Detection system, detection method and kit for human bocavirus HBoV2-4 subtype

By constructing a PAND detection system, utilizing PfAgo protein and MB for nuclease cleavage reaction of HBoV2-4 subtype, and combining it with fluorescence signal detection, the problems of insufficient sensitivity and specificity of existing detection methods are solved, and efficient detection of HBoV2-4 subtype is achieved.

CN121759644APending Publication Date: 2026-03-31HUBEI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-27
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Existing HBoV detection methods suffer from problems such as low sensitivity, insufficient specificity, high detection costs, and complex operation. In particular, they are difficult to effectively distinguish HBoV2-4 subtypes from other bocavirus serotypes.

Method used

A PAND detection system was constructed using PfAgo protein, gDNA, and MB. Through RPA amplification and PfAgo-mediated nuclease cleavage reaction, combined with fluorescence signal detection, a highly sensitive and specific typing detection of HBoV2-4 subtypes was achieved.

Benefits of technology

It enables rapid, sensitive, and highly specific detection of HBoV2-4 subtypes, reducing detection costs, simplifying the operation process, and improving detection efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759644A_ABST
    Figure CN121759644A_ABST
Patent Text Reader

Abstract

The invention discloses a detection system, a detection method and a kit for a human bocavirus HBoV2-4 subtype, and belongs to the technical field of virus detection. The invention establishes a novel diagnosis method which is based on novel gene programming nuclease PfAgo, can be applied to human bocavirus typing, and is relatively rapid in detection, high in sensitivity and strong in specificity. Sensitivity determination shows that the MDC combined with RPA-PfAgo reaches 4 * 10 <-2 > aM (0.025 copy / [mu] L), which saves 45 min compared with a PCR-HBoV-PAND method. Specific detection results show that the RPA-HBoV-PAND method can efficiently and sensitively distinguish different types of the human bocavirus and the non-human bocavirus, and a key scientific support is provided for clinical diagnosis of the human bocavirus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of virus detection technology, and in particular to a detection system, detection method and reagent kit for human bocavirus HBoV2-4 subtype. Background Technology

[0002] Human bocaparvovirus (HBoV) belongs to the family Parvoviridae and the genus Bocaparvovirus. It was first discovered in 2005 in nasopharyngeal samples from children's respiratory secretions. It primarily infects and causes mild to severe upper and lower respiratory tract illnesses in infants and young children, with a detection rate of 1.5% to 19% in children with respiratory symptoms. HBoV types 2, 3, and 4 have subsequently been found in gastrointestinal clinical samples, mainly associated with gastrointestinal symptoms, but their relationship with gastrointestinal diseases remains unclear. HBoV is an icosahedral single-stranded DNA virus with a full-length genome of 5543 nt. The genome contains unequal terminal repeats (ITRs) at both ends. The middle region of the genome encodes six non-structural proteins NS1 / NS1-70 / NS2 / NS3 / NS4 and NP1, and three structural proteins VP1 / 2 / 3. The non-structural proteins are relatively conserved and play a role in viral genome replication and post-transcriptional modification, while the latter are the main proteins that make up the viral capsid.

[0003] Currently, serological and nucleic acid testing are commonly used methods for HBoV clinical detection. Serological testing has high specificity and relatively convenient serum sample collection; however, it has lower sensitivity, which may not accurately identify samples with low viral loads, and it also has drawbacks such as cross-reactivity with other bocavirus serotypes and high testing costs. Nucleic acid testing has high sensitivity and can accurately distinguish HBoV1 from other bocavirus serotypes or other pathogens; however, it suffers from false positives and complex testing procedures. In recent years, molecular diagnostic methods based on CRISPR / CAS systems for the detection of different pathogens have been widely established. Compared with traditional qPCR methods, this method has the advantages of lower equipment and operator requirements, time-saving, rapid, and low cost; however, it relies on PAM sequences and expensive gRNA guidance. Therefore, developing novel molecular detection methods for HBoV is of great significance for HBoV prevention. Summary of the Invention

[0004] The purpose of this invention is to provide a detection system, detection method, and kit for the human bocavirus HBoV2-4 subtype, in order to solve the problems existing in the prior art.

[0005] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of this invention is a detection system for human bocavirus HBoV2-4 subtype, comprising PfAgo protein, gDNA and MB; The nucleotide sequences of the gDNA are shown in SEQ ID NO.1~3; The nucleotide sequence of MB is shown in SEQ ID NO.19; The amino acid sequence of the PfAgo protein is shown in SEQ ID NO.22.

[0006] The second technical solution of this invention is a method for detecting the human bocavirus HBoV2-4 subtype, not for the purpose of disease diagnosis and treatment, comprising the following steps: (1) Extract DNA from the sample to be tested; (2) Using the DNA sample obtained in step (1) as the detection target, a PAND detection system containing PfAgo protein, gDNA and MB was constructed for reaction; The nucleotide sequence of the gDNA is shown in SEQ ID NO.1~3; The nucleotide sequence of the MB is shown in SEQ ID NO.19; The amino acid sequence of the PfAgo protein is shown in SEQ ID NO.22.

[0007] The third technical solution of the present invention is a detection kit for human bocavirus HBoV2-4 subtype, comprising the detection system.

[0008] Based on the above technical solution, the present invention has the following technical effects: This invention establishes a novel gene-programmed nuclease-based system. Pf Ago presents a novel diagnostic method for human bocavirus typing that is relatively rapid, highly sensitive, and specific. Through bioinformatics analysis and in vitro nuclease digestion reactions, gDNA and target DNA targeting HBoV2, HBoV3, and HBoV4 were screened and optimized, ultimately establishing a preliminary novel molecular diagnostic method capable of typing and detecting HBoV2-4 genotypes. Pf Ago's MDC reached 4×10 - 2 The RPA-HBoV-PAND method (0.025 copies / μL) saves 45 minutes compared to the PCR-HBoV-PAND method. Specificity test results show that the RPA-HBoV-PAND method can efficiently and sensitively distinguish between different subtypes of human bocavirus and non-human bocavirus, providing crucial scientific support for the clinical diagnosis of human bocavirus. Attached Figure Description

[0009] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0010] Figure 1 for Pf PCR amplification and validation of the Ago gene and vector. Among them, A... Pf Ago fragment and vector amplification; B.pET23a- Pf Ago recombinant plasmid verification.

[0011] Figure 2 For reorganization Pf Purification and endonuclease activity identification of Ago fusion proteins. Among them, A. recombinant... Pf Purification of the Ago fusion protein; B. Determination of the BSA standard curve; C. Pf Ago endonuclease activity assay: MB stands for Molecular beacon; CP stands for Cleavage Product.

[0012] Figure 3 Screening for HBoV2-4 molecular beacons (MBs) and gMBs. Specifically: A: Screening for HBoV2-VP1 type molecular beacons (MBs) and gMBs; B: Screening for HBoV3-VP1 type molecular beacons (MBs) and gMBs; C: Screening for HBoV4-VP1 type molecular beacons (MBs) and gMBs.

[0013] Figure 4 The primer combination used was HBoV2 / HBoV3 / HBoV4-PAND. The process included: A. Design of the HBoV2 / HBoV3 / HBoV4-PAND primer combination; B. Isothermal amplification detection using the HBoV2 / HBoV3 / HBoV4-PAND primer combination; and C. Fluorescence analysis of the HBoV2 / HBoV3 / HBoV4-PAND primer combination.

[0014] Figure 5 for Pf Establishment of an Ago-mediated targeted nucleic acid detection method for HBoV2-4 genotyping. A: TBE-PAGE image of human bocavirus HBoV2-VP1 detected using the PAND method; B: TBE-PAGE image of human bocavirus HBoV3-VP1 detected using the PAND method; C: TBE-PAGE image of human bocavirus HBoV4-VP1 detected using the PAND method.

[0015] Figure 6To optimize the HBoV-PAND nucleic acid detection method. Specifically, A: fluorescence intensity detection of HBoV2-PAND with three phosphorylated gr / gf / gt and FAM-labeled MB; B: fluorescence intensity detection of HBoV3-PAND with three phosphorylated gr / gf / gt and FAM-labeled MB; C: fluorescence intensity detection of HBoV4-PAND with three phosphorylated gr / gf / gt and FAM-labeled MB.

[0016] Figure 7 Sensitivity determination of the RPA-HBoV-PAND detection method. A: Sensitivity analysis of RPA-PAND and PCR-PAND for HBoV2-VP1; B: Sensitivity analysis of RPA-PAND and PCR-PAND for HBoV3-VP1; C: Sensitivity analysis of RPA-PAND and PCR-PAND for HBoV4-VP1.

[0017] Figure 8 This is for the determination of the specificity of the RPA-HBoV-PAND detection method.

[0018] Figure 9 for Pf A schematic diagram of the principle of Ago-mediated nucleic acid detection. Here, g1 / g2 / g3 represent the input gDNA, and gn represents the generated gDNA released from the double strand. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0025] This invention provides a detection system for human bocavirus HBoV2-4 subtype, comprising PfAgo protein, gDNA, and MB; The nucleotide sequences of the gDNA are shown in SEQ ID NO.1~3; The nucleotide sequence of MB is shown in SEQ ID NO.19; The amino acid sequence of the PfAgo protein is shown in SEQ ID NO.22.

[0026] In some specific implementations, the MB carries a fluorescent group.

[0027] In some specific implementations, the 5' end of the MB is connected to cgcacc, and the 3' end is connected to ggtgcg.

[0028] In some specific implementations, RPA primers are also included.

[0029] In some specific implementations, the RPA primers include an upstream primer as shown in SEQ ID NO. 10 and a downstream primer as shown in SEQ ID NO. 11.

[0030] This invention also provides a method for detecting the human bocavirus HBoV2-4 subtype, not for the purpose of disease diagnosis and treatment, comprising the following steps: (1) Extract DNA from the sample to be tested; (2) Using the DNA sample obtained in step (1) as the detection target, a PAND detection system containing PfAgo protein, gDNA and MB was constructed for reaction; The nucleotide sequence of the gDNA is shown in SEQ ID NO.1~3; The nucleotide sequence of the MB is shown in SEQ ID NO.19; The amino acid sequence of the PfAgo protein is shown in SEQ ID NO.22.

[0031] In some specific implementation schemes, step (1) specifically involves: extracting DNA from the sample to be tested, using the obtained DNA as a template to amplify it through RPA primers to obtain RPA products; wherein the RPA products contain gDNA and the target region for MB detection.

[0032] In some specific implementations, the RPA primers include an upstream primer as shown in SEQ ID NO. 10 and a downstream primer as shown in SEQ ID NO. 11.

[0033] In some specific implementations, the conditions for amplification using RPA primers are: reaction at 37°C for 20 min; the reaction conditions in step (2) are: reaction at 95°C for 30 min.

[0034] This invention also provides a detection kit for the human bocavirus HBoV2-4 subtype, including the detection system.

[0035] Clinical detection of HBoV mainly involves qPCR / qRT-PCR nucleic acid detection based on viral genomic DNA and mRNA, as well as serological testing. Serological testing has high specificity but low sensitivity; while nucleic acid testing has high sensitivity, but there is currently no more efficient method for genotyping. Our laboratory has established a novel gene-programmed enzyme-based... Pf Ago-mediated nucleic acid detection (PAND) technology utilizes 16nt gDNA to be responsible for... Pf Ago guides the target DNA, cleaves it to produce 16nt ssDNA (gn), and then gn combines with... Pf Ago binds to and guides the cleavage and fluorescence signal detection of fluorescent molecular beacons. Compared to the CRISPR / CAS system, the PAND method does not require a PAM sequence, relies on inexpensive gDNA, and has high specificity and stability.

[0036] Example 1 1 Pf PCR amplification of the Ago gene and vector PfAgo gene amplification system: 1 μL template DNA (1 ng / μL), 0.3 μL F (10 μM), 0.3 μL R (10 μM), 5.0 μL 2×Phanta Max Master Mix, 3.4 µL ddH2O; PCR amplification program: 95℃ 3 min, 95℃ 15 sec, 56℃ 15 sec, 72℃ 2 kb / min, 25 cycles; 72℃ 5 min, 12℃ 1 min.

[0037] Amplification Pf The results of the Ago gene (GenBank: OR402834.1) and the pET-23a vector fragment are as follows: Figure 1 As shown in Figure A, the fragment size is consistent with expectations. Ligation was performed using T5 exonuclease (reaction system: 3 pmol target fragment, 1 pmol vector fragment, 0.5 µL 10×NEBuffer™ 4, 0.5 µL T5 exonuclease (1 U / µL)) to construct pET23a- Pf The Ago recombinant plasmid was validated using universal primers, and the results are as follows: Figure 1 As shown in Figure B, the insertion was verified using sequencing. Pf The correctness of the Ago fragment.

[0038] 2. Reorganization Pf Purification and endonuclease activity identification of Ago fusion protein Reorganization Pf Ago protein was expressed and purified in prokaryotes. Pf The Ago protein sequence is shown in SEQ ID NO.20: SEQ ID NO.22:

[0039] The results are as follows Figure 2 As shown in Figure A, recombinant [material] was successfully prepared. Pf Ago protein. Using the Coomassie Brilliant Blue method (Bradford), 5 μL of serially diluted BSA standard (1 mg / mL) was added to 250 μL of G250. The absorbance was recorded using a microplate reader set to OD595 to create a standard curve. Figure 2 As shown in Figure B, y = 0.6784x + 0.496 (R² = 0.9975). His- Pf The Ago protein OD (595) value was 1.488, or 1.462 mg / ml. Next, its gDNA-dependent endonuclease activity was identified, and the results are as follows: Figure 2 As shown in C, Pf Ago protein possesses endonuclease activity and can be used in subsequent experiments.

[0040] 3. Screening of HBoV2-4 type MB and gMB After performing BLAST alignment on the HBoV2-4 subtype genomes (HBoV2: GenBank: PP460986.1), (HBoV3: GenBank: JN086998.1), and (HBoV4: GenBank: MG383446.1), multiple pairs of specific MBs and corresponding gMBs were designed and PAND validation was performed to screen suitable MBs and gMBs that specifically target HBoV2-4.

[0041] HBoV2-MB (SEQ ID NO. 19): attcaaccatatgcaaaacctacaagctggatgacaggaccaggtctactcagcgcaca; HBoV3-MB (SEQ ID NO. 20): atactaccattcatgaacttgcagaaatggaagactccaatgcagtagaaaaagcaat; HBoV4-MB (SEQ ID NO. 21): gataaacaatgaaagagcatacattcctccaggcttaatgtttaatccactagtaccta.

[0042] The results are as follows Figure 3 As shown, HBoV2-4 screened out suitable MB and gMB. HBoV2 gMB-3 (SEQ ID NO.1): 5'-tcatccagcttgtagg-3', gMB-4 (SEQ ID NO.2): 5'-gtcctgtcatccagct-3', gMB-5 (SEQ ID NO.3): 5'-agacctggtcctgtca-3'.

[0043] gMB-1 (SEQ ID NO. 4) of HBoV3: 5'-catgaatggtaggtat-3', gMB-4 (SEQ ID NO. 5): 5'-atttctgcaagttcat-3', gMB-5 (SEQ ID NO. 6): 5'-gcattggagtcttcca-3').

[0044] gMB-1 (SEQ ID NO. 7) of HBoV4: 5'-gaggaatgtatgctct-3', gMB-4 (SEQ ID NO. 8): 5'-agcctggaggaatgta-3', gMB-5 (SEQ ID NO. 9): 5'-aaacattaagcctgga-3'.

[0045] The cleavage effect was good. Next, we will try to establish a three-gDNA-mediated HBoV-PAND detection system for HBoV2-4.

[0046] 20 μL reaction system: 3 μL PfAgo protein, 0.1 μL MB (10 pmol / μL), 2 μL PfAgo buffer (10×), 0.2 μL gDNA (10 pmol / μL), 14.7 μL ddH2O.

[0047] 4. Optimized design of the combination of RPA amplification and PfAgo protein detection To maximize the fluorescence signal change when RPA amplification products are coupled with the PAND method, different upstream and downstream primers were designed near the identified HBoV2-4 target cleavage site. The results are as follows: Figure 4 As shown, by performing PAND detection on the RPA amplification products of 6 different combinations, and then comparing the fluorescence signal intensity by detecting with an ELISA reader, the optimal RPA primer pairs were finally screened out.

[0048] HBoV2-F / R, F (SEQ ID NO. 10): 5'- aaaagttcctacaagaagagctcaatacatcag-3'; R (SEQ ID NO. 11): 5'- ccagctggtcctactctttgtgcgctgag-3'.

[0049] HBoV3-F / R, F (SEQ ID NO. 12): 5'- caacgacctaacagcaggagta-3'; R (SEQ ID NO. 13): 5'- gctttttctactgcattggagtcttcc -3'.

[0050] HBoV4-F / R, F (SEQ ID NO. 14): 5'-caaataccattttttatgcttgaaaacagcgac-3'; R (SEQ ID NO. 15): 5'-tgctcttctagtaggtactagtggat-3'.

[0051] It can generate high fluorescence signal values ​​in the subsequent human bocavirus typing detection method using RPA amplification combined with PAND detection, thus achieving optimal sensitivity.

[0052] 5 Pf Establishment of an Ago-mediated targeted HBoV1-4 genotyping nucleic acid detection method HBoV2-4 target DNA PCR product (HBoV tDNA) was obtained via oligo bridging and PCR amplification, and then subjected to 3 gDNA-mediated targeting of HBoV2-4 using a PAND assay. Double-stranded DNA can be mediated by 3 gDNA. Pf Ago-specific cleavage, then cascaded, with the cleaved gMB2-mediated... Pf Ago completed the cleavage of the fluorescent molecular beacon MB.

[0053] HBoV2-MB-FAM (SEQ ID NO. 16): cgcacctgacaggaccaggtctggtgcg; HBoV3-MB-FAM (SEQ ID NO. 17): cgcaccatgaacttgcagaaatggtgcg; HBoV4-MB-FAM (SEQ ID NO. 18): cgcacctacattcctccaggctggtgcg.

[0054] The results are as follows Figure 5 As shown.

[0055] 6. Optimization of HBoV-PAND nucleic acid detection method To facilitate subsequent HBoV detection, the enzymes and gDNA in the initially established HBoV-PAND reaction system were further optimized. The results were then analyzed by 20% urea TBE PAGE and fluorescence measurement. The results are as follows: Figure 6 As shown, the three gDNAs targeting HBoV2-4 have a gMB / MB ratio of [missing information]. Pf The degree of cleavage mediated by Ago was 3-20 times greater than that in the control without enzyme, which laid the foundation for subsequent sensitivity determination.

[0056] 7. Sensitivity determination of the RPA-HBoV-PAND detection method By combining RPA amplification technology with PAND detection, the target DNA of HBoV2-4 was cloned into the pUC-18 vector. The constructed recombinant plasmid was then serially diluted 10-fold to obtain 4×10⁻⁶ plasmids. 6 / 10 5 / 10 4 / 10 3 / 10 2 / 10 1 / 10 0 / 10 -1 / 10 -2 For each reaction tube, an equal volume of diluted template was added, and PCR was performed for 30 cycles. Simultaneously, to compare the detection effect of the PAND method using combined PCR and RPA amplification, an equal volume of template was added to the RPA reaction system and amplified at 37°C for 20 minutes.

[0057] RPA amplification reaction system: 29.4 μL A buffer, 5 μL DNA, 2 μL F (10 pmol / μL), 2 μL R (10 pmol / μL), 2.5 μL B buffer, 9.1 μL ddH2O.

[0058] The products obtained from each product were added to the PAND detection system.

[0059] PfAgo-mediated PAND reaction system: 3 μL PfAgo protein; 0.6 μL three gDNAs (10 pmol / μL); 1 μL PCR / RPA amplification product; 2 μL PfAgo buffer (10×); 0.25 μL MB (10 pmol / μL); 13.15 μL ddH2O.

[0060] The reaction conditions were 95℃ for 30 min.

[0061] Fluorescence values ​​obtained using a microplate reader were compared and analyzed, and the sensitivity MDC was analyzed using HBoV-PAND detection. The results of HBoV-PAND detection are as follows: Figure 7 The detection limit of HBoV-PAND is 4×10⁻⁶. -2 aM (0.025 copy / μL).

[0062] 8. Specificity determination of the RPA-HBoV-PAND detection method RPA-HBoV-PAND detection was performed by adding each component, and the results are as follows: Figure 8As shown, when only RPA amplification products that can be specifically targeted by gDNA are present, the fluorescence signal in the reaction is enhanced, while no difference in fluorescence signal is observed in other reaction tube detection systems. This ultimately established a method capable of... Pf The Ago-mediated HBoV2-4 genotyping method has high specificity.

[0063] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A detection system for human bocavirus HBoV subtypes 2-4, characterized by, The PAND detection system comprises a PfAgo protein, a gDNA and a MB. The nucleotide sequence of the gDNA is shown as SEQ ID NO. 1-3. The nucleotide sequence of the MB is shown as SEQ ID NO.

19. The amino acid sequence of the PfAgo protein is shown as SEQ ID NO.

22.

2. The detection system of claim 1, wherein, The MB carries a fluorescent group.

3. The detection system of claim 1, wherein, The 5' end of the MB is connected with cgcacc, and the 3' end is connected with ggtgcg.

4. The assay system of claim 1, wherein The RPA primers are also included.

5. The detection system of claim 4, wherein, The RPA primers comprise an upstream primer shown as SEQ ID NO. 10 and a downstream primer shown as SEQ ID NO.

11.

6. A method for detecting human bocavirus HBoV subtypes 2-4 not for the purpose of diagnosis and treatment of disease, characterized by, The PAND detection system comprises the following steps: (1) extracting DNA of a sample to be detected; (2) taking the DNA sample obtained in step (1) as a detection object, constructing a PAND detection system comprising a PfAgo protein, a gDNA and a MB, and performing a reaction. The nucleotide sequence of the gDNA is shown as SEQ ID NO. 1-3. The nucleotide sequence of the MB is shown as SEQ ID NO.

19. The amino acid sequence of the PfAgo protein is shown as SEQ ID NO.

22.

7. The detection method according to claim 6, characterized in that, The step (1) is specifically: extracting DNA of a sample to be detected, taking the obtained DNA as a template to perform amplification through RPA primers, and obtaining RPA products; wherein the RPA products comprise target regions for gDNA and MB detection.

8. The detection method according to claim 7, characterized in that, The RPA primers comprise an upstream primer shown as SEQ ID NO. 10 and a downstream primer shown as SEQ ID NO.

11.

9. The detection method according to claim 7, characterized in that, The amplification condition through the RPA primers is 37°C for 20 min; and the reaction condition in step (2) is 95°C for 30 min.

10. A detection kit for human bocavirus HBoV2-4 subtypes, characterized by, The PAND detection system comprises any one of claims 1-5.