized results.

[0030] In summary, this application has the following beneficial effects: 1. Since the primers and probes of this application target the sap, pXO1 and pXO2 genes of Bacillus anthracis, these substances are designed for conserved regions of the target genes and have been improved and screened. They can achieve efficient and specific simultaneous amplification and detection of the three targets in the same reaction system, avoiding signal crosstalk. Therefore, they can achieve a highly efficient identification effect that can accurately distinguish between wild-type anthrax strains and vaccine strains in one step.

[0031] 2. In this application, the anthrax-specific nucleotide sequences used for identification include the sap, pXO1, and pXO2 genes. Because these genetic material targets have been bioinformatically compared and verified, they specifically bind to the DNA template of the target strain under the selected annealing conditions, and do not cross-react with common closely related or environmental bacteria such as Bacillus cereus and Bacillus thuringiensis. Therefore, a high degree of specificity in identifying wild-type anthrax strains and vaccine strains is obtained, and false positive results in the detection are avoided.

[0032] 3. In this application, because the verified specific primer and probe system has platform versatility, it can not only be used for real-time PCR, but also, after adaptation, for digital PCR, CRISPR-Cas biosensors or isothermal amplification and other technology platforms. Therefore, the detection methods are expanded, providing identification tools for diverse scenarios such as rapid on-site detection, absolute quantification and sequencing enrichment of Bacillus anthracis. Attached Figure Description

[0033] Figure 1 This image shows the nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains, and the primer-probe combination used in this application to verify the identification of wild-type anthrax strains and two vaccine strains. Figure 2 This image shows the specificity verification of the triple qPCR control bacteria for the nucleic acid detection method and primer-probe combination for differentiating between wild-type anthrax strains and vaccine strains proposed in this application. Figure 3 This image shows the sensitivity verification of the nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains, as well as the triple qPCR method using primer-probe combinations proposed in this application. Figure 4 This is a flowchart of the nucleic acid detection method and primer-probe combination for differentiating between wild-type anthrax strains and vaccine strains proposed in this application. Detailed Implementation

[0034] The present application will be further described in detail below with reference to the accompanying drawings and embodiments.

[0035] Technical concept: Related diagnostic techniques include PCR, qPCR, LAMP, RPA isothermal amplification, antibody ELISA detection, and quantum dot fluorescence immunoassay, but existing diagnostic techniques cannot distinguish between wild-type anthrax Bacillus anthracis strains and the two vaccine strains.

[0036] The nucleic acid detection method for differentiating between wild-type and vaccine strains of anthrax disclosed in this application includes the following steps: S1, screening and primer design of differentially expressed fragments of Bacillus anthracis: Primers and probe sets are designed targeting conserved regions of the sap, pXO1, and pXO2 genes, based on the whole genome sequence of Bacillus anthracis in the NCBI database; S2, gene cloning and preparation of standards; S3, optimization of the qPCR reaction system and conditions; S4, qPCR amplification and detection. This method can specifically distinguish between wild-type, non-capsulated vaccine strains, and vaccine strain II of Bacillus anthracis, and shows no cross-reactivity with Bacillus cereus, Bacillus thuringiensis, Bacillus subtilis, Bacillus, Escherichia coli, Proteus mirabilis, Pseudomonas aeruginosa, Salmonella, Staphylococcus aureus, Enterococcus faecalis, and Streptococcus pasteurellosis. Furthermore, the primer and probe combinations can be used on quantitative real-time PCR platforms, digital PCR platforms, CRISPR-Cas detection platforms, or isothermal amplification detection platforms.

[0037] This application provides primers and probes for the SAP, pXO1, and pXO2 genes of Bacillus anthracis. Because these substances are designed for conserved regions of the target genes and have been improved and screened, they can achieve efficient and specific simultaneous amplification and detection of the three targets in the same reaction system, avoiding signal crosstalk. Therefore, they can achieve a highly efficient identification effect that can accurately distinguish between wild-type anthrax strains and vaccine strains in one step.

[0038] Table 1: Primer sequence diagram of primer-probe combinations for differentiating anthrax wild-type strains and vaccine strains.

[0039] Example 1 Identification and verification of wild-type Bacillus anthracis strains with two vaccine strains: Experimental verification showed that this research protocol has good specificity. (See also...) Figure 1 and Figure 2 It was found that in the differentiation test between wild-type Bacillus anthracis strains and the two vaccine strains, the two wild-type strains HC1 and SX1 were positive for sap, pXO1, and pXO2 genes; the No. II vaccine strain was positive for sap and pXO2 genes, but negative for pXO1 gene; the non-capsulated vaccine strain was positive for sap and pXO1 genes, but negative for pXO2 gene. These results can effectively distinguish between wild-type Bacillus anthracis strains and the two vaccine strains.

[0040] Example 2 Triple qPCR control bacterial specificity verification: The triple TaqMan qPCR method established in this experiment was used for specific detection of 11 common pathogens (Bacillus cereus, Bacillus thuringiensis, Bacillus subtilis, Bacillus, Escherichia coli, Proteus mirabilis, Pseudomonas aeruginosa, Salmonella, Staphylococcus aureus, Enterococcus faecalis, and Streptococcus pasteurellosis) and wild-type Bacillus anthracis. The test results are as follows: Figure 3 As shown, the results indicate that only the wild-type Bacillus anthracis strain showed detectable Ct values ​​in the sap, pXO1, and pXO2 genes, while the other bacteria did not show detectable Ct values ​​in any of the three channels. This demonstrates that the established triple TaqMan qPCR detection method for Bacillus anthracis has good specificity. Example 3 Triple qPCR sensitivity validation: at a concentration of 10 7 ~10 0 Triple TaqMan qPCR amplification was performed using plasmid standards pMD19-sap, pMD19-pXO1, and pMD19-pXO2 (copies / µL) as templates. The detection results are as follows: Figure 4 As shown, the results indicate that, under the condition of Ct value < 36, the established triplet qPCR method exhibited good detection sensitivity for all three plasmids, with detection limits of 14 copies / µL for the sap gene, 30 copies / µL for the pXO1 gene, and 14 copies / µL for the pXO2 gene. These results demonstrate that the triplet TaqMan qPCR method established in this study has high sensitivity. Example 4 Triple qPCR intra- and inter-group repeatability assays: using 7 different concentrations (10 7 ~10 1 Equal volumes of plasmid standards pMD19-sap, pMD19-pXO1, and pMD19-pXO2 (copies / µL) were mixed and used as templates. Intra- and inter-group repeatability tests were performed using the triplet qPCR method established in this study. The results are shown in Table 1. The coefficients of variation for intra-group repeatability tests were all less than 1.40%, and the coefficients of variation for inter-group repeatability tests were all less than 3.20%. These results indicate that the triplet qPCR method established in this study has good repeatability and stability.

[0041] Table 2. Intra- and Inter-group Repeatability Tests of Triple qPCR

[0042] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. A nucleic acid detection method for discriminating between a wild-type strain of anthrax and a vaccine strain, characterized in that, The method comprises the following steps: S1, differential fragment screening of Bacillus anthracis: referring to the whole genome sequence of Bacillus anthracis in the NCBI database, primers and probes are designed for the conserved regions of sap, pXO1 and pXO2 genes, respectively; S2, gene cloning and standard preparation: using the genome of the wild strain of Bacillus anthracis as a template, the primers obtained in S1 are used for PCR amplification of the target gene, and 1% agarose gel electrophoresis imaging is observed; the target fragment is recovered, and the recovered target fragment and pMD19-T cloning vector are placed at 12-20 DEG C for 0.8-1.2 hours to construct a recombinant cloning plasmid, which is then transformed into Trans5 alpha competent cells, and positive clones are screened, and after sequencing verification, a recombinant cloning bacterium is obtained, and the recombinant cloning bacterium is cultured and the plasmid is extracted, and a sample is prepared; S3, determination of 20 muL reaction system of triple qPCR: first, the final concentration of the primers of sap gene, pXO1 gene and pXO2 gene is determined, and then the final concentration of TaqMan probe is determined; then add the template, and supplement with enzyme-free deionized water; S4, qPCR amplification detection: using the sample prepared in S2, first treat at 35-39 DEG C for 110-130 s; then treat at 93-97 DEG C for 25-35 s; treat at 93-97 DEG C for 4-6 seconds, then treat at 56-60 DEG C for 25-35 s, and then perform 40-50 cycles.

2. The nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains according to claim 1, characterized in that, In the S1 step, the upstream primer sequence of the sap gene is: TGATGAGCCAACAGCATTACA (SEQ ID NO: 1), and the downstream primer sequence is: GCAGCTGGCGTTACAAATTC (SEQ ID NO: 2); the upstream primer sequence of the pXO1 gene is: AACTTCGCCCGAGTTAACAG (SEQ ID NO: 4), and the downstream primer sequence is: CCTGGATTCTTATCATCTATAGCATTC (SEQ ID NO: 5); the upstream primer sequence of the pXO2 gene is: TTACTGGTGCTACTGCTTCTG (SEQ ID NO: 7), and the downstream primer sequence is: CCTCGTTATGTAGCAATCGTAT (SEQ ID NO: 8).

3. The nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains according to claim 1, characterized in that, In the S1 step, three specific hydrolysis probes are included for simultaneous detection of sap gene, pXO1 gene and pXO2 gene in the same reaction system, wherein: the probe for detecting sap gene is labeled with HEX fluorescent group at 5' end and BHQ1 quenching group at 3' end; the probe for detecting pXO1 gene is labeled with FAM fluorescent group at 5' end and BHQ1 quenching group at 3' end; the probe for detecting pXO2 gene is labeled with Cy5 fluorescent group at 5' end and BHQ1 quenching group at 3' end.

4. The nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains according to claim 2, characterized in that, The nucleotide sequences of the specific primer pair and hydrolysis probe for the sap gene are: CGGTACTGAAGTTGTTTCACCAGAGGG (SEQ ID NO: 3); the nucleotide sequences of the specific primer pair and hydrolysis probe for the pXO1 gene are: CGTAAGGTTTGTCCTTCACGCTACGT (SEQ ID NO: 6); and the nucleotide sequences of the specific primer pair and hydrolysis probe for the pXO2 gene are: ACGTTGTACCCATGTCGCAGCTATTAA (SEQ ID NO: 9).

5. The nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains according to claim 1, characterized in that, In the S2 step, the prepared standard is a mixed plasmid standard containing recombinant cloned plasmids pMD19-sap, pMD19-pXOl and pMD19-pX02, and wherein the copy number concentration of the mixed plasmid is 2.84 x 10 10 copies / μL.

6. The nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains according to claim 1, characterized in that, In the S3 step, the final concentration gradients of the upstream and downstream primers of the sap gene, the pXO1 gene and the pXO2 gene are 0.10, 0.20, 0.30, 0.40, 0.50 and 0.60 µM.

7. The nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains according to claim 1, characterized in that, In the S3 step, the final concentration gradients of the TaqMan probe are 0.05, 0.10, 0.15, 0.20, 0.25 and 0.30 µM.

8. The nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains according to claim 1, characterized in that, The detection sensitivity of the method for the sap gene is 12-16 copies / µL, for the pXO1 gene is 25-35 copies / µL, and for the pXO2 gene is 12-16 copies / µL.

9. The nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains according to claim 1, characterized in that, The repeatability variation coefficient of the method is less than 1.40% within the group and less than 3.20% between groups.

10. The nucleic acid detection method for differentiating between wild-type anthrax strains and vaccine strains according to claim 1, characterized in that, The primer gene sequences are as follows: the sap gene sequence is SEQ ID NO: 10, the pXO1 gene sequence is SEQ ID NO: 11, and the pXO2 gene sequence is SEQ ID NO:

12.

11. A primer-probe combination for the identification of a nucleic acid of a wild-type strain of anthrax from a vaccine strain, characterized in that The nucleic acid detection method for identifying the wild strain and the vaccine strain of anthrax according to any one of claims 1-10, establishes a nucleic acid detection kit for identifying the wild strain and the vaccine strain of anthrax bacillus, which comprises the primer and probe group in the S1 step.