Modulation of ALAS1 (5 '-aminolevulinic acid synthase 1) gene expression

Abstract

The present disclosure relates to methods, compositions, and kits for treating conditions associated with modulation of expression of 5 '-aminolevulinic acid synthase 1 (ALAS1) by gene editing.

Description

Related applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 515,045, filed July 21, 2023; U.S. Provisional Application No. 63 / 598,408, filed November 13, 2023; and U.S. Provisional Application No. 63 / 624,610, filed January 24, 2024. The entire contents of these applications are hereby expressly incorporated herein by reference in their entirety. References to sequence lists

[0002] This application is submitted together with an electronic sequence list. The sequence list is provided as a file entitled 80EM-341775-WO_SequenceListing, created on June 29, 2024, and is 399 kilobytes in size. Information from the electronic sequence list is incorporated herein by reference in its entirety. background

[0003] field This disclosure generally pertains to the fields of molecular biology and biotechnology (including gene editing).

[0004] Description of the prior art 5'-Aminolevulinic acid synthase 1 (ALAS1) is the first and rate-limiting enzyme catalyzing the synthesis of heme in the liver. ALAS1 catalyzes the synthesis of 5-aminolevulinic acid (ALA) from glycine and succinyl-CoA. ALAS1 (e.g., ALAS1 overexpression) is associated with a variety of conditions, including porphyria.

[0005] The RNA-guided DNA targeting principle of CRISPR (clustered regularly spaced short palindromic repeats)-Cas (CRISPR-associated) systems has been widely used for DNA targeting. CRISPR-Cas systems can be divided into two categories: one category utilizes complexes of multiple Cas proteins (such as type I, III, and IV CRISPR-Cas systems), and the other category utilizes a single Cas protein (such as type II, V, and VI CRISPR-Cas systems). Type II CRISPR-Cas-based systems have been used for genome editing and require Cas peptides or variants guided by customizable guide RNA (gRNA) for programmable DNA targeting.

[0006] There is a need to develop safe and effective therapies for the treatment and prevention of ALAS1-related diseases and conditions. Overview

[0007] The disclosure herein includes a guide RNA (gRNA) for targeting the 5'-aminolevulinic acid synthase 1 (ALAS1) genomic locus. In some embodiments, the gRNA comprises a spacer sequence comprising any one of the sequences in SEQ ID NO: 25-48 and 83-112.

[0008] In some embodiments, the spacer region sequence comprises a sequence selected from the group consisting of SEQ ID NO: 25-48 and 83-112. In some embodiments, the gRNA comprises a spacer region sequence comprising any one of SEQ ID NO: 25-37 and 101-112. In some embodiments, the gRNA comprises a spacer region sequence comprising a sequence of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87. In some embodiments, the gRNA comprises a spacer region sequence comprising a sequence of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO: 30. In some embodiments, the gRNA comprises a spacer region sequence comprising a sequence of SEQ ID NO: 29 or SEQ ID NO: 30. In some embodiments, the gRNA induces or is capable of inducing at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% cleavage efficiency targeting the ALAS1 genomic locus. In some embodiments, the gRNA is capable of inducing at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% cleavage efficiency targeting the ALAS1 genomic locus. In some embodiments, the gRNA is a single guide RNA (sgRNA).

[0009] gRNA can be chemically modified gRNA. In some embodiments, the chemically modified gRNA contains one or more phosphate-thioester bonds and / or one or more 2'-O-methyl nucleotides at the 3' end, 5' end, or both. In some embodiments, 50% or less of the nucleotides of the gRNA contain 2'-O-methyl modification. In some embodiments, about 48% of the nucleotides of the gRNA contain 2'-O-methyl modification. In some embodiments, the 5' end of the gRNA contains three phosphate-thioester bonds, and the 3' end of the gRNA contains three phosphate-thioester bonds.

[0010] The disclosure herein includes compositions. In some embodiments, the composition comprises (a) any gRNA or polynucleotide encoding a gRNA disclosed herein, and (b) a nuclease or nucleic acid encoding a nuclease. In some embodiments, the composition comprises (a) any gRNA or polynucleotide encoding a gRNA disclosed herein, and (b) a Cas9 nuclease or nucleic acid encoding a Cas9 nuclease.

[0011] In some embodiments, the composition comprises: (a) a guide RNA (gRNA) targeting the ALAS1 genomic locus, said gRNA comprising a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112, or a nucleic acid encoding said gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease.

[0012] In some embodiments, the spacer sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 25-48 and 83-112. In some embodiments, the gRNA is a single guide RNA (sgRNA). In some embodiments, the gRNA is a chemically modified gRNA. In some embodiments, the chemically modified gRNA contains one or more phosphate-thioester bonds and / or one or more 2'-O-methyl nucleotides at the 3' end, 5' end, or both. In some embodiments, 50% or less of the nucleotides of the gRNA contain 2'-O-methyl modifications. In some embodiments, about 48% of the nucleotides of the gRNA contain 2'-O-methyl modifications. In some embodiments, the 5' end of the gRNA contains three phosphate-thioester bonds, and the 3' end of the gRNA contains three phosphate-thioester bonds.

[0013] In some embodiments, the Cas9 endonuclease is selected from *Streptococcus pyogenes* Cas9, *Staphylococcus aureus* Cas9, *Neisseria meningitidis* Cas9, *Streptococcus thermophilus* CRISPR1 Cas9, *Streptococcus thermophilus* CRISPR3 Cas9, and *T. denticola* Cas9. In some embodiments, the composition comprises (a) ALAS1 gRNA and (b) Cas9 endonuclease, and the ALAS1 gRNA and Cas9 endonuclease are formulated as ribonucleoprotein particles (RNPs). In some embodiments, the composition comprises (a) nucleic acid encoding ALAS1 gRNA and (b) nucleic acid encoding Cas9 endonuclease. In some embodiments, (a) and / or (b) are present on a viral vector. In some embodiments, the viral vector is an adeno-associated virus vector. In some embodiments, (a) the gRNA or nucleic acid encoding the gRNA, (b) the Cas9 endonuclease or nucleic acid encoding the Cas9 endonuclease, or both, are complexed with liposomes or lipid nanoparticles (LNPs). In some embodiments, the lipid nanoparticles comprise one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-conjugated lipids. In some embodiments, the lipid nanoparticles comprise cholesterol, polyethylene glycol (PEG) lipids, or both.

[0014] The disclosure herein includes methods for treating diseases or conditions caused by ALAS1 overexpression in subjects with appropriate need. In some embodiments, the method includes administering any of the compositions disclosed herein to a subject to treat the disease or condition caused by ALAS1 overexpression in the subject.

[0015] The disclosure herein includes methods for treating subjects who have or are suspected of having porphyria. In some embodiments, the method includes administering any of the compositions disclosed herein to the subject to treat porphyria.

[0016] This disclosure includes methods for treating diseases or conditions caused by ALAS1 overexpression in subjects with corresponding needs. In some embodiments, the method includes administering to the subject a composition comprising more than one nanoparticle compounded with: (a) a guide RNA (gRNA) targeting an ALAS1 genomic locus or a nucleic acid encoding said gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease, thereby treating diseases or conditions caused by ALAS1 overexpression in the subject. In some embodiments, the method includes administering to the subject a composition comprising more than one nanoparticle compounded with: (a) a gRNA targeting an ALAS1 genomic locus, said gRNA comprising a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112, or a nucleic acid encoding said gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease, thereby treating diseases or conditions caused by ALAS1 overexpression in the subject.

[0017] The disclosure herein includes methods for treating subjects with or suspected of having porphyria. In some embodiments, the method includes administering to the subject a composition comprising more than one nanoparticle compounded with: (a) a gRNA targeting an ALAS1 genomic locus or a nucleic acid encoding said gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease, thereby treating porphyria. In some embodiments, the method includes administering to the subject a composition comprising more than one nanoparticle compounded with: (a) a gRNA targeting an ALAS1 genomic locus, said gRNA comprising a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112, or a nucleic acid encoding said gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease, thereby treating porphyria.

[0018] The Cas9 endonuclease can be, for example, *Streptococcus pyogenes* Cas9, *Staphylococcus aureus* Cas9, *Neisseria meningitidis* Cas9, *Streptococcus thermophilus* CRISPR1 Cas9, *Streptococcus thermophilus* CRISPR3 Cas9, or *Treponema denticulatum* Cas9. In some embodiments, more than one nanoparticle is a lipid nanoparticle. The lipid nanoparticle may, for example, comprise one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-conjugated lipids. In some embodiments, the lipid nanoparticle comprises cholesterol, polyethylene glycol (PEG) lipids, or both. The method may include administering the composition to a subject in a single dose of (a) and (b) total nucleic acids at about 0.1 mg / kg, 0.3 mg / kg, 0.6 mg / kg, 1.0 mg / kg, or 2.0 mg / kg. In some embodiments, the method includes a single administration of the composition to a subject. In some embodiments, the composition is administered to a subject two or more times. In some embodiments, the interval between each of the two or more administrations is about two weeks to about four weeks. In some implementations, the interval between each of two or more applications is at least three months.

[0019] In some embodiments, ALAS1 expression is reduced in the subject. In some embodiments, ALAS1 expression is reduced in the liver of the subject. In some embodiments, the reduction is relative to (a) ALAS1 expression in the subject before administration of the composition; (b) ALAS1 expression in one or more untreated subjects; and / or (c) a reference level of ALAS1 expression in a healthy subject. In some embodiments, ALAS1 expression in the subject is reduced by at least 20% after administration. In some embodiments, ALAS1 expression in the subject is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% after administration. In some embodiments, the level of ALAS1 mRNA is reduced by at least 90% after administration. In some embodiments, the level of ALAS1 protein is reduced by at least 75% after administration. In some embodiments, the reduction lasts for at least two weeks, at least three weeks, at least four weeks, or at least one month. The method may include administering a therapeutically effective amount of at least one additional therapeutic agent to the subject. In some implementations, additional therapeutic agents are hydroxymethemoglobin, argininemethemoglobin, ALAS1 siRNA, or combinations thereof.

[0020] In some embodiments, the subject has or is suspected of having cutaneous porphyria. Cutaneous porphyria can be, for example, congenital erythropoietic porphyria (CEP), hepatic erythropoietic porphyria (HEP), delayed-onset cutaneous porphyria (PCT), or erythropoietic protoporphyria and X-linked porphyria (EP / XLP). In some embodiments, the subject has, is suspected of having, or has already had acute porphyria. Acute porphyria can be, for example, acute intermittent porphyria (AIP), hereditary coprophyria (HCP), variant porphyria (VP), or δ-aminolevulinic acid dehydratase deficiency porphyria (ADP). In some embodiments, the frequency of acute porphyria episodes is reduced in the subject compared to before administration.

[0021] Subjects may have elevated urinary porphyrinogen (PBG), elevated urinary aminolevulinic acid (ALA), elevated urinary porphyrin, elevated fecal porphyrin, elevated plasma porphyrin, or any combination thereof. In some embodiments, compared to reference values. In some embodiments, after administration of the composition, the levels of plasma and / or urinary bilirubinogen (PBG), plasma and / or urinary aminolevulinic acid (ALA), urinary porphyrin, fecal porphyrin, plasma porphyrin, or any combination thereof in the subject are reduced. In some embodiments, after administration of the composition, the level of ALAS1 mRNA in the subject's urine is reduced; and said reduction is relative to (a) the ALAS1 mRNA level of the subject before administration of the composition; (b) the ALAS1 mRNA level in one or more untreated subjects; and / or (c) a reference level of ALAS1 mRNA in healthy subjects. In some embodiments, the subject has or is suspected of having a mutation in at least one gene selected from the group consisting of: ALAS2, ALAD, HMBS, UROD, UROS, CPOX, PPOX, and FECH. In some embodiments, the mutation results in reduced expression, stability, and / or activity of the RNA and / or protein product of at least one gene. Brief description of the attached diagram

[0022] Figure 1 Non-limiting exemplary data depicting the editing efficiency of gRNA containing the shown spacer region sequence in Huh7-Cas9 human hepatocellular carcinoma cells are shown.

[0023] Figure 2 Non-limiting exemplary data depicting the editing efficiency of gRNA containing the shown spacer region sequence in LLC-MK2 rhesus monkey kidney cells are shown.

[0024] Figure 3 Non-limiting exemplary data depicting the editing efficiency of gRNA containing the shown spacer region sequence in AML12-Cas9 mouse hepatocytes are shown.

[0025] Figure 4 Non-limiting exemplary data depicting the editing efficiency of gRNA containing the illustrated spacer region sequence in human hepatocytes from two donors are shown.

[0026] Figure 5 Non-limiting exemplary data depicting the editing efficiency of gRNAs containing the illustrated spacer region sequences in mouse livers are shown. As used herein, “mpk” represents milligrams per kilogram (mg / kg) of LNP per mouse body weight.

[0027] Figure 6 Non-limiting exemplary data are shown depicting the editing efficiency of gRNA containing the xhALAS1_E5_G5 (SEQ ID NO: 30) spacer region sequence in primary human hepatocytes.

[0028] Figure 7 A non-restrictive diagram showing the therapeutic principle for treating acute intermittent porphyria is displayed.

[0029] Figure 8 Non-limiting exemplary data relating to the activity of the gRNA of this disclosure are shown. The percentage of ALAS1 edited in the livers of individual NHPs who were administered the shown gRNA is shown.

[0030] Figures 9A-9B Non-limiting exemplary data and protein dose curves related to ALAS1 editing in human and NHP hepatocytes treated with LNP formulated with Cas9 mRNA and xhALAS1_E5_G5 (SEQ ID NO: 30) are shown. Figure 9A The data is shown from human liver cells. Figure 9B Data from NHP hepatocytes are shown. Protein levels are expressed as relative expression between treated and untreated samples. Detailed Explanation

[0031] The following detailed description incorporates reference to the accompanying drawings, which form part of this document. In the drawings, like reference numerals generally identify like components unless the context otherwise indicates. The illustrative embodiments described in the detailed description, drawings, and claims are not intended to be limiting. Other embodiments may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that aspects of this disclosure as generally described herein and illustrated in the drawings can be arranged, substituted, combined, separated, and designed in a variety of different configurations, all of which are expressly contemplated herein and form part of this disclosure.

[0032] All patents, published patent applications, other publications, and sequences from GenBank and other databases mentioned in this article concerning the relevant technology are incorporated herein by reference in their entirety.

[0033] The disclosure herein includes a guide RNA (gRNA) for targeting the 5'-aminolevulinic acid synthase 1 (ALAS1) genomic locus. In some embodiments, the gRNA comprises a spacer sequence comprising any one of the sequences in SEQ ID NO: 25-48 and 83-112.

[0034] The disclosure herein includes compositions. In some embodiments, the composition comprises (a) any gRNA or polynucleotide encoding said gRNA disclosed herein, and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease.

[0035] In some embodiments, the composition comprises: (a) a gRNA targeting the ALAS1 genomic locus, said gRNA comprising a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112, or a nucleic acid encoding said gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease.

[0036] The disclosure herein includes methods for treating diseases or conditions caused by ALAS1 overexpression in subjects with appropriate need. In some embodiments, the method includes administering any of the compositions disclosed herein to a subject to treat the disease or condition caused by ALAS1 overexpression in the subject.

[0037] The disclosure herein includes methods for treating subjects who have or are suspected of having porphyria. In some embodiments, the method includes administering any of the compositions disclosed herein to the subject to treat porphyria.

[0038] This disclosure includes methods for treating diseases or conditions caused by ALAS1 overexpression in subjects with appropriate need. In some embodiments, the methods include administering to the subject a composition comprising more than one nanoparticle compounded with: (a) a gRNA targeting an ALAS1 genomic locus or a nucleic acid encoding said gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease, thereby treating the disease or condition caused by ALAS1 overexpression in the subject. This disclosure includes methods for treating diseases or conditions caused by ALAS1 overexpression in subjects with appropriate need. In some embodiments, the method includes administering to the subject a composition comprising more than one nanoparticle compounded with: (a) a gRNA targeting an ALAS1 genomic locus, the gRNA comprising a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112, or a nucleic acid encoding the gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease, thereby treating a disease or condition in the subject caused by ALAS1 overexpression.

[0039] This disclosure includes methods for treating a subject with or suspected of having porphyria. In some embodiments, the method includes administering to the subject a composition comprising more than one nanoparticle compounded with: (a) a gRNA targeting the ALAS1 genomic locus or a nucleic acid encoding said gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease, thereby treating porphyria. This disclosure includes methods for treating a subject with or suspected of having porphyria. In some embodiments, the method includes administering to the subject a composition comprising more than one nanoparticle compounded with: (a) a guide RNA (gRNA) targeting the ALAS1 genomic locus, said gRNA comprising a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112, or a nucleic acid encoding said gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease, thereby treating porphyria.

[0040] definition Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. See, for example, Singleton et al., Dictionary of Microbiology and Molecular Biology, 2nd edition, J. Wiley & Sons (New York, NY 1994); Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press (Cold Spring Harbor, NY 1989). For the purposes of this disclosure, the following terms are defined below.

[0041] As used in this article, the term “about” can mean a value provided plus or minus 5%.

[0042] As used herein, the term "RNA-directed endonuclease" refers to a polypeptide capable of binding RNA (e.g., gRNA) to form a complex that targets a specific DNA sequence (e.g., a specific DNA sequence within a target DNA). Non-limiting examples of RNA-directed endonucleases are Cas polypeptides (e.g., Cas endonucleases, such as Cas9 endonucleases). In some embodiments, RNA-directed endonucleases as described herein target specific DNA sequences within a target DNA via the RNA molecule they bind. The RNA molecule may include a sequence complementary to and capable of hybridizing with a specific sequence within the target DNA, thereby allowing the bound polypeptide to be targeted to a specific location within the target DNA.

[0043] As used herein, the terms “guide RNA” or “gRNA” can refer to site-specific target RNA that binds to an RNA-guided endonuclease to form a complex and directs the activity of the bound RNA-guided endonuclease (such as Cas endonuclease) to a specific sequence within a target nucleic acid (e.g., a specific gene or a region within a gene). Guide RNA may include one or more RNA molecules.

[0044] As used in this article, the “secondary structure” of a nucleic acid molecule (e.g., an RNA fragment or gRNA) refers to the base-pairing interactions within the nucleic acid molecule.

[0045] As used herein, the term "Cas endonuclease" or "Cas nuclease" refers to an RNA-directed DNA endonuclease that is associated with and / or derived from the CRISPR adaptive immune system.

[0046] Unless otherwise indicated, “nuclease” and “endonuclease” are used interchangeably in this document and refer to enzymes that have catalytic activity for the endonucleolysis of polynucleotides.

[0047] The terms “polynucleotide” and “nucleic acid” are used interchangeably herein and refer to polymers of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Polynucleotides can be single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids / triple helices, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases.

[0048] As used herein, the term "binding" refers to a non-covalent interaction between macromolecules (e.g., between proteins and nucleic acids). When macromolecules are in a non-covalent interaction state, they are referred to as "associated," "interacting," or "bound" (e.g., when molecule X is said to interact with molecule Y, this means that molecule X binds to molecule Y in a non-covalent manner). Binding interactions can be characterized by a dissociation constant (Kd), such as the following Kd or less: 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 M, 10 -12 M, 10 -13 M, 10 -14 M, 10 -15 M is a number or range between any two of these values. Kd can depend on environmental conditions such as pH and temperature. "Affinity" refers to the strength of binding, and increased binding affinity is associated with lower Kd.

[0049] As used herein, the term "hybridizing" or "hybridize" refers to the pairing of substantially complementary or complementary nucleic acid sequences within two different molecules. Pairing can be achieved by any process in which a nucleic acid sequence joins with a substantially complementary or fully complementary sequence through base pairing to form a hybridization complex. "Hybridizing" or "hybridize" can include denaturing the molecule to disrupt one or more intramolecular structures (e.g., one or more secondary structures) within the molecule. In some embodiments, denaturing the molecule involves heating the solution containing the molecule to a temperature sufficient to disrupt the intramolecular structure of the molecule. In some cases, denaturing the molecule involves adjusting the pH of the solution containing the molecule to a pH sufficient to disrupt the intramolecular structure of the molecule. For hybridization purposes, two nucleic acid sequences or sequence segments are "substantially complementary" if at least 80% of their individual bases are complementary to each other. In some embodiments, the splice oligonucleotide sequence is no more than about 50% identical to one of two polynucleotides (e.g., RNA fragments) designed to be complementary to it. The complementary parts of each sequence may be referred to as “segments” in this paper, and segments are substantially complementary if they have 80% or more identity.

[0050] The terms “complementarity” and “complementary” mean that a nucleic acid can form hydrogen bonds with another nucleic acid based on the conventional Watson-Crick base pairing rules, i.e., adenine (A) pairs with thymine (T, or uracil (U) in RNA), and guanine (G) pairs with cytosine (C). Complementarity can be perfect (e.g., complete complementarity) or imperfect (e.g., partial complementarity). Perfect or complete complementarity means that every and all nucleic acid bases in one strand are capable of forming hydrogen bonds with corresponding bases in another antiparallel nucleic acid sequence according to the Watson-Crick standard base pairing. Partial complementarity means that only a certain percentage of consecutive residues in one nucleic acid sequence can form Watson-Crick base pairs with the same number of consecutive residues in another antiparallel nucleic acid sequence. In some embodiments, complementarity can be at least 70%, 80%, 90%, 100%, or any number or range between these values. In some embodiments, complementarity is perfect, i.e., 100%. For example, if a complementary candidate sequence segment is completely complementary to a candidate sequence segment, the sequence of the complementary candidate sequence segment can be derived from the candidate sequence segment using the Watson-Crick base pairing rules.

[0051] As used herein, the terms “nucleic acid” and “polynucleotide” are interchangeable and refer to any nucleic acid, whether including phosphodiester bonds or modified bonds such as triphosphates, phosphoramides, siloxanes, carbonates, carboxymethyl esters, acetamides, carbamates, thioethers, bridged phosphoramides, bridged methylene phosphonates, bridged phosphoramides, bridged phosphoramides, bridged methylene phosphonates, thiophosphates, methylphosphonates, dithiophosphates, bridged thiophosphates, or sultone bonds, and combinations of such bonds. The terms “nucleic acid” and “polynucleotide” also specifically include nucleic acids composed of bases other than those found in the five biologically present bases (adenine, guanine, thymine, cytosine, and uracil).

[0052] The terms “DNA editing efficiency” or “editing efficiency” are used interchangeably herein and can refer to the number or proportion of the intended target sequence that is edited. For example, if a CRISPR-Cas9 system edits 10% of the intended target sequence (e.g., within a cell or cell population), the system can be described as 10% efficient. In some embodiments, efficiency can be reported as % insertion / deletion, such as the proportion of insertions and / or deletions detected in the target sequence. Insertion / deletion (e.g., insertion-deletion) can be repaired by methods including, but not limited to, non-homologous end joining (NHEJ) repair of double-stranded DNA breaks caused by Cas9 cleavage.

[0053] As used herein, the term “off-target editing frequency” refers to the number or proportion of unintended DNA sequences that are edited. Target and off-target editing frequencies can be measured using the methods and assays described herein, further taking into account techniques known in the art, including high-throughput sequencing reads. As used herein, high-throughput sequencing involves hybridization with nucleic acid primers (e.g., DNA primers) that are complementary to nucleic acid (e.g., DNA) regions that are just upstream or downstream of the target or off-target sequence of interest. Because many Cas9-dependent off-target sites have high sequence identity with the target site of interest, nucleic acid primers that are sufficiently complementary to regions upstream or downstream of Cas9-dependent off-target sites can be designed using techniques and kits known in the art. These kits utilize polymerase chain reaction (PCR) amplification, which produces amplicons as intermediate products. Target and off-target sequences may contain genomic loci that also include prototype spacer regions and PAMs. Therefore, as used herein, the term “amplifier” can refer to a nucleic acid molecule that constitutes an aggregate of genomic loci, prototype spacer regions, and PAMs. The high-throughput sequencing technologies used herein may also include Sanger sequencing and / or whole-genome sequencing (WGS).

[0054] As used herein, the terms “transfection” or “infection” refer to the introduction of nucleic acids into host cells, for example by contacting the cells with liposomes or nanoparticles (e.g., lipid nanoparticles) as described herein.

[0055] As used herein, “treatment” means a clinical intervention in response to a disease, condition, or physical condition that a patient presents with or is susceptible to. The aim of treatment includes, but is not limited to, reducing or preventing symptoms, slowing or stopping the progression or worsening of a disease, condition, or physical condition, and / or alleviating a disease, condition, or physical condition. “Treatment” refers to one or both of therapeutic treatment and prophylactic or preventive measures. Subjects requiring treatment include those already affected by a disease, condition, or undesirable physical condition, as well as those with a disease, condition, or undesirable physical condition to be prevented from developing.

[0056] As used herein, the terms “effective amount” or “pharmaceutical effective amount” or “therapeutic effective amount” mean an amount sufficient to produce beneficial or desirable biological and / or clinical outcomes.

[0057] As used herein, the term "pharmaceuticalally acceptable excipient" means any suitable substance that provides a pharmaceutically acceptable carrier, additive, or diluent for administration to a subject of a compound of interest. Pharmaceutically acceptable excipients may include substances referred to as pharmaceutically acceptable diluents, pharmaceutically acceptable additives, and pharmaceutically acceptable carriers.

[0058] As used herein, “subject” refers to an animal requiring diagnosis, treatment, or therapy. In some embodiments, the subject is a mammal. As used herein, “mammal” means an individual belonging to the class Mammalia and includes, but is not limited to, humans, livestock and farm animals, zoo animals, sporting animals, and pets. Non-limiting examples of mammals include mice; rats; rabbits; guinea pigs; dogs; cats; sheep; goats; cattle; horses; primates such as monkeys, chimpanzees, and apes, and particularly humans. In some embodiments, the mammal is a primate. In some embodiments, the mammal is a human. In some embodiments, the mammal is not a human. In some embodiments, the subject has or is suspected of having an ALAS1-related disease or condition.

[0059] 5'-Aminolevulinic acid synthase 1 (ALAS1) and heme biosynthesis 5'-Aminolevulinic acid synthase 1 (ALAS1) is a nuclear-encoded mitochondrial protein that catalyzes the first step in heme biosynthesis. ALAS1 functions primarily in the liver, where heme is essential for the synthesis of enzymes such as P450. Its paralog, ALAS2, is primarily active in the bone marrow. ALAS enzymes (e.g., ALAS1) catalyze the condensation of glycine with succinyl-CoA to form δ-aminolevulinic acid (ALA). The first step in heme biosynthesis is the rate-limiting step in the hepatic pathway. In some embodiments, ALAS1 levels are regulated via negative feedback, where heme negatively regulates ALAS1 expression and / or activity.

[0060] The subsequent steps in heme biosynthesis are summarized below. Starting with ALA, the enzyme ALA-dehydratase (ALAD) catalyzes the condensation of two ALA molecules to form bile pigmentogen (PBG). Next, bile pigmentogen deaminase (PBGD) activity converts four PBG molecules into hydroxymethylbilane (HMB). Uroporphyrinogen III synthase (UROS or UROIIIS) catalyzes the formation of uroporphyrinogen III from HMB. Uroporphyrinogen decarboxylase (UROD) catalyzes the removal of four carboxyl groups from the carboxymethyl side chain of uroporphyrinogen, producing coproporphyrinogen. Coproporphyrinogen oxidase (CPO or CPOX) and protoporphyrinogen oxidase (PPO or PPOX) convert coproporphyrinogen into protoporphyrinogen IX, and then into protoporphyrin IX. In the final step, iron is inserted into protoporphyrin IX to form heme; this reaction is catalyzed by iron chelate enzyme (FECH). In some implementations, each product of these reactions may be referred to as a "porphyrin".

[0061] As mentioned above, the ALAS1 enzyme is the rate-limiting step in the heme biosynthesis pathway, and overexpression of ALAS1, such as in subjects with mutations in other enzymes in the pathway, can lead to diseases or conditions like porphyria. Mouse studies have found that the ubiquitously expressed isoenzyme ALAS1 plays an indispensable role in early mouse embryogenesis. ALAS1-ineffective embryos are lethal at day 8.5 (E8.5). However, significant abnormalities were not observed in heterozygous knockout animals (A1+ / - mice) until 20 weeks of age. In some embodiments, heterozygous mice exhibit a prediabetic phenotype under normal feeding conditions and also present with glucose intolerance and insulin resistance in an age-dependent manner (as opposed to a pronounced diabetic phenotype), as well as abnormalities in skeletal muscle mitochondria. Notably, dietary administration of ALA was found to reverse insulin resistance and glucose intolerance in older A1+ / - mice. Compared with aged wild-type (WT) mice, no significant reduction in total heme levels was observed in the cytoplasmic or mitochondrial portions of skeletal muscle from aged A1+ / - mice, but a reduction in the regulatory “free heme” pool was observed. Unlike ALAS2, there are no reports of human diseases directly caused by ALAS1 mutations.

[0062] Depending on whether porphyria primarily affects the nervous system or the skin, there are two main types: acute (hepatic) porphyria or cutaneous porphyria. In acute hepatic porphyria, four types affect the nervous system. Two of these types also affect the skin. Symptoms of acute porphyria (e.g., attacks) can develop over hours or days and last for days or weeks. There are at least four types of acute porphyria that can be caused by the accumulation of porphyrins in, for example, the liver. Acute intermittent porphyria (AIP) affects the nervous system, variable porphyria (VP) affects both the nervous system and the skin, hereditary coprophyria (HCP) affects both the nervous system and the skin, and δ-aminolevulinic acid (ALA) dehydratase deficiency porphyria (ALAD) affects the nervous system. The four types of cutaneous porphyria affect only the skin and cause chronic or long-term symptoms. People with cutaneous porphyria may experience skin symptoms such as blistering or pain after sun exposure. In porphyria cutanea tardivea (PCT), porphyrins can accumulate in the liver. In congenital erythropoiesis (CEP), porphyrins can accumulate in the bone marrow. In hepatoerythropoietic porphyria (HEP), porphyrins can accumulate in the liver. In erythropoietic protoporphyria and X-linked porphyria (EP / XLP), porphyrins can accumulate in the bone marrow. In some implementations, the onset of symptoms occurs after childhood, e.g., between 12 and 65 years of age.

[0063] Acute intermittent porphyria (AIP) is the most common type of acute porphyria, affecting 5–10 individuals per 100,000. In the United States, 1 in 1,675 people carry the AIP genetic mutation. This disease is caused by a deficiency of bilochromegen deaminase (also known as hydroxymethylcholine synthase, HMBS) at q23.3 on chromosome 11. Variant porphyria (VP) is caused by a mutation in the PPOX gene (at q22–23 on chromosome 1), resulting in a deficiency of protoporphyrinogen oxidase. Hereditary coprophyria (HCP) is caused by a mutation in the CPOX gene (at q11.2 on chromosome 3), resulting in a deficiency of coprophyrinogen oxidase. The above diseases and mutations are usually autosomal dominant mutations, meaning that only one copy of the mutated gene is required to cause the disease. The least common type, ALA-dehydratase deficiency porphyria (ALAD), is caused by a recessive mutation (meaning both copies of the gene must be mutated). Mutations in the ALAD gene (at q34 on chromosome 9) result in a deficiency of aminolevulinic acid dehydratase.

[0064] AIP is caused by a mutation in the hydroxymethylcholine synthase gene (HMBS), which encodes the third enzyme in the heme biosynthesis pathway. Loss of functional HMBS prevents the breakdown of ALA and PBG, which are toxic to the liver and other organs. Knocking out ALAS1, the first enzyme in this pathway, reduces ALA and PBG levels, which can prevent future attacks and chronic symptoms. Figure 7 The prevalence of AIP (HMBS- / +) in the general population is estimated at 1:1,600, with a penetrance of approximately 2%–3% (or 10%–20%, NIH 2023). New data on the AIP family suggest a lower penetrance due to ambiguous symptoms / misdiagnosis / missed diagnosis. The penetrance in these studies is actually 20%–40% (based on symptom diagnosis in questionnaires). More patients develop symptoms when they believe they have no clinical manifestations. Absorption of prior therapies (e.g., siRNA) is hampered by adverse reactions, such as elevated liver function tests (LFT) in >15% of patients (transient, but with monthly dosing), and failure to produce improvement in diagnosis.

[0065] Unbound by any particular theory, diseases such as porphyria are caused by the accumulation of precursor molecules (e.g., porphyrins) in the heme biosynthesis pathway, which may be toxic. Alcohol use, drugs, stress, hormonal changes, and other factors can lead to attacks or flare-ups of, for example, "acute porphyria." Acute porphyria can be characterized by a variety of symptoms, including but not limited to neurological symptoms such as abdominal and / or chest pain, muscle weakness, autonomic neuropathy (e.g., hypertension, tachycardia, nausea, vomiting, and constipation), and altered mental status, as well as skin symptoms. Non-acute (or cutaneous) porphyria primarily affects the skin. Both acute and cutaneous porphyria can cause, for example, photosensitivity, blisters, and painful redness and swelling of the skin. Although porphyria attacks can be treated with, for example, heme chloride, long-term and / or preventative and more effective therapies and treatments are needed for diseases caused by ALAS1 overexpression.

[0066] Gene editing This document provides methods, compositions, and kits for editing the ALAS1 gene to reduce the expression level of the ALAS1 protein (e.g., the concentration of ALAS1 protein in the liver of a subject). Gene editing (including genome editing) is a type of genetic engineering in which one or more nucleotides / nucleic acids are inserted, deleted, and / or substituted in a DNA sequence (such as in the genome of a target cell). Targeted gene editing enables insertion, deletion, and / or substitution at pre-selected sites in the genome of a target cell (e.g., in the targeted gene or the targeted DNA sequence). When the sequence of an endogenous gene is edited, for example by deletion, insertion, or substitution of one or more nucleotides / nucleic acids, the endogenous gene containing the affected sequence can be knocked out or knocked down due to the sequence alteration. Therefore, targeted editing can be used to disrupt the expression of endogenous genes. “Targeted integration” refers to a process involving the insertion of one or more exogenous sequences, with or without the deletion of the endogenous sequence at the insertion site. Targeted integration can be generated by targeted gene editing when a donor template containing the exogenous sequence is available.

[0067] Targeted editing can be achieved through nuclease-independent or nuclease-dependent methods. In nuclease-independent targeted editing, homologous recombination is guided by homologous sequences flanking exogenous polynucleotides to introduce endogenous sequences via enzymatic mechanisms of the host cell. Exogenous polynucleotides can introduce nucleotide deletions, insertions, or substitutions into the endogenous sequence.

[0068] Alternatively, nuclease-dependent methods can achieve targeted editing at a higher frequency by specifically introducing double-strand breaks (DSBs) using rare cleaving nucleases (e.g., endonucleases). Such nuclease-dependent targeted editing also utilizes DNA repair mechanisms, such as non-homologous end joining (NHEJ) in response to DSBs. DNA repair via NHEJ typically results in the random insertion or deletion of a small number of endogenous nucleotides (indels). Repair can also occur via homology-directed repair (HDR) in contrast to NHEJ-mediated repair. When a donor template containing exogenous genetic material flanked by a pair of homologous arms is present, exogenous genetic material can be introduced into the genome via HDR, leading to targeted integration of the exogenous genetic material.

[0069] Available endonucleases capable of introducing specific and targeted DSBs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-directed CRISPR-Cas9 nucleases (CRISPR / Cas9; clustered regularly spaced short palindromic repeats related to Cas9). Additionally, the DICE (Dual Integrase Box Exchange) system utilizing phiC31 and Bxb1 integrases can also be used for targeted integration.

[0070] ZFNs are targeted nucleases comprising a nuclease fused to a zinc finger DNA-binding domain (ZFBD), which is a polypeptide domain that binds to DNA in a sequence-specific manner via one or more zinc fingers. A zinc finger is a domain of approximately 30 amino acids within the zinc finger-binding domain, whose structure is stabilized by coordination with zinc ions. Examples of zinc fingers include, but are not limited to, C2H2, C3H, and C4 zinc fingers. The designed zinc finger domains are domains not found in nature, and their design / composition is primarily derived from rational criteria, such as applying substitution rules and computerized algorithms to process information in databases storing existing ZFP designs and binding data. See, for example, U.S. Patents 6,140,081; 6,453,242; and 6,534,261; WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO03 / 016496, the contents of which are incorporated herein by reference in their entirety. The selected zinc finger domains are domains not found in nature and are generated primarily through empirical processes such as phage display, interaction trapping, or hybridization selection. ZFNs are described in more detail in U.S. Patents 7,888,121 and 7,972,854. The most widely accepted example of a ZFN is a fusion of the FokI nuclease with a zinc finger DNA-binding domain.

[0071] TALEN is a targeted nuclease comprising a nuclease fused to a TAL effector DNA-binding domain. A “transcription activator-like effector DNA-binding domain,” “TAL effector DNA-binding domain,” or “TALEDNA-binding domain” is a polypeptide domain of a TAL effector protein responsible for binding the TAL effector protein to DNA. TAL effector proteins are secreted by plant pathogens of the genus *Xanthomonas* during infection. These proteins enter the nucleus of plant cells, bind effector-specific DNA sequences via their DNA-binding domains, and activate gene transcription of these sequences via their transactivation domains. The specificity of the TAL effector DNA-binding domain depends on the effector-variable number of imperfect 34 amino acid repeats, which contain polymorphisms at selected repeat positions called variable double residues (RVDs). TALEN is described in more detail in US2011 / 0145940. The most widely accepted example of TALEN in this field is a fusion peptide of the FokI nuclease and the DNA-binding domain of the TAL effector.

[0072] Other examples of targeting nucleases suitable for the uses described herein include, but are not limited to, Bxb1, phiC31, R4, PhiBT1, and Wb / SPBc / TP901-1, whether used alone or in combination. Other non-limiting examples of targeting nucleases include naturally occurring and recombinant nucleases such as CRISPR / Cas9, restriction endonucleases, meganucleases, homing endonucleases, etc.

[0073] CRISPR-Cas gene editing system and RNA-guided nucleases In some embodiments, the vectors, compositions, methods, and kits described herein can be used in gene editing systems, such as the CRISPR-Cas gene editing system, to genetically edit the ALAS1 gene. For example, the CRISPR-Cas9 system, a naturally occurring defense mechanism in prokaryotes, has been repurposed as an RNA-guided DNA targeting platform for gene editing. It relies on the DNA nuclease Cas9 and two non-coding RNAs: crprRNA (crRNA) and trans-activating RNA (tracrRNA) to target DNA cleavage. The crRNA drives sequence recognition and specificity of the CRISPR-Cas9 complex by typically pairing with Watson-Crick bases in a 20-nucleotide (nt) sequence in the target DNA. If the target sequence is followed by a specific short DNA motif (with, for example, the sequence NGG) called the protospacer adjacent motif, the CRISPR-Cas9 complex binds only to DNA sequences containing sequences that match the first 20 nt of the crRNA, the single guide RNA (sgRNA). The tracrRNA hybridizes with the 3' end of the crRNA to form an RNA double-stranded structure. This structure is bound by the Cas9 endonuclease to form a catalytically active CRISPR-Cas9 complex, which can then cleave the target DNA. After the CRISPR-Cas9 complex binds to DNA at the target site, each of the two independent nuclease domains within the Cas9 enzyme cleaves one strand of the DNA upstream of the PAM site, leaving a double-strand break (DSB), where the two strands of DNA terminate at a base pair (blunt ends). After the CRISPR-Cas9 complex binds to DNA at a specific target site and forms a site-specific DSB, the next crucial step is the repair of the DSB. Cells use two main DNA repair pathways to repair DSBs: non-homologous end joining (NHEJ) and homologous directed repair (HDR). In some implementations, the CRISPR-Cas9 gene editing system comprises an RNA-guided nuclease and one or more guide RNAs targeting one or more target genes.

[0074] As described in this article, RNA-directed endonucleases can be either naturally occurring or non-natural. Non-restricted examples of RNA-directed endonucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cpf1 endonucleases and their functional derivatives. In some embodiments, the RNA-directed endonuclease is a Cas9 endonuclease. Cas9 endonucleases can be derived from, for example, *Streptococcus pyogenes* (SpCas9 or SpyCas9), *Staphylococcus lugdunensis* (SluCas9), or *Staphylococcus aureus* (SaCas9). In some embodiments, the RNA-directed endonuclease is a variant of Cas9, including but not limited to small Cas9, dead Cas9 (dCas9), and Cas9 cleavage enzymes. In some embodiments, the Cas nuclease may contain a RuvC or RuvC-like nuclease domain (e.g., Cpf1) and / or an HNH or HNH-like nuclease domain (e.g., Cas9). In some embodiments, the Cas9 endonuclease is *Streptococcus pyogenes* Cas9, *Staphylococcus aureus* Cas9, *Neisseria meningitidis* Cas9, *Streptococcus thermophilus* Cas9, *Streptococcus thermophilus* 3 Cas9, *Treponema denticulatum* Cas9, or a variant thereof.

[0075] RNA-directed endonucleases can be small RNA-directed endonucleases. Small RNA-directed endonucleases can be partially engineered from any RNA-directed endonuclease derived from those described herein and known in the art. Small RNA-directed endonucleases can be, for example, small Cas endonucleases. In some cases, small RNA-directed endonucleases are shorter than about 1,100 amino acids.

[0076] RNA-guided endonucleases can be mutant RNA-guided endonucleases. For example, an RNA-guided endonuclease can be a mutant of a naturally occurring RNA-guided endonuclease. Mutant RNA-guided endonucleases can also be mutant RNA-guided endonucleases with altered activities compared to naturally occurring RNA-guided endonucleases, such as altered endonuclease activity (e.g., altered or eliminated DNA endonuclease activity without substantially reduced DNA binding affinity). Such modifications can allow sequence-specific DNA targeting of the mutant RNA-guided endonuclease for purposes such as transcriptional regulation (e.g., activation or repression); epigenetic or chromatin modifications via methylation, demethylation, acetylation, or deacetylation, or any other modifications to DNA-binding and / or DNA-modifying proteins known in the art. In some embodiments, the mutant RNA-guided endonuclease does not possess DNA endonuclease activity.

[0077] RNA-directed endonucleases can be either cleavage enzymes that cleave the complementary strand of the target DNA but have a reduced ability to cleave the non-complementary strand of the target DNA, or cleavage enzymes that cleave the non-complementary strand of the target DNA but have a reduced ability to cleave the complementary strand of the target DNA. In some embodiments, RNA-directed endonucleases have the ability to reduce the cleavage of both the complementary and non-complementary strands of the target DNA.

[0078] In some embodiments, nucleic acids encoding RNA-directed endonucleases are administered to the subject. In some embodiments, the nucleic acids can be produced via an in vitro transcription reaction. In some embodiments, producing RNA for in vitro transcription involves incubating a linear DNA template with a mixture of RNA polymerase and nucleotides under conditions that allow (run-off) RNA in vitro transcription. The nucleotide mixture may be part of an in vitro transcription mixture (IVT-mix). In some embodiments, the RNA polymerase is a T7 RNA polymerase.

[0079] Nucleotide mixtures used for in vitro transcription of RNA may additionally contain modified nucleotides as defined below. In some embodiments, the nucleotide mixture used for in vitro transcription of RNA (e.g., the proportion of each nucleotide in the mixture) (optimized NTP mixture) can be optimized for a given RNA sequence. Such methods are described, for example, in WO2015 / 188933. In some embodiments, RNA obtained using the method of using an optimized NTP mixture is characterized by reduced immunostimulatory properties.

[0080] In some embodiments, the nucleotide mixture comprises (chemically) unmodified ribonucleoside triphosphates (NTPs) GTP, ATP, CTP, and UTP. In some embodiments, in vitro transcription may include the presence of at least one cap analog, such as a cap1 (cap1) trinucleotide cap analog, m7G(5')ppp(5')(2'OMeA)pG or m7G(5')ppp(5')(2'OMeG)pG, m7G(5')ppp(5')(2'OMeA)pG or rn7(3'OMeG)(5')ppp(5')(2'OMeA)pG. In some embodiments, a 5'-cap structure is formed by enzymatic capping using a capping enzyme (e.g., vaccinia virus capping enzyme and / or cap-dependent 2'-O-methyltransferase) to produce a cap0, cap1, or cap2 structure. The methods and techniques disclosed in WO2016 / 193226 can also be used to add a 5'-cap structure (cap 0 or cap 1) using a fixed capping enzyme and / or a cap-dependent 2'-O-methyltransferase. In some embodiments, at least one (ribo)nucleoside triphosphate is partially or completely replaced by a modified nucleoside triphosphate. In some embodiments, the modified nucleoside triphosphate includes pseudouridine (ψ), N1-methylpseudouridine (m1ψ), 5-methylcytosine, or 5-methoxyuridine. In some embodiments, uracil nucleotides in the nucleotide mixture are replaced (partially or completely) with pseudouridine (ψ) and / or N1-methylpseudouridine (m1ψ) to obtain modified RNA. In some embodiments, the chemically modified nucleotide is pseudouridine (ψ). In some embodiments, the chemically modified nucleotide is N1-methylpseudouridine (m1ψ). In some embodiments, the nucleotide mixture contains at least one modified nucleotide and / or at least one nucleotide analog or nucleotide derivative for incorporation into RNA. For example, a modified nucleotide as defined herein may include nucleotide analogs / modifications, such as backbone modifications, sugar modifications, or base modifications. Backbone modifications may include modifications in which the phosphate group of the nucleotide backbone is chemically modified. Sugar modifications may include chemical modifications of the sugar group of the nucleotide. Furthermore, base modifications may include chemical modifications of the base portion of the nucleotide. In this context, nucleotide analogs or modifications may include nucleotide analogs suitable for transcription and / or translation. In some embodiments, the nucleotide mixture comprises at least one modified nucleotide and / or at least one nucleotide analog selected from backbone-modified nucleotides, sugar-modified nucleotides, and / or base-modified nucleotides, or any combination thereof.

[0081] Modified nucleosides and nucleotides that can be included in nucleotide mixtures and incorporated into RNA can be modified at the sugar moiety. For example, the 2' hydroxyl group (OH) can be modified or substituted by many different "oxygen" or "deoxygen" substituents. Examples of "oxygen"-2' hydroxyl group modifications include, but are not limited to, alkoxy or aryloxy groups (-OR, e.g., R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), -O(CH2CH2)nCH2CH2OR; "locked" nucleic acids (LNAs) in which the 2' hydroxyl group is, for example, connected to the 4' carbon of the same ribose via a methylene bridge; and amino groups (-O-amino, where the amino group can be alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino) or aminoalkoxy groups. "Deoxy" modifications include hydrogen, amino groups (e.g., NH₂, alkylamino, dialkylamino, heterocyclic, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acids); or the amino group may be attached to a sugar via a linker containing one or more of the atoms C, N, and O. The sugar group may also contain one or more carbons with a stereochemical configuration opposite to the corresponding carbon in ribose. Therefore, modified RNA molecules may include nucleotides containing, for example, arabinose as a sugar.

[0082] The phosphate backbone can be further modified in the modified nucleosides and nucleotides, which can be included in the nucleotide mixture and incorporated into the modified in vitro transcribed RNA. The phosphate groups of the backbone can be modified by replacing one or more oxygen atoms with different substituents. Furthermore, the modified nucleosides and nucleotides can include the complete replacement of the unmodified phosphate moiety with a modified phosphate group as described herein. Examples of modified phosphate groups include, but are not limited to, thiophosphates, phosphoroselenates, borano phosphates, boranophosphate esters, hydrophosphonates, aminophosphates, alkyl or aryl phosphonates, and phosphate triesters. In dithiophosphates, both unlinked oxygen atoms are replaced with sulfur. Phosphate linkers can also be modified by replacing the linking oxygen with nitrogen (bridged aminophosphates), sulfur (bridged thiophosphates), and carbon (bridged methylene-phosphonates).

[0083] Nucleotides as described herein can be modified at their nucleobase moieties. Examples of nucleobases present in RNA include, but are not limited to, adenine, guanine, cytosine, and uracil. For example, nucleosides and nucleotides described herein can be chemically modified at their major groove surfaces. In some embodiments, major groove chemical modifications include amino groups, thiol groups, alkyl groups, or halogen groups.

[0084] In some embodiments, the nucleotide analogs / modifications include 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine-riboside-5'-triphosphate; 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methyl-inosine-5'-triphosphate, 4-Thiouridine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodouridine-5'- - Triphosphate, 5-iodino-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazoadenosine-5'-triphosphate 7-Denitroguanosine-5'-triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, flavin-5'-triphosphate. Base-modified nucleotides can include 5-methylcytidine-5'-triphosphate, 7-dezoguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, pseudouridine-5'-triphosphate, pyridine-4-ketoribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyluridine, 1-carboxymethyl-pseudouridine, 5-propynyluridine, 1-propynyl-pseudouridine, 5-taurate methyluridine, 1-taurate methyl-pseudouridine, 5-Taurine methyl-2-thio-uridine, 1-Taurine methyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-denitro-pseudouridine, 2-thio-1-methyl-1-denitro-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidinePseudocytidine, 3-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudocytidine, pyrrolo-cytidine, pyrrolo-pseudocytidine, 2-thio-cytidine, 2-thio-5-methylcytidine, 4-thio-pseudocytidine, 4-thio-1-methyl-pseudocytidine, 4-thio-1-methyl-1-deazo-pseudocytidine, 1-methyl-1-deazo-pseudocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy- 5-Methyl-cytidine, 4-methoxy-pseudo-cytidine and 4-methoxy-1-methyl-pseudo-cytidine, 2-aminopurine, 2,6-diaminopurine, 7-deadenine, 7-deadenine-8-aza-adenine, 7-deadenine-2-aminopurine, 7-deadenine-8-aza-2-aminopurine, 7-deadenine-2,6-diaminopurine, 7-deadenine-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylamino Formicyl adenosine, N6,N6-dimethyl adenosine, 7-methyl adenosine, 2-methylthio-adenosine and 2-methoxy-adenosine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deazo-guanosine, 7-deazo-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deazo-guanosine, 6-thio-7-deazo-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl -6-Thio-guanosine and N2,N2-dimethyl-6-thio-guanosine, 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, 5'-O-(1-thiophosphate)-pseuuridine, 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseuuridine, 5,6-dihydrouridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, inosine, α-thio-guanosine,6-Methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deazo-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudo-iso-cytidine, 6-chloro-purine, N6-methyl-adenosine, α-thio-adenosine, 8-azido-adenosine, or 7-deazo-adenosine.

[0085] At least one modified nucleotide and / or at least one nucleotide analogue may include 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, 2'-O-methyladenosine, 2-methylthio-N6-methyladenosine, N6-isopentenyladenosine, 2-methylthio-N6-isopentenyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-methyl N6-Threonylcarbamoyl adenosine, N6-hydroxyn-valinecarbamoyl adenosine, 2-methylthio-N6-hydroxyn-valinecarbamoyl adenosine, inosine, 3-methylcytidine, 2-O-methylcytidine, 2-thiocytidine, N4-acetylcytidine, lysine, 1-methylguanosine, 7-methylguanosine, 2'-O-methylguanosine, piracetamidine, epoxypiracetamidine, 7-cyano-7-deazoguanosine, 7-Aminomethyl-7-denitroguanosine, pseudouridine, dihydrouridine, 5-methyluridine, 2'-O-methyluridine, 2-thiouridine, 4-thiouridine, 5-methyl-2-thiouridine, 3-(3-amino-3-carboxypropyl)uridine, 5'-hydroxyuridine, 5-methoxyuridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-aminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylaminomethyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-(isopenteneaminomethyl)uridine, 5-(isopenteneaminomethyl)-2-thiouridine or 5-(isopenteneaminomethyl)-2'-O-methyluridine.

[0086] In some embodiments, the chemical modification includes pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deazo-pseudouridine, 2-thio-1-methylpseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methylpseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, or 2'-O-methyluridine.

[0087] In some embodiments, 100% of the uracil in the coding sequence as defined herein may be chemically modified. In some embodiments, the chemical modification is at the 5' position of the uracil. In some embodiments, 100% of the uracil in the coding sequence (cds) of the RNA may be chemically modified, for example, at the 5' position of the uracil. In other embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the uracil nucleotides in the cds are chemically modified, for example, at the 5' position of the uracil nucleotides. Such modification can reduce stimulation of the innate immune system (after administration of RNA containing such modified nucleotides in vivo).

[0088] As used herein, the terms “cds”, “coding sequence”, or “coding region” will be recognized and understood by those skilled in the art, and may, for example, refer to a sequence of several nucleotide triplets that can be translated into a peptide or protein. The cds of RNA may contain at least one modified nucleotide, wherein the at least one modified nucleotide may be selected from pseudouridine (ψ), N1-methylpseudouridine (m1ψ), 5-methylcytosine, and 5-methoxyuridine.

[0089] As used herein, the term “modified nucleotide” or “chemically modified nucleotide” can refer to all potential natural and non-natural chemical modifications to the structural units of RNA (i.e., ribonucleotides A, G, C, and U).

[0090] In various embodiments, the nucleotide mixture in the in vitro transcription reaction contains a cap analog. Thus, in some embodiments, the cap analog is a cap 0, cap 1, cap 2, modified cap 0, or modified cap 1 analog, or cap 1 analog as described below.

[0091] As used herein, the terms "cap analogue" or "5'-cap structure" can refer to the 5' structure of RNA, particularly the guanine nucleotide located at the 5' end of RNA (e.g., mRNA). In some embodiments, the 5'-cap structure is linked to RNA via a 5'-5'-triphosphate bond. In some embodiments, "5'-cap structure" or "cap analogue" is not considered a "modified nucleotide" or "chemically modified nucleotide." Suitable 5'-cap structures include cap 0 (methylation of the first nucleobase, e.g., m7GpppN), cap 1 (further methylation of the ribose of the adjacent nucleotide of m7GpppN), cap 2 (further methylation of the ribose of the second nucleotide downstream of m7GpppN), cap 3 (further methylation of the ribose of the third nucleotide downstream of m7GpppN), cap 4 (further methylation of the ribose of the fourth nucleotide downstream of m7GpppN), ARCA (antisense reverse cap analogs), modARCA (e.g., phosphate thioester modARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deazo-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0092] 5'-cap (cap 0 or cap 1) structures can be formed using capping enzymes in chemical RNA synthesis or using cap analogs in in vitro RNA transcription (co-transcriptional capping). As used herein, the term "cap analog" can refer to a non-polymerizable dinucleotide or trinucleotide having a cap functional group, because when incorporated at the 5' end of RNA, said cap analog promotes RNA translation or localization and / or prevents RNA degradation. Non-polymerizable means that the cap analog will only be incorporated at the 5' end because it does not have a 5' triphosphate and therefore cannot be extended in the 3' direction by template-dependent polymerases (e.g., DNA-dependent RNA polymerase). Examples of cap analogs include m7GpppG, m7GpppA, m7GpppC; unmethylated cap analogs (e.g., GpppG); dimethylated cap analogs (e.g., m2,7GpppG), trimethylated cap analogs (e.g., m2,2,7GpppG), dimethylated symmetrical cap analogs (e.g., m7Gpppm7G), or antisense reverse cap analogs (e.g., ARCA; m7,2'OmeGpppG, m7,2'dGpppG, m7,3'OmeGpppG, m7,3'dGpppG and their tetraphosphate derivatives). Further cap analogs have previously been described, for example, in WO2008 / 016473, WO2008 / 157688, WO2009 / 149253, WO2011 / 015347 and WO2013 / 059475. Other suitable cap analogues in this context are described, for example, in WO2017 / 066793, WO2017 / 066781, WO2017 / 066791, WO2017 / 066789, WO2017 / 053297, WO2017 / 066782, WO2018 / 075827 and WO2017 / 066797, the disclosures relating to cap analogues of which are incorporated herein by reference.

[0093] In some embodiments, the cap 1 structure is generated using trinucleotide cap analogs disclosed in WO2017 / 053297, WO2017 / 066793, WO2017 / 066781, WO2017 / 066791, WO2017 / 066789, WO2017 / 066782, WO2018 / 075827, and WO2017 / 066797. For example, any cap analog derived from the structure disclosed in claims 1-5 of WO2017 / 053297 can be suitably used for co-transcriptionalization to generate the cap 1 structure. In some embodiments, any cap analog derived from the structure described in WO2018 / 075827 can be suitably used for co-transcriptionalization to generate the cap 1 structure. In some embodiments, the cap 1 analog is a cap 1 trinucleotide cap analog. In some embodiments, the cap 1 structure of in vitro transcribed RNA is formed using co-transcriptional capping with the trinucleotide cap analogs m7G(5')ppp(5')(2'OMeA)pG or m7G(5')ppp(5')(2'OMeG)pG. In some embodiments, the cap 1 analog is m7G(5')ppp(5')(2'OMeA)pG.

[0094] In some embodiments, the RNA (e.g., mRNA) comprises a 5'-cap structure, such as a cap 1 structure. In some embodiments, the 5' cap structure can improve the stability and / or expression of the mRNA. A cap 1 structure containing mRNA (generated via, for example, in vitro transcription) has several advantageous features, including increased translation efficiency and reduced stimulation of the innate immune system. In some embodiments, the in vitro transcribed RNA comprises at least one coding sequence encoding at least one peptide or protein. In some embodiments, the protein is an RNA-directed endonuclease. In some embodiments, the RNA-directed endonuclease is Cas9 or a derivative thereof.

[0095] This disclosure provides an optimized mRNA (“SpCas9mRNA”) encoding the Streptococcus pyogenes Cas9 endonuclease, and optionally includes chemically modified nucleotides therein, which, when administered in conjunction with one or more gRNAs, provides efficient genome editing of a target cell population. In some embodiments, this disclosure provides an mRNA comprising (i) a 5' untranslated region (UTR); (ii) an open reading frame (ORF) containing a nucleotide sequence encoding a site-directed endonuclease; and (iii) a 3' untranslated region (UTR). In some embodiments, the site-directed endonuclease is a Cas nuclease. In some embodiments, the Cas nuclease is a Cas9 polypeptide. In some embodiments, the Cas9 polypeptide is a Cas9 (SpCas9) polypeptide derived from Streptococcus pyogenes. In some embodiments, the ORF also contains one or more nucleotide sequences encoding a nuclear localization signal, such as the nucleotide sequences described herein. In some embodiments, the ORF comprises a nucleotide sequence encoding a site-directed endonuclease (such as the SpCas9 peptide) and at least one NLS, said NLS being a nucleoplasmic protein and / or an SV40 NLS. In some embodiments, the ORF comprises a nucleotide sequence encoding an N-terminal and / or C-terminal NLS operably linked to a site-directed endonuclease (such as the SpCas9 peptide). In some embodiments, the ORF comprises a nucleotide sequence encoding an N-terminal SV40 NLS operably linked to a site-directed endonuclease (such as the SpCas9 peptide) and a C-terminal nucleoplasmic protein NLS operably linked to a site-directed endonuclease (such as the SpCas9 peptide).

[0096] In some embodiments, this disclosure provides mRNA comprising at least 85% or more (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleotide sequence identical to that of SEQ ID NO: 51. In some embodiments, this disclosure provides mRNA comprising 100% of the nucleotide sequence identical to that of SEQ ID NO: 51. In some embodiments, the mRNA comprises a codon-optimized sequence comprising at least 85% or more (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleotide sequence identical to that of SEQ ID NO: 51.

[0097] In some embodiments, this disclosure provides mRNA comprising at least 85% or more (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) the same nucleotide sequence as SEQ ID NO: 50. In some embodiments, this disclosure provides mRNA comprising 100% the same nucleotide sequence as SEQ ID NO: 50.

[0098] In some embodiments, the mRNA may contain at least one chemically modified nucleoside and / or nucleotide. In some embodiments, the chemically modified nucleoside and / or nucleotide is selected from pseudouridine, N1-methylpseudouridine, and 5-methoxyuridine. In some embodiments, the chemically modified nucleoside is N1-methylpseudouridine (e.g., 1-methylpseudouridine). In some embodiments, at least about 80% or more (e.g., about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) of the uridine in the mRNA is modified or replaced by N1-methylpseudouridine. In some embodiments, 100% of the uridine (e.g., uracil) in the mRNA is modified or replaced by N1-methylpseudouridine. In some embodiments, this disclosure provides mRNA comprising at least 85% or more (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%) of the nucleotide sequence identical to that of SEQ ID NO: 50, wherein 100% of the uridine or uracil in the mRNA is modified or replaced by N1-methylpseudouridine. In some embodiments, two or more of the uridine or uracil residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 5) are used. 5, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 200, 300, 400, 500, 600, 700, 800 or more) are N1-methylpseudoruridin.

[0099] In some embodiments, this disclosure provides mRNA comprising at least 85% or more (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) the same nucleotide sequence as SEQ ID NO: 52. In some embodiments, this disclosure provides mRNA comprising one, two, three, four, or five mismatched nucleotide sequences as the nucleotide sequence of SEQ ID NO: 52. In some embodiments, this disclosure provides mRNA comprising 100% the same nucleotide sequence as the nucleotide sequence of SEQ ID NO: 52.

[0100] Some embodiments provide mRNA comprising 100% identical nucleotide sequences to the nucleotide sequence of SEQ ID NO: 50, wherein 100% of the uridine (e.g., uracil) in the mRNA is modified or replaced with N1-methylpseuuridine. In some embodiments, the mRNA comprises or is composed of the nucleotide sequence of SEQ ID NO: 52. In some embodiments, the mRNA may also comprise a 5' cap, such as the cap described herein. The 5' cap may be, for example, cap-0, cap-1, or cap-2 structures. SEQ ID NO: 51 is a non-limiting exemplary sequence of parental Cas9 mRNA. SEQ ID NO: 52 is a codon-optimized sequence derived from parental Cas9 mRNA, and some u in SEQ ID NO: 52 are N1-methylpseuuridine.

[0101] Optimized mRNAs encoding, for example, Cas9 are also described in US20210355463A1, which is incorporated herein by reference in its entirety.

[0102] Guide RNA (gRNA) In some embodiments, the CRISPR / Cas-mediated gene editing system for genetically editing the ALAS1 gene comprises a genome-targeting nucleic acid (e.g., a guide RNA) that directs the activity of an RNA-guided endonuclease to a specific target sequence within the ALAS1 gene. The guide RNA comprises at least a spacer sequence that hybridizes to the specific nucleic acid sequence of interest and a CRISPR repeat sequence. The gRNA can be a single-molecule guide RNA (sgRNA) or a two-molecule guide RNA. The RNA-guided endonuclease can be, for example, a Cas endonuclease, including the Cas9 endonuclease. The Cas9 endonuclease can be, for example, SpCas9, SaCas9, or SluCas9 endonuclease. In some embodiments, the RNA-guided endonuclease is a Cas9 variant. In some embodiments, the RNA-guided endonuclease is a small RNA-guided endonuclease. In some embodiments, the RNA-guided endonuclease is a small Cas endonuclease.

[0103] In some embodiments, the gRNA from 5' to 3' comprises: crRNA and tracrRNA, wherein the crRNA and tracrRNA hybridize to form a double strand. In some embodiments, the crRNA comprises a spacer region sequence capable of targeting a target sequence in a target nucleic acid (e.g., a genomic DNA molecule) and a crRNA repeat sequence. In some embodiments, the tracrRNA comprises a tracrRNA antisense repeat sequence and a 3' tracrRNA sequence. In some embodiments, the 3' end of the crRNA repeat sequence is linked to the 5' end of the tracrRNA antisense repeat sequence, for example, via a tetraloop, wherein the crRNA repeat sequence and the tracrRNA antisense repeat sequence hybridize to form sgRNA. In some embodiments, the sgRNA from 5' to 3' comprises: a spacer region sequence, a crRNA repeat sequence, a tetraloop, a tracrRNA antisense repeat sequence, and a 3' tracrRNA sequence. In some embodiments, the sgRNA comprises a 5' spacer region extension sequence. In some embodiments, the sgRNA comprises a 3' tracrRNA extension sequence. 3' tracrRNA may contain or consist of one or more stem loops, such as one, two, three or more stem loops.

[0104] In some embodiments, the sgRNA sequence comprises the nucleotide sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 49), or a nucleotide sequence having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide deletions, insertions, or substitutions relative to SEQ ID NO: 49. In some embodiments, the sgRNA is used in conjunction with the Streptococcus pyogenes Cas9 endonuclease described herein (also referred to herein as SpCas9 or SpyCas9).

[0105] The guide RNA disclosed herein can target any sequence of interest via a spacer sequence. The spacer sequence in the gRNA is a sequence (e.g., a 20-nucleotide sequence) that defines a target sequence (e.g., a DNA target sequence, such as a genomic target sequence) of interest (e.g., the ALAS1 gene). In some embodiments, the spacer sequence ranges from 15 to 30 nucleotides. For example, the length of the spacer sequence can be the following, can be about the following, can be at least the following, or can be at most the following: 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, or any two of these values, or a range of nucleotides. In some embodiments, the spacer sequence contains 20 nucleotides. In some embodiments, the gRNA is capable of hybridizing with the forward strand of the target dsDNA. In some embodiments, the gRNA is capable of hybridizing with the reverse strand of the target dsDNA. In some embodiments, the gRNA is capable of hybridizing with a DNA strand complementary to the target PAM strand in the dsDNA.

[0106] The terms “target nucleic acid,” “target site,” and “target sequence” are used interchangeably throughout this document and can refer to any nucleic acid sequence that can be targeted by the gRNA sequence described herein. In some embodiments, the “target sequence” is located in a target gene adjacent to the PAM sequence and is a sequence to be modified by an RNA-directed nuclease (e.g., Cas9). The “target sequence” may be on the so-called PAM-chain of the “target nucleic acid,” which is a double-stranded molecule containing the PAM-chain and a complementary non-PAM chain. Those skilled in the art will recognize that the gRNA spacer region sequence hybridizes with a complementary sequence located in the non-PAM chain of the target nucleic acid of interest. Thus, in some embodiments, the gRNA spacer region sequence is an RNA equivalent of the target sequence. The gRNA spacer region interacts with the target nucleic acid of interest in a sequence-specific manner via hybridization (i.e., base pairing). Therefore, the nucleotide sequence of the spacer region varies depending on the target sequence of the target nucleic acid of interest. In some embodiments, the target sequence of the ALAS1 gene is located in exons 3, 4, 5, or 6 of the ALAS1 gene.

[0107] In the CRISPR / Cas system used in this paper, the spacer region sequence is designed to hybridize with the 5' region of the PAM located in the target nucleic acid that can be recognized by the Cas9 enzyme used in the system. The spacer region may perfectly match the target sequence or may have a mismatch. Each Cas9 enzyme has a specific PAM sequence that it recognizes in the target DNA. For example, the Streptococcus pyogenes Cas9 recognizes a PAM containing the sequence 5'-NRG-3' in the target nucleic acid, where R contains A or G, N is any nucleotide, and N is immediately adjacent to the 3' of the target nucleic acid sequence targeted by the spacer region sequence.

[0108] In some embodiments, the target nucleic acid sequence is 20 nucleotides long. In some embodiments, the target nucleic acid is less than 20 nucleotides long. In some embodiments, the target nucleic acid is more than 20 nucleotides long. In some embodiments, the target nucleic acid has a length of at least: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid has a length of at most: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid sequence has 20 bases immediately adjacent to the 5' of the first nucleotide of PAM. For example, in the sequence containing 5'-NNNNNNNNNNNNNNNNNNNNNN NRGIn the -3' sequence, the target nucleic acid can be a sequence corresponding to N, where N can be any nucleotide, and the underlined NRG sequence (R is G or A) is Streptococcus pyogenes PAM. In some embodiments, the PAM sequence used as the sequence recognized by SpCas9 in the compositions and methods of this disclosure is NGG, where N can be A, T, C, or G.

[0109] In some embodiments, the complementarity percentage between the spacer region sequence and the target nucleic acid is about, at least, at least about, at most, or at most about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the spacer region sequence of the guide RNA and the target nucleic acid in the target gene are 100% complementary. In some embodiments, the complementarity percentage between the spacer region sequence and the target nucleic acid is 100% over six consecutive 5' nucleotides of the target sequence on the complementary strand of the target nucleic acid. In some embodiments, the complementarity percentage between the spacer region sequence and the target nucleic acid is at least 60% over about 20 consecutive nucleotides. In other embodiments, the spacer region sequence of the guide RNA and the target sequence in the target gene may contain up to 10 mismatches, such as up to 9, up to 8, up to 7, up to 6, up to 5, up to 4, up to 3, up to 2, or up to 1 mismatch.

[0110] In some embodiments, the gRNA is a chemically modified gRNA. Various types of RNA modifications can be introduced into the gRNA to enhance stability, reduce the likelihood or extent of an innate immune response, and / or enhance other properties described in the art. The gRNAs described herein may contain one or more modifications, including nucleotide internucleotides, purine or pyrimidine bases, or sugars. In some embodiments, modifications are introduced at the ends of the gRNA by chemical synthesis or by polymerase. Examples of modified nucleic acids and their synthesis are disclosed in WO2013 / 052523. The synthesis of modified polynucleotides is also described in Verma and Eckstein, Annual Review of Biochemistry, Vol. 76, 99-134 (1998).

[0111] In some embodiments, the chemically modified gRNA contains thiophosphorylated 2'-O-methyl nucleotides at both the 3' and 5' ends. In some embodiments, the chemically modified gRNA contains thiophosphorylated 2'-O-methyl nucleotides at the 3' end. In some embodiments, the chemically modified gRNA contains thiophosphorylated 2'-O-methyl nucleotides at the 5' end. In some embodiments, the chemically modified gRNA contains three or four thiophosphorylated 2'-O-methyl nucleotides at the 3' end and / or three or four thiophosphorylated 2'-O-methyl nucleotides at the 5' end. In some embodiments, any gRNA containing any one of SEQ ID NO: 25-48 and 83-112 may be chemically modified to have four or more thiophosphorylated 2'-O-methyl nucleotides at the 3' end and / or three thiophosphorylated 2'-O-methyl nucleotides at the 5' end.

[0112] The number and position of phosphate-thioester bonds can vary. In some embodiments, the bonds can be between the first and second, second and third, third and fourth, fourth and fifth, fifth and sixth, sixth and seventh, seventh and eighth, eighth and ninth, ninth and tenth, or other positions at the 5' end of the gRNA. In some embodiments, the bonds can be between the first and second, second and third, third and fourth, fourth and fifth, fifth and sixth, sixth and seventh, seventh and eighth, eighth and ninth, ninth and tenth, or other positions at the 3' end of the gRNA.

[0113] In some embodiments, the nucleotide analogue / modification may include 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine-riboside-5'-triphosphate; 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, and 2'-O-methyl-inosine-5'-triphosphate. 4-Thiouridine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodouridine-5 5'-triphosphate, 5-iodine-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazoadenosine-5'-triphosphate 7-Denitroguanosine-5'-triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, or flavin-5'-triphosphate. Base-modified nucleotides can include 5-methylcytidine-5'-triphosphate, 7-dezoguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, pseudouridine-5'-triphosphate, pyridine-4-ketoribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyluridine, 1-carboxymethyl-pseudouridine, 5-propynyluridine, 1-propynyl-pseudouridine, 5-taurate methyluridine, 1-taurate methyl-pseudouridine, 5-Taurine methyl-2-thio-uridine, 1-Taurine methyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deazo-pseudouridine, 2-thio-1-methyl-1-deazo-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine and 4-methoxy-2-thio-pseudouridine, 5-aza-cytidinePseudocytidine, 3-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudocytidine, pyrrolo-cytidine, pyrrolo-pseudocytidine, 2-thio-cytidine, 2-thio-5-methylcytidine, 4-thio-pseudocytidine, 4-thio-1-methyl-pseudocytidine, 4-thio-1-methyl-1-deazo-pseudocytidine, 1-methyl-1-deazo-pseudocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5 -Methyl-cytidine, 4-methoxy-pseudo-cytidine, 4-methoxy-1-methyl-pseudo-cytidine, 2-aminopurine, 2,6-diaminopurine, 7-deadenine, 7-deadenine-8-aza-adenine, 7-deadenine-2-aminopurine, 7-deadenine-8-aza-2-aminopurine, 7-deadenine-2,6-diaminopurine, 7-deadenine-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine Benzalkonium chloride, N6,N6-dimethyladenosine, 7-methyladenosine, 2-methylthio-adenosine and 2-methoxy-adenosine, inosine, 1-methyl-inosine, woyoside, woyoside, 7-deazo-guanosine, 7-deazo-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deazo-guanosine, 6-thio-7-deazo-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine and N2,N2-dimethyl-6-thio- Guanosine, 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, 5'-O-(1-thiophosphate)-pseuuridine, 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseuuridine, 5,6-dihydrouridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, inosine, α-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine,7-Denitro-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudo-iso-cytidine, 6-chloro-purine, N6-methyl-adenosine, α-thio-adenosine, 8-azido-adenosine, or 7-denitro-adenosine.

[0114] At least one modified nucleotide and / or at least one nucleotide analogue may include 1-methyladenosine, 2-methyladenosine, N6-methyladenosine, 2'-O-methyladenosine, 2-methylthio-N6-methyladenosine, N6-isopentenyladenosine, 2-methylthio-N6-isopentenyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-methyl N6-Threonylcarbamoyl adenosine, N6-hydroxyn-valinecarbamoyl adenosine, 2-methylthio-N6-hydroxyn-valinecarbamoyl adenosine, inosine, 3-methylcytidine, 2-O-methylcytidine, 2-thiocytidine, N4-acetylcytidine, lysine, 1-methylguanosine, 7-methylguanosine, 2'-O-methylguanosine, piracetamidine, epoxypiracetamidine, 7-cyano-7-deazoguanosine, 7-Aminomethyl-7-denitroguanosine, pseudouridine, dihydrouridine, 5-methyluridine, 2'-O-methyluridine, 2-thiouridine, 4-thiouridine, 5-methyl-2-thiouridine, 3-(3-amino-3-carboxypropyl)uridine, 5'-hydroxyuridine, 5-methoxyuridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-aminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylaminomethyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-(isopenteneaminomethyl)uridine, 5-(isopenteneaminomethyl)-2-thiouridine or 5-(isopenteneaminomethyl)-2'-O-methyluridine.

[0115] In some embodiments, the chemical modification includes pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deazo-pseudouridine, 2-thio-1-methylpseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methylpseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, or 2'-O-methyluridine. In some embodiments, the modification includes 2'-O-methyluridine (2'OMe-rU), 2'-O-methylcytidine (2'OMe-rC), 2'-O-methyladenosine (2'OMe-rA), or 2'-O-methylguanosine (2'OMe-rG).

[0116] gRNA can contain any number of modified nucleic acids. In some implementations, the percentage of modified nucleotides in the gRNA molecule may be, may be at least, may be about, or may be at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% of the gRNA sequence. In some implementations, 50% or less of the nucleotides of the gRNA contain 2'-O-methyl modifications.

[0117] In some implementations, more than one guide RNA can be used with the CRISPR / Cas nuclease system. Each guide RNA can contain a different target sequence, allowing the CRISPR / Cas system to cleave more than one target nucleic acid. In some implementations, one or more guide RNAs can have the same or different properties, such as activity or stability within the Cas9 RNP complex. When more than one guide RNA is used, each guide RNA can be encoded on the same or different vectors.

[0118] In some embodiments, the gRNAs described herein can be produced by in vitro transcription (IVT), synthesis, and / or chemical synthesis methods, or combinations thereof. One or more of enzymatic IVT, solid-phase, liquid-phase, combinatorial synthesis, small-region synthesis, and ligation methods can be used. In some embodiments, gRNAs are prepared using an IVT enzymatic synthesis method. Methods for preparing polynucleotides via IVT are known in the art and described in WO2013 / 151666. Polynucleotide constructs and vectors can be used for in vitro transcription of the gRNAs described herein.

[0119] This disclosure includes a guide RNA (gRNA) for targeting the 5'-aminolevulinic acid synthase 1 (ALAS1) genomic locus. In some embodiments, the gRNA comprises a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112. In some embodiments, the gRNA comprises a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112 or a variant thereof having no more than three mismatches compared to any one of SEQ ID NO: 25-48 and 83-112. The spacer sequence may comprise a sequence selected from the group consisting of SEQ ID NO: 25-48 and 83-112.

[0120] The gRNA may contain a spacer sequence comprising any one of SEQ ID NO: 25-37 and 101-112. In some embodiments, the gRNA contains a spacer sequence comprising any one of SEQ ID NO: 25-37 and 101-112 or a variant thereof having no more than three mismatches compared to any one of SEQ ID NO: 25-37 and 101-112.

[0121] In some embodiments, the gRNA comprises a spacer region sequence comprising the sequence of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87. In some embodiments, the gRNA comprises a spacer region sequence comprising any one of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87, or a variant thereof having no more than three mismatches compared to any one of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87. In some embodiments, the gRNA comprises a spacer region comprising or consisting of the sequence of SEQ ID NO: 45. In some embodiments, the gRNA comprises a spacer region comprising or consisting of the sequence of SEQ ID NO: 83. In some embodiments, the gRNA comprises a spacer region comprising or consisting of the sequence of SEQ ID NO: 83. In some embodiments, the gRNA includes a spacer region comprising or consisting of the sequence of SEQ ID NO: 86. In some embodiments, the gRNA includes a spacer region comprising or consisting of the sequence of SEQ ID NO: 87.

[0122] In some embodiments, the gRNA comprises a spacer region sequence comprising the sequence of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO: 30. In some embodiments, the gRNA comprises a spacer region sequence comprising any one of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO: 30, or a variant thereof having no more than three mismatches compared to any one of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO: 30. In some embodiments, the gRNA comprises a spacer region comprising or consisting of the sequence of SEQ ID NO: 25. In some embodiments, the gRNA comprises a spacer region comprising or consisting of the sequence of SEQ ID NO: 26. In some embodiments, the gRNA includes a spacer region comprising or consisting of the sequence of SEQ ID NO: 27. In some embodiments, the gRNA includes a spacer region sequence comprising the sequence of SEQ ID NO: 29 or SEQ ID NO: 30. In some embodiments, the gRNA includes a spacer region sequence comprising or consisting of the sequence of SEQ ID NO: 29 or SEQ ID NO: 30, or a variant thereof having no more than three mismatches compared to SEQ ID NO: 29 or SEQ ID NO: 30. In some embodiments, the gRNA includes a spacer region comprising or consisting of the sequence of SEQ ID NO: 29. In some embodiments, the gRNA includes a spacer region comprising or consisting of the sequence of SEQ ID NO: 30.

[0123] In some implementations, the gRNA can induce a cleavage efficiency of at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% targeting the ALAS1 genomic locus (e.g., 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any two of these values ​​or a range thereof).

[0124] In some implementations, the gRNA can induce a cleavage efficiency of at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% targeting the ALAS1 genomic locus (e.g., 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any two of these values ​​or a range thereof).

[0125] In some implementations, the gRNA can induce a cleavage efficiency of at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% targeting the ALAS1 genomic locus (e.g., 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values).

[0126] gRNA can be a single guide RNA (sgRNA). gRNA can be chemically modified gRNA. Chemically modified gRNA can contain one or more phosphate-thioester bonds. Chemically modified gRNA can contain one or more 2'-O-methyl nucleotides at the 3' end, 5' end, or both. In some embodiments, 50% or less of the nucleotides of the gRNA contain 2'-O-methyl modifications. For example, for a gRNA of 100 nucleotides in length (e.g., sgRNA), 50 or fewer nucleotides may be 2'-O-methyl nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides may be or may contain 2'-O-methyl nucleotides).

[0127] 2'-O-methyl nucleotides can be located anywhere within the gRNA. In some embodiments, the three nucleotides at the 5' end of the gRNA contain or are 2'-O-methyl nucleotides. In some embodiments, approximately the last 35 or fewer nucleotides at the 3' end of the gRNA contain or are 2'-O-methyl nucleotides (e.g., the last 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, and 35 nucleotides at the 3' end of the sgRNA). In some embodiments, for example, for a 100 bp sgRNA, the nucleotides at positions 25-41 of the sgRNA can be or may contain 2'-O-methyl nucleotides. Approximately 48% of the nucleotides of the gRNA may contain 2'-O-methyl modifications.

[0128] The 5' end of the gRNA may contain three phosphate-thioester bonds, and the 3' end of the gRNA may contain three phosphate-thioester bonds. In some embodiments, the bonds may be located between the first, second, and third and / or third and fourth positions from the 5' end of the gRNA. In some embodiments, the bonds may be located between the first, second, and third and / or third and fourth positions from the 3' end of the gRNA.

[0129] Base editing In some implementations, base editing can be used to edit genes. Base editing is a genome editing method that directly produces point mutations in specific regions of genomic DNA without causing double-strand breaks (DSBs). DNA base editors (BEs) contain a fusion between a catalytically impaired Cas nuclease and a base-modifying enzyme. Nucleobase editors typically include a polynucleotide-programmable nucleotide-binding domain and a nucleobase editing domain (e.g., adenosine deaminase, cytidine deaminase). When conjugated with a binding guide polynucleotide (e.g., gRNA), the polynucleotide-programmable nucleotide-binding domain can specifically bind to the target polynucleotide sequence, thereby positioning the base editor to the target nucleic acid sequence to be edited. In some implementations, base editing can be used to introduce loss-of-function mutations (e.g., premature stop codons, unstable mutations, altered splicing, etc.). In other implementations, base editing can be used to correct mutations (e.g., pathogenic mutations).

[0130] In some embodiments, the base editor comprising a polynucleotide-programmable nucleotide-binding domain comprises all or part (e.g., a functional portion) of a CRISPR protein. In some embodiments, the polynucleotide-programmable nucleotide-binding domain comprises a nicking enzyme domain. In this document, the term "nicking enzyme" should be given its common meaning and should also refer to a polynucleotide-programmable nucleotide-binding domain comprising a nuclease domain capable of cleaving only one of the two strands of a double-stranded nucleic acid molecule (e.g., DNA). For example, in the case where the polynucleotide-programmable nucleotide-binding domain comprises a Cas9-derived nicking enzyme domain, the Cas9-derived nicking enzyme domain may contain a D10A mutation and a histidine residue at position 840. In another example, the Cas9-derived nicking enzyme domain contains an H840A mutation, while the amino acid residue at position 10 remains D. In some embodiments, the Cas9 nuclease has an inactive (e.g., inactivated) DNA-cutting domain (e.g., Cas9 is a nicking enzyme, referred to as the "nCas9" protein). Based on this disclosure and knowledge in the art, suitable Cas9 cleavage enzymes will be apparent to those skilled in the art and are within the scope of this disclosure. In some embodiments, the base editor comprises a polynucleotide-programmable nucleotide-binding domain that catalytically dies (e.g., cannot cleave the target polynucleotide sequence). For example, in the case where the base editor comprises a Cas9 domain, Cas9 may contain both the D10A mutation and the H840A mutation. In a further embodiment, the catalytically dies polynucleotide-programmable nucleotide-binding domain comprises a point mutation (e.g., D10A or H840A) and the deletion of all or part (e.g., the functional portion) of the nuclease domain.

[0131] In some embodiments, the base editor comprises an adenosine deaminase domain. Such an adenosine deaminase domain of the base editor can facilitate the editing of adenine (A) nucleobases to guanine (G) nucleobases by deaminating A to form inosine (I), which exhibits the base-pairing properties of G. In some embodiments, the A-to-G base editor further comprises an inhibitor of inosine base excision repair, such as a uracil glycosylase inhibitor (UGI) domain or a catalytically inactivating inosine-specific nuclease. Without wishing to be bound by any particular theory, the UGI domain or the inactive inosine-specific nuclease can inhibit or prevent base excision repair of deaminated adenosine residues (e.g., inosine), which can improve the activity or efficiency of the base editor. Adenosine deaminases can be derived from any suitable organism (e.g., *E. coli*, such as ecTadA deaminase). In some embodiments, the adenine deaminase is a naturally occurring adenosine deaminase comprising one or more mutations. Detailed descriptions of A-to-G nucleobase editing proteins can be found in WO2018 / 027078 and Gaudelli, NM et al., “Programmable base editing of A»T to G»C in genomic DNA without DNA cleavage” Nature, 551, 464-471 (2017), the entire contents of which are incorporated herein by reference.

[0132] In some embodiments, the base editor comprises a fusion protein or complex containing a cytidine deaminase capable of deaminating a target cytidine (C) base of a polynucleotide to produce uridine (U), which has the base-pairing property of thymine. In some embodiments, for example, where the polynucleotide is double-stranded (e.g., DNA), the uridine base can then be substituted by a thymine base (e.g., via cellular repair mechanisms) to produce a C:G to T:A transition. In other embodiments, the base editor deamination of C to U in a nucleic acid does not involve a U to T substitution. Deamination of a target C in a polynucleotide to produce U is a non-limiting example of the type of base editing that can be performed by the base editor described herein. In another example, a base editor containing a cytidine deaminase domain can mediate the conversion of a cytosine (C) base to a guanine (G) base. For example, the U in a polynucleotide produced by deamination of cytidine via the cytidine deaminase domain of a base editor can be removed from the polynucleotide via a base excision repair mechanism (e.g., via the uracil DNA glycosylase (UDG) domain), thereby creating a debasement site. The nucleobase opposite the debasement site can then be replaced with another base, such as C, by, for example, a trans-damage polymerase (e.g., via a base repair mechanism). Although the nucleobase opposite the debasement site is usually replaced by C, other substitutions (e.g., A, G, or T) can also occur.

[0133] Therefore, in some embodiments, the base editor described herein includes a deamination domain (e.g., a cytidine deaminase domain) capable of deaminating a target C to U in a polynucleotide. Furthermore, as described below, the base editor may include additional domains that facilitate the conversion of the U resulting from deamination to T or G in some embodiments. For example, a base editor containing a cytidine deaminase domain may further include a uracil glycosylase inhibitor (UGI) domain to mediate the substitution of U for T, thereby completing the C-to-T base editing event. In another instance, the base editor may include a uracil-stabilizing protein as described herein. In yet another instance, the base editor may incorporate a transdamage polymerase to enhance the efficiency of C-to-G base editing, since the transdamage polymerase can facilitate the incorporation of C opposite the debasement site (i.e., resulting in the incorporation of G at the debasement site, thereby completing the C-to-G base editing event). A base editor containing a cytidine deaminase as a domain can deaminate a target C in any polynucleotide, including DNA, RNA, and DNA-RNA hybrids.

[0134] In some embodiments, the base editor's cytidine deaminase comprises all or part (e.g., the functional part) of apolipoprotein B mRNA editing complex (APOBEC) family of deaminases. APOBEC is an evolutionarily conserved family of cytidine deaminases. Members of this family are C-to-U editing enzymes. The N-terminal domain of APOBEC-like proteins is the catalytic domain, while the C-terminal domain is the pseudocatalytic domain. More specifically, the catalytic domain is the zinc-dependent cytidine deaminase domain and is important for cytidine deamination. APOBEC family members include APOBEC 1, APOBEC 2, APOBEC 3A, APOBEC 3B, APOBEC 3C, APOBEC 3D (“APOBEC 3E” now refers to it), APOBEC 3F, APOBEC 3G, APOBEC 3H, APOBEC 4, and activation-induced (cytidine) deaminases. In some embodiments, the deaminase is an activation-induced deaminase (AID). In some embodiments, the APOBEC deaminase incorporated into the base editor may contain one or more mutations selected from the group consisting of: H121R, H122R, R126A, R126E, R118A, W90A, W90Y, and R132E of rAPOBECl; D316R, D317R, R320A, R320E, R313A, W285A, W285Y, and R326E of hAPOBEC3G; and any substitution mutations at the corresponding positions, or one or more corresponding mutations of another APOBEC deaminase. Many modified cytidine deaminases are commercially available, including but not limited to SaBE3, SaKKH-BE3, VQR-BE3, EQR-BE3, VRER-BE3, YE-BE3, EE-BE3, YE-BE3, and YE-BE3, which are available from Addgene (plasmids 85169, 85170, 85171, 85172, 85173, 85174, 85175, 85176, 85177). In some embodiments, the deaminase incorporated into the base editor comprises all or part (e.g., the functional portion) of the APOBEC 1 deaminase.

[0135] Detailed descriptions of C-to-T nucleobase editing proteins can be found in WO2017 / 070632 and Komor, AC et al., “Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage” Nature 533, 420-424 (2016), the entire contents of which are incorporated herein by reference.

[0136] When conjugated with a binding guide polynucleotide (e.g., gRNA), the polynucleotide programmable nucleotide-binding domain can specifically bind to the target polynucleotide sequence (i.e., via complementary base pairing between the bases of the bound guide nucleic acid and the bases of the target polynucleotide sequence), thereby positioning the base editor to the target nucleic acid sequence (e.g., a double-stranded DNA target) to be edited. In one embodiment, the guide polynucleotide is gRNA. In some embodiments, the guide polynucleotide is at least one single guide RNA (“sgRNA” or “gRNA”). In some embodiments, the methods described herein may utilize engineered Cas proteins. A guide RNA (gRNA) is a short synthetic RNA containing a scaffold sequence necessary for Cas binding and a user-defined spacer region of approximately 20 nucleotides that defines the genomic target to be modified. Therefore, the specificity of the Cas protein to its genomic target depends in part on the degree of specificity of the gRNA targeting sequence to the genomic target compared to the rest of the genome. In some implementations, the spacer region is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25 or more nucleotides long. The spacer region of the gRNA may be about 19, 20 or 21 nucleotides long.

[0137] Other exemplary editing In some embodiments, additional exemplary edits can be used to edit genes. In some embodiments, additional edits can be used to introduce loss-of-function mutations (e.g., premature stop codons, unstable mutations, altered splicing, etc.). In other embodiments, edits can be used to correct mutations (e.g., pathogenic mutations). Editing systems typically include an editor containing a multinucleotide programmable nucleotide-binding domain (e.g., a nickase Cas9) and a DNA-polymerase domain (e.g., a reverse transcriptase (RT), such as Moloney murine leukemia virus reverse transcriptase (M-MLV RT)). The guiding nucleic acid may contain an editing template. The gRNA may also include a primer binding site (PBS). The PBS can be programmed to hybridize with a substitution strand on the 5' side of an introduced nick produced by the nickase. The PBS may be complementary to a portion of the original spacer region sequence. The editing template sequence contains the edit to be performed and is typically located between the tracr region (e.g., a scaffold or core region) and the PBS. The length of the edit to be performed can vary, for example, from the deletion of 10 or fewer nucleotides to the insertion of more than 80 nucleotides. In some embodiments, the edit involves the substitution of one or more nucleotides.

[0138] In some implementations, the target sequence is bound by a cleavage enzyme Cas9 (e.g., the Cas9-H840A domain) via a spacer region of guide RNA (gRNA). Hybridization of the spacer region sequence with a complementary target sequence can result in the substitution of another strand (e.g., a PAM strand or an edited strand). The Cas9-H840A domain can cleave the substituted strand, which can then pair with PBS. RT can recognize the RNA-DNA duplex formed by the substituted strand and PBS and use the editing template of the gRNA (e.g., the RT template) as a template to extend the DNA of the substituted strand in the 3' direction. This can produce a "flap" of single-stranded DNA on the substituted strand, including the desired edit. The editor can then dissociate from the DNA, leaving two redundant "flaps" on the substituted strand, one of which is the original sequence and the other is the edited sequence. Through a process called "flap balancing," one sequence will bind to the target sequence, while the other will remain attached to the substituted strand as a single-stranded flap. If the flap with the edited sequence binds to the target sequence, the complex can be referred to as a "DNA heteroduplex" due to the mismatch caused by the editing. Then, cellular DNA repair mechanisms can act on heteroduplex DNA, incorporating editing.

[0139] In some embodiments, where the editor contains a Cas9-derived cleavage enzyme domain, the Cas9-derived cleavage enzyme domain may include a D10A mutation and a histidine residue at position 840. In another example, the Cas9-derived cleavage enzyme domain contains an H840A mutation, while the amino acid residue at position 10 remains D. In some embodiments, the Cas9 nuclease has an inactive (e.g., inactivated) DNA cleavage domain, i.e., Cas9 is a cleavage enzyme, referred to as an "nCas9" protein. The Cas9 cleavage enzyme may be a Cas9 protein capable of cleaving only one strand of a double-stranded nucleic acid molecule (e.g., a double-stranded DNA molecule). Based on this disclosure and knowledge in the art, other suitable Cas9 cleavage enzymes will be apparent to those skilled in the art and are within the scope of this disclosure. In some embodiments, the editor contains an RNA-dependent DNA polymerase domain, such as reverse transcriptase (RT). In some embodiments, the editor contains a viral RT, such as a retroviral RT (e.g., Moloney murine leukemia virus (M-MLV or MLVRT)). In some implementations, the editor may contain a fusion of a Streptococcus pyogenes Cas9 peptide and a Moloney murine leukemia virus (M-MLV) reverse transcriptase peptide.

[0140] gRNA can refer to a guide polynucleotide comprising one or more intended nucleotide edits for incorporation into the target DNA. In some embodiments, the gRNA is associated with an editor and guides the editor to incorporate one or more intended nucleotide edits into the target gene via editing. "Nucleotide edit" or "intended nucleotide edit" should be given its common meaning and should also refer to a specific deletion of one or more nucleotides at a specific location, an insertion of one or more nucleotides at a specific location, a substitution of a single nucleotide, or other alteration at a specific location to be incorporated into the sequence of the target gene. Intended nucleotide edits can refer to edits on an editing template compared to a sequence on the target strand of the target gene, or edits encoded by the editing template on newly synthesized single-stranded DNA. In some embodiments, the gRNA comprises a spacer sequence complementary or substantially complementary to a sequence on the target strand of the target gene. In some embodiments, the gRNA comprises a gRNA core associated with a DNA-binding domain (e.g., a CRISPR-Cas protein domain) of the editor. In some implementations, the gRNA also includes an extended nucleotide sequence that contains one or more intended nucleotide edits compared to the endogenous sequence of the target gene, wherein the extended nucleotide sequence may be referred to as an extended arm.

[0141] The extension arm may contain a primer-binding site sequence (PBS) capable of initiating target-initiated DNA synthesis. In some embodiments, the PBS is complementary or substantially complementary to the free 3' end of the edit strand of the target gene at the nick site generated by the editor. In some embodiments, the extension arm also contains an editing template containing the intended nucleotides to be edited by editing one or more nucleotides incorporated into the target gene. In some embodiments, the editing template is a template of an RNA-dependent DNA polymerase domain or a polypeptide (e.g., a reverse transcriptase domain) of the editor. In some embodiments, the editing template contains partial complementarity to the edit target sequence in the target gene. In some embodiments, the editing template contains substantially or partially complementarity to the edit target sequence, except at the site of the intended nucleotide editing to be incorporated into the target gene.

[0142] Some editors include a Cas9 variant containing the H840A mutation (i.e., the Cas9 nickase) and the wild-type M-MLV RT, along with an N-terminal NLS sequence (19 amino acids) and an amino acid linker (32 amino acids) connecting the C-terminus of the Cas9 nickase domain to the N-terminus of the RT domain. The fusion protein can have the following structure: [NLS]-[Cas9(H840A)]-[linker]-[MMLV_RT(wt)]. In some cases, the editor protein may include a Cas9 variant containing the H840A mutation (i.e., the Cas9 nickase) and an M-MLV RT containing mutants D200N, T330P, L603W, T306K, and W313F, along with an N-terminal NLS sequence (19 amino acids) and an amino acid linker (33 amino acids) connecting the C-terminus of the Cas9 nickase domain to the N-terminus of the RT domain. Fusion proteins can have the following structure: [NLS]-[Cas9(H840A)]-[linker]-[MMLV_RT(D200N)(T330P)(L603W)(T306K)(W313F)].

[0143] In some embodiments, the editing system or composition also includes a nick-directing polynucleotide, such as nick-directing RNA (ngRNA). Not wishing to be bound by any particular theory, the unedited strand of the double-stranded target DNA in the target gene can be nicked by a CRISPR-Cas nicking enzyme directed by the ngRNA. In some embodiments, a nick-directed endogenous DNA repair mechanism on the unedited strand uses the edited strand as a template for repairing the unedited strand, which can improve the efficiency of editing. Some editor systems have an editor plus a second-strand nick-directing RNA that is compounded with the editor and introduces a nick into the unedited DNA strand to induce preferential replacement of the edited strand. In some editors, the second-strand nick-directing RNA is designed for time control, such that the second-strand nick is not introduced until after the desired edit has been performed. This is achieved by designing a gRNA with a spacer region sequence that matches only the edited strand and not the original allele. Using this strategy, mismatches between the prototype spacer region and the unedited allele should be unfavorable for nicking by the sgRNA until after an editing event occurs on the PAM strand. Some additional editors contain a fusion protein comprising Cas9 (R221K N39K H840A) and a variant MMLV_RT five mutant (D200N T306K W313F T330P L603W) with the following structure: [Bisecting NLS]-[Cas9(R221K)(N394K)(H840A)]-[Connector]-[MMLV_RT(D200N)(T330P)(L603W)]-[Bisecting NLS]-[NLS]+desired gRNA.

[0144] Some of the methods and compositions related to the editing disclosed herein are also described in WO2023015309, WO2022150790, WO2022067130, WO2020191233, WO2020191234, WO2020191239, WO2020191241, WO2020191242, WO2020191243, WO2020191245, WO2020191246, WO2020191248, WO2020191249, WO2020191153 and WO2020191171, the contents of which are incorporated herein by reference in their entirety.

[0145] Methods for editing the ALAS1 gene This article provides a method for using genome editing to edit ALAS1, thereby functionally reducing the expression of the ALAS1 gene. This method can be used to treat subjects, such as patients with ALAS1-related diseases or conditions.

[0146] This document provides a method for treating ALAS1-related disease or condition in subjects (e.g., mammalian subjects) with appropriate need. In some embodiments, the method includes administering to the subject more than one nanoparticle complexed with (a) a guide RNA (gRNA) targeting the ALAS1 gene or a nucleic acid encoding a gRNA targeting the ALAS1 gene and (b) a nucleic acid encoding an RNA-directed endonuclease, thereby alleviating ALAS1-related disease or condition in the subject. More than one nanoparticle may be administered to the subject once. More than one nanoparticle may be administered to the subject two or more times, for example, twice, for treatment. The two administrations of the nanoparticle to the subject may be spaced apart by an appropriate time period. In some embodiments, an appropriate time period is approximately one week, two weeks, three weeks, four weeks, five weeks, six weeks, seven weeks, eight weeks, three months, four months, five months, six months, one year, two years, three years, or longer. In some embodiments, the interval between two or more administrations is approximately two weeks to approximately two months, for example, approximately three weeks. In some embodiments, the interval between each two administrations is approximately two weeks to approximately two months, for example, approximately three weeks. The appropriate time interval between two administrations may be the same as or different from the appropriate time interval between other administrations. In some embodiments, more than one nanoparticle is administered to the subject at a dose of about 0.01-5 mg / kg per administration, such as 0.05-2 mg / kg, 0.5-3 mg / kg, or 0.1-1 mg / kg. In some embodiments, ALAS1 gRNA or nucleic acid encoding ALAS1 gRNA is administered to the subject at a dose of 0.01-5 mg / kg per administration, such as 0.1-1 mg / kg gRNA. In some embodiments, nucleic acid encoding RNA-directed endonuclease is administered to the subject at a dose of 0.1-5 mg / kg per administration, such as 0.5-3 mg / kg or 0.3-2 mg / kg. The dose may be the same or different for each administration to the subject.

[0147] In some embodiments, the gRNA targets a sequence within or near the coding sequence of the ALAS1 gene. In some embodiments, the gRNA targets a sequence within one of the 12 exons of the ALAS1 gene. In some embodiments, the gRNA targets a sequence within exons 3, 4, 5, or 6 of the ALAS1 gene. The gRNA may contain a spacer sequence complementary to the target sequence within exons 3, 4, 5, or 6 of the ALAS1 gene. In some embodiments, one or more spacer regions are complementary to a sequence within or near exons 3, 4, 5, or 6 of the ALAS1 gene (e.g., within any of the following distances from exons 3, 4, 5, or 6: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases). The complementarity between the gRNA spacer regions and the target sequence in the ALAS1 gene can be complete or incomplete. In some embodiments, complementarity can be at least 70%, 80%, 90%, 100%, or a number or range between any two of these values. In some embodiments, complementarity is complete, i.e., 100%.

[0148] In some embodiments, the gRNA comprises a spacer region sequence comprising any one of SEQ ID NO: 25-48 and 83-112. In some embodiments, the gRNA comprises a spacer region sequence selected from SEQ ID NO: 25-48 and 83-112, or a variant thereof having about, at least, at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to any spacer region of SEQ ID NO: 25-48 and 83-112. In some embodiments, the gRNA comprises a spacer region sequence selected from SEQ ID NO: 25-48 and 83-112, or a variant thereof having no more than three mismatches compared to any one of SEQ ID NO: 25-48 and 83-112. In some embodiments, the gRNA comprises a spacer region sequence selected from SEQ ID NO: 25-48 and 83-112. In some embodiments, the gRNA comprises or consists of a spacer region sequence of SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27. In some embodiments, the gRNA comprises or consists of a spacer region sequence comprising or consists of a sequence of SEQ ID NO: 29 or SEQ ID NO: 30. In some embodiments, the gRNA comprises a spacer region sequence comprising or consists of a sequence of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87. In some embodiments, the gRNA comprises a spacer region sequence comprising or consists of a sequence of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 29, or SEQ ID NO: 30.

[0149] In some embodiments, the gRNA used in the methods herein may comprise two or more gRNAs, each containing a spacer region complementary to the sequence at the ALAS1 gene locus (e.g., any one of SEQ ID NO: 25-48 and 83-112 or a variant thereof having at least 85% homology to any one of SEQ ID NO: 25-48 and 83-112 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NO: 25-48 and 83-112).

[0150] In some embodiments, the gRNA used in the methods herein may comprise two or more gRNAs, each containing a spacer region complementary to the sequence at the ALAS1 gene locus (e.g., any one of SEQ ID NO: 25-48 and 83-112 or a variant thereof having at least 85% homology to any one of SEQ ID NO: 25-48 and 83-112 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NO: 25-48 and 83-112).

[0151] In some implementations, the guide sequence comprises a spacer region sequence of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO: 30, or a variant thereof having about, at least, or at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to the spacer region of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29, or SEQ ID NO: 30. In some embodiments, the guide sequence comprises a spacer region sequence of SEQ ID NO:45, SEQ ID NO:83, SEQ ID NO:86, or SEQ ID NO:87, or a variant thereof having about, at least, or at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to the spacer region of SEQ ID NO:45, SEQ ID NO:83, SEQ ID NO:86, or SEQ ID NO:87. In some embodiments, the guide sequence comprises or consists of a spacer region sequence of SEQ ID NO:25, SEQ ID NO:26, or SEQ ID NO:27. In some embodiments, the gRNA comprises a spacer sequence comprising the sequence of SEQ ID NO: 29 or SEQ ID NO: 30, or a variant thereof having about, at least, or at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% homology to the spacer sequence of SEQ ID NO: 29 or SEQ ID NO: 30. In some embodiments, the guide sequence comprises or is composed of the spacer sequence of SEQ ID NO: 29 or SEQ ID NO: 30.

[0152] The gRNA used in this paper enhances on-target activity while significantly reducing potential off-target effects (i.e., cleavage of genomic DNA at undesirable sites outside the ALAS1 gene). In some embodiments, off-target binding is reduced by about, at least, or at least about: 80%, 85%, 90%, 95%, 98%, 99%, or 100%.

[0153] In some implementations, the gRNA induces a cleavage efficiency of at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% (e.g., at least 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values).

[0154] In some implementations, the gRNA induces a cleavage efficiency of at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% (e.g., at least 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any two of these values ​​or a range thereof).

[0155] In some embodiments, the DNA endonuclease is a Cas endonuclease described herein or known in the art. Cas endonucleases may be naturally occurring or non-natural (e.g., recombinant or mutated). In some implementations, the DNA endonuclease is selected from the group consisting of: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 or Cpf1 endonuclease or functional derivatives thereof. In some embodiments, the DNA endonuclease is Cas9 endonuclease or a variant thereof. In some embodiments, the Cas9 endonuclease is derived from Streptococcus pyogenes (SpyCas9 or SpCas9). In some embodiments, the Cas9 endonuclease is derived from Staphylococcus ludenbergii (SluCas9).

[0156] Compositions and therapeutic applications The content provided herein also includes pharmaceutical compositions for carrying out the methods disclosed herein. The compositions may comprise one or more gRNAs, RNA-directed endonucleases, or nucleotide sequences encoding RNA-directed endonucleases as described herein. In some embodiments, the compositions may also comprise a polynucleotide (e.g., a donor template) to be inserted into the ALAS1 gene to achieve the desired genetic modification of the methods disclosed herein.

[0157] The disclosure herein includes compositions. In some embodiments, the composition comprises (a) any gRNA or polynucleotide encoding a gRNA disclosed herein, and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease.

[0158] In some embodiments, the composition comprises: (a) a guide RNA (gRNA) targeting the 5'-aminolevulinic acid synthase 1 (ALAS1) genomic locus, said gRNA comprising a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112, or a nucleic acid encoding said gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease.

[0159] The composition may comprise any spacer region and / or gRNA disclosed herein. In some embodiments, the spacer region sequence comprises a sequence selected from the group consisting of SEQ ID NOs: 25-48 and 83-112. The gRNA may be a single guide RNA (sgRNA). The gRNA may be a chemically modified gRNA. The chemically modified gRNA may contain one or more phosphate-thioester bonds. The chemically modified gRNA may contain one or more 2'-O-methyl nucleotides at the 3' end, 5' end, or both. In some implementations, 50% or less of the nucleotides of the gRNA contain a 2'-O-methyl modification (e.g., 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, or any two of these values ​​or a range thereof). In some embodiments, approximately 48% of the nucleotides of the gRNA contain a 2'-O-methyl modification (e.g., 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, or any two of these values ​​or a range thereof). In some embodiments, the 5' end of the gRNA contains three phosphate-thioester bonds, and the 3' end of the gRNA contains three phosphate-thioester bonds. In some implementations, the Cas9 endonuclease is selected from the group consisting of: Streptococcus pyogenes Cas9, Staphylococcus aureus Cas9, Neisseria meningitidis Cas9, Streptococcus thermophilus CRISPR1 Cas9, Streptococcus thermophilus CRISPR3 Cas9, and Treponema denticulatum Cas9.

[0160] The composition may comprise (a) ALAS1 gRNA and (b) Cas9 endonuclease, and the ALAS1 gRNA and Cas9 endonuclease may be formulated into ribonucleoprotein particles (RNPs). The composition may comprise (a) nucleic acid encoding ALAS1 gRNA and (b) nucleic acid encoding Cas9 endonuclease. In some embodiments, (a) and / or (b) are present on a viral vector. The viral vector may be an adeno-associated virus vector.

[0161] (a) gRNA or nucleic acid encoding gRNA, (b) Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, or both, can be complexed with liposomes or lipid nanoparticles (LNPs). Lipid nanoparticles may contain one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-conjugated lipids. Lipid nanoparticles may contain cholesterol, polyethylene glycol (PEG) lipids, or both.

[0162] In some embodiments, one or more gRNAs each contain a spacer region complementary to or near a genomic sequence of the ALAS1 gene at any of the following distances from any exon of the ALAS1 gene: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases. In some embodiments, the gRNA targets a sequence in any of exons 3-6 of the ALAS1 gene. The gRNA may contain a spacer region sequence complementary to or identical to the target sequence in any of exons 3-6 of the ALAS1 gene. In some embodiments, the gRNA comprises a spacer region sequence of any one of SEQ ID NO: 25-48 and 83-112 or a variant thereof having at least 85% homology with a spacer region sequence of any one of SEQ ID NO: 25-48 and 83-112. In some embodiments, the gRNA comprises a spacer region of any one of SEQ ID NO: 25-48 and 83-112 or a variant thereof having at least 85% homology with a spacer region having a sequence of SEQ ID NO: 25-48 and 83-112. In some embodiments, the gRNA comprises a spacer region of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87 or a variant thereof having at least 85% homology with a spacer region having a sequence of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87. In some embodiments, the gRNA comprises a spacer region of SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27, or a variant thereof having at least 85% homology with a spacer region having the sequence SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27. In some embodiments, the gRNA comprises a spacer region comprising or consisting of a sequence of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86, or SEQ ID NO: 87. In some embodiments, the gRNA comprises a spacer region comprising or consisting of a sequence of SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27. In some embodiments, the gRNA comprises a spacer region of SEQ ID NO: 29 or SEQ ID NO: 30, or a variant thereof having at least 85% homology with a spacer region having the sequence SEQ ID NO: 29 or SEQ ID NO: 30.In some embodiments, the gRNA includes a spacer region that contains or consists of the sequence of SEQ ID NO: 29 or SEQ ID NO: 30.

[0163] In some implementations, the RNA-directed endonuclease is Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cpf1 endonucleases or functional derivatives thereof. In some embodiments, the DNA endonuclease is Cas9. In some embodiments, the Cas9 endonuclease is derived from *Streptococcus pyogenes* (SpyCas9). In some embodiments, the Cas9 endonuclease is derived from *Staphylococcus ludensii* (SluCas9). In some embodiments, the DNA sequence transcribed into the nucleic acid encoding the DNA endonuclease is codon-optimized. In some embodiments, the nucleic acid encoding the DNA endonuclease (e.g., mRNA) contains a 5' cap and a 3' multi-A tail. In some embodiments, the nucleic acid encoding the DNA endonuclease is covalently linked to gRNA.

[0164] In some implementations, one or more of the nucleic acid sequence and / or polypeptide can be delivered to cells in vitro or in vivo via a virus-based or non-virus-based delivery system, including adenovirus vectors, adeno-associated virus (AAV) vectors, retroviral vectors, lentivirus vectors, herpesvirus vectors, liposomes, lipid nanoparticles, poxviruses, naked DNA application, plasmids, granulocytes, bacteriophages, cell encapsulation techniques, etc.

[0165] In some embodiments, the compounds of the compositions disclosed herein (e.g., ALAS1 gRNA or nucleic acids encoding ALAS1 gRNA, and nucleic acids encoding RNA-directed endonucleases) may be formulated in liposomes or lipid nanoparticles. In some embodiments, the compounds of the compositions are formulated in lipid nanoparticles (LNPs). LNPs are a non-viral delivery system that can safely and efficiently deliver nucleic acids to target organs (e.g., the liver). The term "lipid nanoparticle" refers to nanoscale particles composed of lipids having a size measured in nanometers (e.g., 1-5,000 nm). In some embodiments, the lipids contained in the lipid nanoparticles include cationic lipids and / or ionizable lipids. Any suitable cationic lipids and / or ionizable lipids known in the art can be used to formulate LNPs for the delivery of gRNA and Cas endonucleases to cells. Exemplary cationic lipids comprise one or more positively charged amine groups. In some embodiments, the cationic lipids are ionizable such that they exist in a positively charged or neutral form depending on the pH. In some embodiments, the cationic lipids of the lipid nanoparticles contain a protonable tertiary amine head group that exhibits a positive charge at low pH. The lipid nanoparticles may also contain one or more neutral lipids (e.g., distearylphosphatidylcholine (DSPC), 1,2-dioleoyl-sn-glycerol-3-phosphate choline (DOPC), 1,2-dimyristoyl-sn-glycerol-3-phosphate ethanolamine (DMPE), 1,2-dispalmitoyl-sn-glycerol-3-phosphate ethanolamine (DPPE), etc. as co-lipids), charged lipids, steroids, and polymer-conjugated lipids. In some embodiments, the LNP may contain cholesterol. In some embodiments, the LNP may contain polyethylene glycol (PEG) lipids.

[0166] Lipid nanoparticles may contain varying concentrations of constituent lipids. In some embodiments, the molar percentage of ionizable lipids in the total lipids of the lipid nanoparticles is about, at least, at least about, at most, or at most about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or any two of these values. In some embodiments, the molar percentage of ionizable lipids in the lipid nanoparticles is in the range of about 40% to 70% (e.g., about 60%). In some embodiments, the lipid nanoparticles may also contain accessory lipids (e.g., DSPC), sterol lipids (e.g., cholesterol), and PEG lipids or phospholipid PEG conjugates. In some embodiments, the molar percentage of accessory lipids in the lipid nanoparticles is about 5% to 20% (e.g., about 10.5%), the molar percentage of sterol lipids is about 10% to 40% (e.g., about 21%), and the molar percentage of PEG lipids is about 0.5% to 10% (e.g., about 8.5%).

[0167] LNP uptake in hepatocytes can be mediated by the apolipoprotein E-low-density lipoprotein receptor (ApoE-LDLR) or the N-acetyl-D-galactosamine / desialylglycoprotein receptor pathway (GalNAc-ASGPR) (Sato et al., 2020, Journal of Controlled Release, 322, 217-226.). In some embodiments, the LNPs described herein for delivering gRNA and Cas endonucleases to cells can be formulated to follow the ApoE-LDLR uptake pathway. In some embodiments, the LNPs described herein for delivering gRNA and Cas endonucleases to cells can be formulated to follow the GalNAc-ASGPR uptake pathway. In some embodiments, the LNP formulations described herein can be used to treat subjects with a disease or condition characterized by heterozygous (HeFH) or homozygous (HoFH) loss of low-density lipoprotein receptor (LDLR).

[0168] In some embodiments, the lipid nanoparticles comprise N-acetylgalactosamine (GalNAc), an aminoglycoside derivative of galactose. In some embodiments, GalNAc is present in the LNP at a molar percentage of about, at least, at least about, at most, or at most about 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, or 6.0%. In some embodiments, GalNAc is present in the LNP at a molar percentage of about 2.5%. In some embodiments, the lipid nanoparticles disclosed herein do not contain GalNAc. In some embodiments, the lipid nanoparticles comprise a molar percentage of not more than about 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.05%, 0.01%, 0.005%, 0.001%, or less of GalNAc.

[0169] In some embodiments, the concentration of nanoparticles in the compositions disclosed herein is about 58.2 mg / mL (e.g., as a percentage of total lipids), and the nanoparticles are complexed with nucleic acids totaling about 2 mg / mL of (a) ALAS1 gRNA and (b) Cas9 mRNA. In some embodiments, the concentration of more than one nanoparticle is about 58.2 mg / mL, and the nanoparticles are complexed with (a) about 1.5 mg / mL of ALAS1 gRNA and (b) about 0.5 mg / mL of Cas9 mRNA.

[0170] In different embodiments, the relative amounts of total RNA ((a) ALAS1 gRNA targeting the ALAS1 gene or nucleic acid encoding gRNA targeting the ALAS1 gene, and (b) nucleic acid encoding RNA-directed endonuclease) and total lipids in the nanoparticles can vary. For example, the nanoparticles may have a total lipid to total RNA ratio of about 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 21:1, 22:1, 23:1, 24:1, 25:1, 26:1, 27:1, 28:1, 29:1, or 30:1. In some embodiments, the nanoparticles may have a total lipid to total RNA ratio of about 30:1. In some embodiments, the nanoparticles may have a total lipid to total RNA molar ratio of about 30:1, 31:1, 32:1, 33:1, 34:1, 35:1, 36:1, 37:1, 38:1, 39:1, 40:1, 41:1, 42:1, 43:1, 44:1, 45:1, 46:1, 47:1, 48:1, 49:1, or 50:1. In some embodiments, the nanoparticles may have a total lipid to total RNA molar ratio of about 40:1.

[0171] In some embodiments, the concentration of nanoparticles in the compositions disclosed herein (e.g., as a percentage of total lipids) is about, at least, at least about, at most, or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43. 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 mg / mL or any number or range between any two of these values. In some embodiments, the RNA in the nanoparticles is formulated at a concentration of about, at least, at least about, at most or at most about 50, 75, 100, 200, 400, 600, 800, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000 μg / ml or any number or range between these values.

[0172] The amounts of the nanoparticles (e.g., the relative amounts of (a) ALAS1 gRNA or nucleotide encoding gRNA targeting the ALAS1 gene and (b) nucleotide encoding RNA-guided endonuclease (e.g., mRNA encoding Cas protein (e.g., Cas9 mRNA)) can vary. For example, the nanoparticles may have a 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, 3:1, 4:1, or 5:1 ratio (by weight) of nucleotides encoding RNA-guided endonuclease (e.g., SpCas9 mRNA) and ALAS1 gRNA. In some embodiments, the nanoparticles may have nucleotides encoding RNA-guided endonuclease and ALAS1 gRNA in a 3:1 ratio (by weight).

[0173] In some implementations, more than one nanoparticle is administered to the subject at a dose of about 0.01-5 mg / kg (determined by the total nucleic acid (e.g., the sum of ALAS1 gRNA and Cas9 mRNA)) per administration. For example, a single dose of more than one nanoparticle administered to a subject, or each dose may be in the form of 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 4 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 2 ...3 mg / kg, 3 mg / kg, 4 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, Nanoparticles containing total RNA (e.g., the sum of ALAS1 gRNA and Cas9 mRNA) in doses of mg / kg, 4.5 mg / kg, or 5 mg / kg, or any two of these values ​​or ranges thereof. In some embodiments, more than one nanoparticle is administered to the subject at doses of 0.1 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, or 3 mg / kg, or at doses of about 0.1 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, or 3 mg / kg (determined by the sum of ALAS1 gRNA and Cas9 mRNA).

[0174] In some embodiments, the lipid nanoparticles may have an average diameter of about, at least, at least about, at most, or at most about the following: 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, or any number or range between two of these values. In some embodiments, the lipid nanoparticle size is about 50 nm to about 100 nm in diameter, or about 70 nm to about 90 nm in diameter, or about 55 nm to about 95 nm in diameter.

[0175] In some embodiments, the compounds of the compositions described herein are encapsulated in the lipid portion of lipid nanoparticles or in an aqueous space encapsulated in some or all of the lipid portion of the lipid nanoparticles. Encapsulation can be complete, partial, or both. In some embodiments, nucleic acids and / or peptides are completely or substantially encapsulated (e.g., greater than 90% RNA) in the lipid nanoparticles.

[0176] In some embodiments, one or more compounds described herein are associated with liposomes or lipid nanoparticles via covalent or non-covalent bonds. In some embodiments, any compound in the composition may be contained alone or together in liposomes or lipid nanoparticles.

[0177] Recombinant adeno-associated virus (AAV) vectors can be used for delivery. Techniques for generating rAAV particles are standard in the art, wherein an AAV genome to be packaged, comprising the polynucleotide to be delivered, rep and cap genes, and helper viral functions, is provided to a cell. RAAV generation typically requires the presence of the following components within a single cell (referred to herein as a packaging cell): the rAAV genome, the AAV rep and cap genes separated from the rAAV genome (i.e., not in the rAAV genome), and helper viral functions. The AAV rep and cap genes can be derived from any AAV serotype from which recombinant viruses can be derived, and can be derived from AAV serotypes different from the rAAV genomic ITR, including but not limited to the AAV serotypes described herein. The generation of pseudotyped rAAV is disclosed, for example, in International Patent Application Publication No. WO 2001 / 83692.

[0178] AAV particles packaging polynucleotides (e.g., endonucleases, donor sequences, or RNA-directing molecules of the compositions of this disclosure) may comprise or be derived from any natural or recombinant AAV serotype. According to this disclosure, AAV particles may utilize or be based on serotypes selected from, but not limited to, any of the following serotypes and their variants: AAV1, AAV10, AAV106.1 / hu.37, AAV11, AAV114.3 / hu.40, AAV12, AAV127.2 / hu.41, AAV127.5 / hu.42, AAV128.1 / hu.43, AAV128.3 / hu.44, AAV130.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55, AAV16.12 / hu. .11, AAV16.3, AAV16.8 / hu.10, AAV161.10 / hu.60, AAV161.6 / hu.61, AAVl-7 / rh.48, AAVl-8 / rh.49, AAV2, AAV2.5T, AAV2-15 / rh.62, AAV22 3.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6, AAV223.7, AAV2-3 / rh.61, AAV24.1, AAV2-4 / rh.50, AAV2-5 / rh.51, AAV27.3, AAV29.3 / bb.1 , AAV29.5 / bb.2, AAV2G9, AAV-2-pre-miRNA-101, AAV3, AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-11 / rh.53, AAV3-3, AAV33.12 / hu.17, AAV33.4 / h u.l5, AAV33.8 / hu.16, AAV3-9 / rh.52, AAV3a, AAV3b, AAV4, AAV4-19 / rh.55, AAV42.12, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15 , AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AA V43-21, AAV43-23, AAV43-25, AAV43-5, AAV4-4, AAV44.1, AAV44.2, AAV44.5, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV4-8 / r11.64, AAV4-8 / rh.64、AAV4-9 / rh.54、AAV5、AAV52.1 / hu.20、AAV52 / hu.19、AAV5-22 / rh.58、AAV5-3 / rh.57、AAV54.1 / hu.21、AAV54.2 / hu.22、AAV54.4R / hu.27、AAV54.5 / hu.23、AAV54.7 / hu.24、AAV58.2 / hu.25、AAV6、AAV6.1、AAV6.1.2、AAV6.2、AAV7、AAV7.2、AAV7.3 / hu.7、AAV8、AAV-8b、AAV-8h、AAV9、AAV9.11、AAV9. 13、AAV9.16、AAV9.24、AAV9.45、AAV9.47、AAV9.61、AAV9.68、AAV9.84、AAV9.9、AAVA3.3、AAVA3.4、AAVA3.5、AAVA3.7、AAV-b、AAVC1、AAVC2、AAVC5 VCh.5、AAVCh.5Rl、AAVcy.2、AAVcy.3、AAVcy.4、AAVcy.5、AAVCy.5Rl、AAVCy.5R2、AAVCy.5R3、AAVCy.5R4、AAVcy.6、AAV-DJ、AAV-DJ8、AAVF3、AAVF5、AAVcy. V-h、AAVH-l / hu.1、AAVH2、AAVH-5 / hu.3、AAVH6、AAVhE1.1、AAVhER1.14、AAVhEr1.16、AAVhEr1.18、AAVhEr1.23、AAVhEr1.35、AAVhEr1.36、AAVhEr1.5 、AAVhEr1.7、AAVhEr1.8、AAVhEr2.16、AAVhEr2.29、AAVhEr2.30、AAVhEr2.31、AAVhEr2.36、AAVhEr2.4、AAVhEr3.1、AAVhu.1、AAVhu.10、AAVhu.11、AA Vhu.12、AAVhu.13、AAVhu.14 / 9、AAVhu.15、AAVhu.16、AAVhu.17、AAVhu.18、AAVhu.19、AAVhu.2、AAVhu.20、AAVhu.21、AAVhu.22、AAVhu.23、AAVhu.2. 24、AAVhu.25、AAVhu.27、AAVhu.28、AAVhu.29、AAVhu.29R、AAVhu.3、AAVhu.31、AAVhu.32、AAVhu.34、AAVhu.35、AAVhu.37、AAVhu.39、AAVhu.4、AAVhu.40、AAVhu.41、AAVhu.42、AAVhu.43、AAVhu.44、AAVhu.44R1、AAVhu.44R2、AAVhu.44R3、AAVhu.45、AAVhu.46、AAVhu.47、AAVhu.48、AAVhu.48R1、AAVhu.48R2、AAVhu.48R3、AAVhu.49、AAVhu.5、AAVhu.51、AAVhu.52、AAVhu.53、AAVhu.54、AAVhu.55、AAVhu.56、AAVhu.57、AAVhu.58、AAVhu.6、AAVhu.60、AAVhu.61、AAVhu.63、AAVhu.64、AAVhu.66、AAVhu.67、AAVhu.7、AAVhu.8、AAVhu.9、AAVhu.t 19、AAVLG-10 / rh.40、AAVLG-4 / rh.38、AAVLG-9 / hu.39、AAVLG-9 / hu.39、AAV-LK01、AAV-LK02、AAVLK03、AAV-LK03、AAV-LK04、AAV-LK05、AAV-LK06、AAV-LK07、AAV-LK08、AAV-LK09、AAV-LK10、AAV-LK11、AAV-LK12、AAV-LK13、AAV-LK14、AAV-LK15、AAV-LK17、AAV-LK18、AAV-LK19、AAVN721-8 / rh.43、AAV-PAEC、AAV-PAEC11、AAV-PAEC12、AAV-PAEC2、AAV-PAEC4、AAV-PAEC6、AAV-PAEC7、AAV-PAEC8、AAVpi.1、AAVpi.2、AAVpi.3、AAVrh.10、AAVrh.12、AAVrh.13、AAVrh.13R、AAVrh.14、AAVrh.17、AAVrh.18、AAVrh.19、AAVrh.2、AAVrh.20、AAVrh.21、AAVrh.22、AAVrh.23、AAVrh.24、AAVrh.25、AAVrh.2R、AAVrh.31、AAVrh.32、AAVrh.33、AAVrh.34、AAVrh.35、AAVrh.36、AAVrh.37、AAVrh.37R2、AAVrh.38、AAVrh.39、AAVrh.40、AAVrh.43、AAVrh.44、AAVrh.45、AAVrh.46、AAVrh.47、AAVrh.48、AAVrh.48、AAVrh.48.1、AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.50, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh. 54. AAVrh.55, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.59, AAVrh.60, AAVrh.61, AAVr h.62, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.65, AAVrh.67, AAVrh.68, AAVrh.6 9. AAVrh.70, AAVrh.72, AAVrh.73, AAVrh.74, AAVrh.8, AAVrh.8R, AAVrh8R, AAVrh8R A586R mutant, AAVrh8R R533A mutant, BAAV, BNP61 AAV, BNP62 AAV, BNP63 AAV, Bovidae AAV, Goat AAV, Japanese AAV10, Prototype AAV (ttAAV), UPENN AAV10, AAV-LK16, AAAV, AAV Shuffle 100-1, AAV Shuffle 100-2, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV SM 100-10, AAV SM 100-3, AAV SM 10-1, AAV SM 10-2, and / or AAV SM 10-8.

[0179] In some implementations, the AAV serotype is or has mutations in the AAV9 sequence as described in N Pulicherla et al. (Molecular Therapy 19(6): 1070-1078 (2011)), such as, but not limited to, AAV9.9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, and AAV9.84.

[0180] In some embodiments, the AAV serotype is or has a sequence as described in U.S. Patent No. 6,156,303, such as, but not limited to, AAV3B (SEQ ID NOs: 1 and 10 of US 6,156,303), AAV6 (SEQ ID NOs: 2, 7 and 11 of US 6,156,303), AAV2 (SEQ ID NOs: 3 and 8 of US 6,156,303), AAV3A (SEQ ID NOs: 4 and 9 of US 6,156,303), or derivatives thereof.

[0181] In some embodiments, the serotype may be AAVDJ or a variant thereof, such as AAVDJ8 (or AAV-DJ8), as described by Grimm et al. (Journal of Virology 82(12): 5887-5911 (2008)). The amino acid sequence of AAVDJ8 may contain two or more mutations to remove the heparin-binding domain (HBD). As a non-limiting example, the AAV-DJ sequence described in U.S. Patent No. 7,588,772 as SEQ ID NO: 1 may contain two mutations: (1) R587Q, wherein arginine (R; Arg) at amino acid 587 is replaced with glutamine (Q; Gln) and (2) R590T, wherein arginine (R; Arg) at amino acid 590 is replaced with threonine (T; Thr). As another non-limiting example, it may contain three mutations: (1) K406R, in which lysine (K; Lys) at amino acid 406 is replaced with arginine (R; Arg), (2) R587Q, in which arginine (R; Arg) at amino acid 587 is replaced with glutamine (Q; Gln) and (3) R590T, in which arginine (R; Arg) at amino acid 590 is replaced with threonine (T; Thr).

[0182] In some implementations, the AAV serotype is or has a sequence as described in International Publication No. WO2015121501, such as, but not limited to, prototype AAV (ttAAV) (SEQ ID NO: 2 of WO2015121501), “UPenn AAV10” (SEQ ID NO: 8 of WO2015 / 121501), “Japanese AAV10” (SEQ ID NO: 9 of WO2015 / 121501), or variants thereof.

[0183] According to this disclosure, the selection or use of AAV capsid serotypes can be derived from a variety of species. In some embodiments, AAV is avian AAV (AAAV). The AAAV serotype can be or has a sequence as described in U.S. Patent No. 9,238,800, such as, but not limited to, AAAV (SEQ ID NOs: 1, 2, 4, 6, 8, 10, 12, and 14 of US 9,238,800) or variants thereof.

[0184] In some embodiments, AAV is bovine AAV (BAAV). The BAAV serotype can be or has a sequence as described in U.S. Patent No. 9,193,769, such as, but not limited to, BAAV (SEQ ID NOs: 1 and 6 of US9,193,769) or variants thereof. The BAAV serotype can be or has a sequence as described in U.S. Patent No. 7,427,396, such as, but not limited to, BAAV (SEQ ID NOs: 5 and 6 of US7,427,396) or variants thereof.

[0185] In some embodiments, AAV is caprine AAV. The caprine AAV serotype may be or have the sequence described in U.S. Patent No. 7,427,396, such as, but not limited to, caprine AAV (SEQ ID NO:3 of US7,427,396) or a variant thereof.

[0186] In some embodiments, AAV is engineered as a heterozygous AAV derived from two or more parental serotypes. In some embodiments, the AAV is AAV2G9, which comprises sequences from AAV2 and AAV9. The AAV2G9 AAV serotype can be or has the sequences described in US2016 / 0017005.

[0187] In some implementations, AAV is a serotype generated from an AAV9 capsid library with a mutation at amino acid 390-627 (VPl number), as described by Pulicherla et al. (Molecular Therapy 19(6): 1070-1078(2011)). The serotype and corresponding nucleotide and amino acid substitutions can be, but are not limited to: AAV9.1 (G1594C; D532H), AAV6.2 (T1418A and T1436X; V473D and I479K), AAV9.3 (T1238A; F413Y), AAV9.4 (T1250C and A1617T; F417S), AAV9.5 (A1235G, A1314T, A1642G, C1760T; Q412R, T548A, A587V), AAV9.6 (T1231A; F411I), AAV9.9 (G1203A, G1785T; W595C), AAV9.10 (A1500G, T1676C; M559T), AAV9.11 (A1425T, A1702C, A1769T; T568P, Q590L), AAV9.13 (A1369C, A1720T; N457H, T574S), AAV9.14 (T1340A, T1362C, T1560C, G1713A; L447H), AAV9.16 (A1775T; Q592L), AAV9.24 (T1507C, T1521G; W503R), AAV9.26 (A1337G, A1769C; Y446C, Q590P), AAV9.33 (A1667C; D556A), AAV9.34 (A1534G, C1794T; N512D), AAV9.35 (A1289T, T1450A, C1494T, A1515T, C1794A, G1816A; Q430L, Y484N, N98K, V606I), AAV9.40 (A1694T, E565V), AAV9.41 (A1348T, T1362C; T450S), AAV9.44 (A1684C, A1701T, A1737G; N562H, K567N), AAV9.45 (A1492T, C1804T; N498Y, L602F), AAV9.46 (G1441C, T1525C, T1549G; G481R, W509R, L517V), 9.47 (G1241A, G1358A, A1669G, C1745T; S414N, G453D, K557E, T582I), AAV9.48 (C1445T, A1736T; P482L, Q579L), AAV9.50 (A1638T, C1683T, T1805A; Q546H, L602H), AAV9.53 (G1301A, A1405C, C1664T, G1811T; R134Q, S469R, A555V, G604V), AAV9.54 (C1531A, T1609A; L511I, L537M), AAV9.55 (T1605A; F535L), AAV9.58 (C1475T, C1579A; T492I, H527N), AAV.59 (T1336C; Y446H), AAV9.61 (A1493T; N498I), AAV9.64 (C1531A, A1617T; L511I), AAV9.65 (C1335T, T1530C, C1568A; A523D), AAV9.68 (C1510A; P504T), AAV9.80 (G1441A,;G481R), AAV9.83 (C1402A, A1500T; P468T, E500D), AAV9.87 (T1464C, T1468C; S490P), AAV9.90 (A1196T; Y399F), AAV9.91 (T1316G, A1583T, C1782G, T1806C; L439R, K528I), AAV9.93 (A1273G, A1421G, A1638C, C1712T, G1732A, A1744T, A1832T; S425G, Q474R, Q546H, P571L, G578R, T582S, D611V), AAV9.94 (A1675T; M559L) and AAV9.95 (T1605A; F535L).

[0188] In some embodiments, AAV is a serotype containing at least one AAV capsid CD8+ T cell epitope. As a non-limiting example, the serotype may be AAV1, AAV2, or AAV8. In some embodiments, AAV may be a variant, such as PHP.A or PHP.B as described in Deverman et al. 2016, Nature Biotechnology. 34(2): 204-209.

[0189] The general principles of rAAV production are summarized in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbial, and Immunol., 158:97-129. Various methods are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984); Tratschin et al., Mol. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62: 1963 (1988); and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988); Samulski et al. (1989, J. Virol., 63:3822-3828); U.S. Patent No. 5,173,414; WO 95 / 13365 and the corresponding U.S. Patent No. 5,658,776; WO 95 / 13392; WO WO97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al. (1995) Vaccine 13: 1244-1250; Paul et al. (1993) Human Gene Therapy 4:609-615; Clark et al. (1996) Gene Therapy 3:1124-1132; U.S. Patent No. 5,786,211; U.S. Patent No. 5,871,982; and U.S. Patent No. 6,258,595.

[0190] AAV vector serotypes can be matched with target cell types. For example, the following exemplary cell types can be transduced using the AAV serotypes shown.

[0191] In addition to adeno-associated virus vectors, other viral vectors can be used. These viral vectors include, but are not limited to, lentiviruses, alphaviruses, enteroviruses, hemorrhagic viruses, baculoviruses, herpesviruses, Epstein-Barr virus (EBV), papillomaviruses, poxviruses, vaccinia virus, and herpes simplex virus.

[0192] In some implementations, Cas9 mRNA, sgRNA targeting one or two loci of the ALAS1 gene, and donor DNA can be individually formulated into lipid nanoparticles or all of them can be co-formulated into a single lipid nanoparticle.

[0193] In some implementations, Cas9 mRNA can be formulated in lipid nanoparticles, while sgRNA and donor DNA can be delivered in an AAV vector.

[0194] Cas9 nuclease can be delivered as a DNA plasmid, mRNA, or protein. The guide RNA can be expressed from the same DNA or delivered as RNA. RNA can be chemically modified to alter or improve its half-life, or to reduce the likelihood or extent of an immune response. The endonuclease protein can be complexed with gRNA prior to delivery. Viral vectors allow for efficient delivery; the splitting form of Cas9 and smaller orthologs of Cas9 can be packaged in AAVs, as can the HDR donor. A range of non-viral delivery methods exist that can deliver each of these components, or non-viral and viral methods can be used in tandem. For example, nanoparticles can be used to deliver both proteins and guide RNA, while AAVs can be used to deliver donor DNA.

[0195] The compositions described above may also contain one or more additional reagents, wherein such additional reagents are selected from buffers, buffers for introducing peptides or polynucleotides into cells, wash buffers, control reagents, control vectors, control RNA polynucleotides, reagents for generating peptides from DNA in vitro, adaptors for sequencing, etc. The buffers may be stabilization buffers, remodeling buffers, dilution buffers, etc. In some embodiments, the compositions may also contain one or more components that can promote or enhance the mid-target binding or cleavage of DNA by endonucleases or improve the specificity of the target.

[0196] Depending on the specific administration route and dosage form, one or more components of the composition may be formulated with pharmaceutically acceptable excipients such as carriers, solvents, stabilizers, adjuvants, diluents, etc. In some embodiments, the guide RNA composition is typically formulated to achieve a physiologically compatible pH, ranging from about 3 to about 11, or from about 3 to about 7, depending on the formulation and route of administration. In some embodiments, the pH is adjusted to a range from about pH 5 to about pH 8.

[0197] Suitable excipients may include, for example, carrier molecules, which include large, slowly metabolizing macromolecules such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polyamino acids, amino acid copolymers, and inactive viral particles. Other exemplary excipients include antioxidants (e.g., but not limited to ascorbic acid), chelating agents (e.g., but not limited to EDTA), sugars (e.g., but not limited to dextrin, hydroxyalkyl cellulose, and hydroxyalkyl methyl cellulose), stearic acid, liquids (e.g., but not limited to oils, water, saline, glycerol, and ethanol), wetting agents or emulsifiers, pH buffers, etc.

[0198] Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions containing no substances other than the active ingredient and water, or containing buffers such as sodium phosphate at physiological pH, physiological saline, or both, such as phosphate-buffered saline. Aqueous carriers may contain more than one buffer salt, as well as salts (such as sodium chloride and potassium chloride), dextran, polyethylene glycol, and other solutes. Liquid compositions may also contain a liquid phase in addition to water, or a liquid phase without water. Examples of such additional liquid phases are glycerol, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of active compound used in cellular compositions for the effective treatment of a particular disease or condition will depend on the nature of the disease or condition and can be determined using standard clinical techniques.

[0199] As used herein, the term “stable” or “stability” can refer to the ability of a compound described herein (e.g., an RNA-directed endonuclease or a nucleic acid and / or gRNA encoding an RNA-directed endonuclease) to maintain its therapeutic efficacy (e.g., all or most of its intended biological activity and / or physicochemical integrity) over an extended period of time. The stability of one or more compounds described herein (e.g., RNA-directed endonucleases or nucleic acids and / or gRNAs encoding RNA-directed endonucleases and nanoparticles) can be 2 weeks, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 3 weeks, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 31 days, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 20 months, 21 months, 22 months, 23 months, 2 years, 3 years, or more than 3 years. Storage temperature may vary. For example, the storage temperature can be, can be about, can be at least, or can be at least about -80°C, -65°C, -20°C, 5°C, or a number or range between any two of these values. In some embodiments, the storage temperature is less than or equal to -65°C.

[0200] In some embodiments, the compounds described herein (e.g., RNA-directed endonucleases or nucleic acids and / or gRNAs encoding RNA-directed endonucleases) of the composition can be delivered via transfection, such as calcium phosphate transfection, DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, electronuclear transport, chemical transduction, electrotransduction, Lipofectamine-mediated transfection, Effectene-mediated transfection, lipid nanoparticle (LNP)-mediated transfection, or any combination thereof. In some embodiments, lipid nanoparticles are used to introduce the composition into cells via lipid-mediated transfection.

[0201] The compositions described herein can be administered to subjects in need of treating ALAS1-related conditions. Therefore, this disclosure also provides a gene therapy approach for treating ALAS1-related conditions in subjects by editing the ALAS1 gene. In some embodiments, the ALAS1 gene in relevant cells (e.g., hepatocytes) in a subject is edited using the materials and methods described herein, which employ an RNA-directed endonuclease (e.g., Cas9) to edit a target sequence from the genome, resulting in reduced ALAS1 expression in the liver. This provides a long-term or permanent cure for ALAS1-related conditions and prevents attacks such as acute porphyria by permanently reducing ALAS1 protein levels and / or preventing ALAS1 upregulation. The term “related,” as used herein, refers to a relationship between two items (e.g., ALAS1 and disease / condition) such that the presence of one item (e.g., ALAS1 protein level) is accompanied by the presence of another item (e.g., disease or condition), including but not limited to causal relationships and sign / symptom-disease relationships.

[0202] As described herein, in some embodiments, nanoparticles (e.g., LNPs containing ionizable lipids) complexed with (a) a guide RNA (gRNA) targeting the ALAS1 gene or nucleic acid encoding a gRNA targeting the ALAS1 gene and (b) nucleic acid encoding an RNA-guided endonuclease (e.g., Cas9 mRNA) are administered via IV infusion to subjects in need. Administration may be, for example, a single dose or two or more doses. The nanoparticles may, for example, be rapidly distributed to, for example, the liver of the subject, and the nanoparticles may enter the subject's hepatocytes (e.g., via endocytosis). In some embodiments, ionizable lipid disruption of the endosome may destroy the nanoparticles, thereby releasing the nucleic acid encoding an RNA-guided endonuclease (e.g., Cas9 mRNA) from the nanoparticles. An RNA-guided endonuclease (e.g., Cas9) may be synthesized and an endonuclease-gRNA RNP complex may be formed to achieve gene editing. In some embodiments, endogenous DNA repair via non-homologous end joining (NHEJ) results in the introduction of an insertion / deletion into the ALAS1 gene, leading to a frameshift mutation that prevents the production of the functional ALAS1 protein. In some implementations, the methods disclosed herein result in regulation (e.g., reduction) of ALAS1 expression. As demonstrated herein, robust on-target editing of the ALAS1 gene without off-target editing can be achieved using the methods, compositions, systems, and kits described herein.

[0203] This disclosure includes methods for treating diseases or conditions caused by overexpression of 5'-aminolevulinic acid synthase 1 (ALAS1) in subjects with appropriate need. In some embodiments, the method includes administering any of the compositions disclosed herein to the subject to treat the disease or condition caused by ALAS1 overexpression in the subject. This disclosure also includes methods for treating subjects who have or are suspected of having porphyria. In some embodiments, the method includes administering any of the compositions disclosed herein to the subject to treat porphyria.

[0204] This disclosure includes methods for treating diseases or conditions caused by ALAS1 overexpression in subjects with appropriate need. In some embodiments, the methods include administering to the subject a composition comprising more than one nanoparticle in combination with: (a) a guide RNA (gRNA) targeting an ALAS1 genomic locus, the gRNA comprising a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112, or a nucleic acid encoding the gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease, thereby treating diseases or conditions caused by ALAS1 overexpression in the subject.

[0205] The disclosure herein includes methods for treating subjects who have or are suspected of having porphyria. In some embodiments, the method includes administering to the subject a composition comprising more than one nanoparticle in combination with: (a) a gRNA targeting the ALAS1 genomic locus, the gRNA comprising a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112, or a nucleic acid encoding the gRNA; and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease, thereby treating porphyria.

[0206] The Cas9 endonuclease can be, for example, *Streptococcus pyogenes* Cas9, *Staphylococcus aureus* Cas9, *Neisseria meningitidis* Cas9, *Streptococcus thermophilus* CRISPR1 Cas9, *Streptococcus thermophilus* CRISPR3 Cas9, or *Treponema denticulatum* Cas9. More than one nanoparticle can be a lipid nanoparticle. Lipid nanoparticles can contain one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-conjugated lipids. Lipid nanoparticles can contain cholesterol, polyethylene glycol (PEG) lipids, or both.

[0207] The method may include administering the composition to a subject in a single dose of (a) and (b) total nucleic acids of about 0.1 mg / kg, 0.3 mg / kg, 0.6 mg / kg, 1.0 mg / kg or 2.0 mg / kg or more. For example, a single dose of more than one nanoparticle administered to a subject, or each dose may be in the form of 0.01 mg / kg, 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1 mg / kg, 1.1 mg / kg, 1.2 mg / kg, 1.3 mg / kg, 1.4 mg / kg, 1.5 mg / kg, 1.6 mg / kg, 1.7 mg / kg, 1.8 mg / kg, 1.9 mg / kg, 2 mg / kg, 2.1 mg / kg, 2.2 mg / kg, 2.3 mg / kg, 2.4 mg / kg, 2.5 mg / kg, 2.6 mg / kg, 2.7 mg / kg, 2.8 mg / kg, 2.9 mg / kg, 3 mg / kg, 3.5 mg / kg, 4 mg / kg, 4 mg / kg, 2 ...3 mg / kg, 3.5 mg / kg, 4 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, 3 mg / kg, 3 mg / kg, 4 mg / kg, 2 mg / kg, 2 mg / kg, 2 mg / kg, Nanoparticles containing total RNA (e.g., the sum of ALAS1 gRNA and Cas9 mRNA) in doses of mg / kg, 4.5 mg / kg, or 5 mg / kg, or any two of these values ​​or ranges thereof. In some embodiments, more than one nanoparticle is administered to the subject at doses of 0.1 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, or 3 mg / kg, or about 0.1 mg / kg, 0.3 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 1 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, or 3 mg / kg (determined by the sum of ALAS1 gRNA and SpCas9 mRNA).

[0208] This method may include a single administration of the composition to a subject. The compositions described herein (e.g., an LNP containing ALAS1 gRNA or a nucleic acid encoding ALAS1 gRNA; and a nucleic acid encoding an RNA-directed endonuclease) may be administered to a subject with the appropriate need once or more, such as once, twice, three times, four times, five times, or six times. In some embodiments, a single administration of the composition to a subject may be advantageous. In some embodiments, up to three administrations of the composition to a subject (e.g., one, two, or three administrations) may be advantageous. Any two administrations may be spaced, for example, from one day to one year. For example, the first administration may be spaced 1 to 21 days or about 1 to 21 days from the second administration (e.g., one day, two days, three days, four days, five days, six days, seven days, ten days, two weeks, three weeks, or any two of these values ​​or a range thereof). As another example, the second application may be spaced from one day to one year or about one day to one year after the third application (e.g., one day, two days, three days, four days, five days, six days, seven days, two weeks, three weeks, four weeks, five weeks, six weeks, two months, three months, six months, one year, or any two of these values ​​or a range thereof). When there are three or more applications, the length of the interval between any two adjacent applications may be the same or different. For example, in some embodiments, the first application is about one week (e.g., 7 days) after the second application, and the second application is about five weeks (e.g., 35 days) after the third application. In some embodiments, the methods described herein do not include periodic, scheduled application of the composition, such as every two days, every three days, every five days, weekly, every two weeks, monthly, every two months, quarterly, every two quarters, annually, or every two years. In some embodiments, the methods described herein do not include application of the composition three months, six months, nine months, one year, two years, or longer after the first, second, or third application of the composition. In some embodiments, the methods described herein do not include any application of the composition after the second or third application of the composition. For example, in some embodiments, the methods described herein can be effective in such cases that a subject, after a single treatment with the composition described herein, does not require any additional treatment for ALAS1-related conditions (such as porphyria) for the rest of their life.

[0209] ALAS1 expression in subjects may be reduced (e.g., after administration). ALAS1 expression may be reduced in the liver of subjects. The reduction may be relative to (a) ALAS1 expression in subjects before administration of the composition; (b) ALAS1 expression in one or more untreated subjects; and / or (c) a reference level of ALAS1 expression in healthy subjects. ALAS1 expression in subjects may be reduced by at least 20% after administration. ALAS1 mRNA expression may be reduced by at least 90% after administration. ALAS1 protein expression may be reduced by at least 75% after administration. In some embodiments, ALAS1 (e.g., ALAS1 mRNA) is reduced after administration. The expression of mRNA and / or ALAS1 protein was reduced by approximately, at least, or at least about 20% in the subjects (e.g., 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%). 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between these values. In some implementations, genetic modification of the ALAS1 gene results in a significant reduction in ALAS1 protein or mRNA in the liver.In some implementations, ALAS1 protein or mRNA levels were reduced by 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, and 59%. 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values. In some implementations, the methods described herein can reduce the level of ALAS1 protein or mRNA in the liver by about, at least, or at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any two of these values ​​or a range thereof.

[0210] In some embodiments, after administration of the composition, the level of ALAS1 mRNA in the urine of a subject decreases; and said decrease is relative to (a) the ALAS1 mRNA level of the subject before administration of the composition; (b) the ALAS1 mRNA level in one or more untreated subjects; and / or (c) a reference level of ALAS1 mRNA in a healthy subject. In some embodiments, the method described herein can reduce the level of ALAS1 mRNA in urine by about, at least, or at least about 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%. 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values.

[0211] In some embodiments, genetic modification of the ALAS1 gene results in a significant reduction in the levels of plasma porphyrin, uroporphyrin, fecal porphyrin, or any combination thereof. In some embodiments, the reductions in plasma porphyrin, uroporphyrin, and / or fecal porphyrin levels are 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 5 9%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values. In some implementations, the methods described herein can reduce plasma porphyrin, urinary porphyrin, and / or fecal porphyrin levels by about, at least, or at least about 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values.

[0212] In some embodiments, genetic modification of the ALAS1 gene results in a significant reduction in plasma and / or urinary levels of 5-aminolevulinic acid (e.g., δ-aminolevulinic acid, such as ALA) in subjects (e.g., mammals, NHPs, human subjects). In some embodiments, genetic modification of the ALAS1 gene results in a significant reduction in plasma and / or urinary bilirubinogen (PBG) levels in subjects (e.g., mammals, NHPs, human subjects).

[0213] In some implementations, the ALAS1 protein and / or ALAS1 mRNA levels in genetically modified subjects (e.g., mammals, NHPs, human subjects) are approximately, less than, or less than approximately 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, and 56% compared to their unmodified counterparts in mammals. 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

[0214] In some embodiments, the frequency of acute porphyria attacks is reduced in subjects compared to subjects prior to administration of any of the compositions disclosed herein. In some embodiments, the frequency of acute porphyria attacks is reduced by about, at least, or at least about 5% or more (e.g., 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%) compared to subjects prior to administration of any of the compositions disclosed herein. %, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, or any number or range between any two of these values). In some implementations, the subject did not experience an attack of acute porphyria after administration.

[0215] The reduction can last for at least two weeks, at least three weeks, at least four weeks, or at least one month.

[0216] This method may include administering a therapeutically effective amount of at least one additional therapeutic agent to the subject. The additional therapeutic agent may be or contain hydroxyheme (e.g., heme chloride), arginine heme, ALAS1-specific siRNA, or a combination thereof. In some embodiments, the additional treatment is administered to the subject 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, or longer before administering the more than one nanoparticle. In some embodiments, the additional treatment is administered to the subject up to 2 hours before administering the more than one nanoparticle. In some embodiments, the additional treatment and the more than one nanoparticle are administered simultaneously.

[0217] In some embodiments, the method may include administering to a subject a therapeutically effective amount of at least one additional therapeutic agent to treat one or more symptoms of porphyria (e.g., acute porphyria). In some embodiments, the additional treatment is an analgesic (e.g., acetaminophen, opioids, or nonsteroidal anti-inflammatory drugs (NSAIDs) or combinations thereof). In some embodiments, the additional therapeutic agent may be a phenothiazine (e.g., chlorpromazine) to relieve, for example, nausea. In some embodiments, insomnia may be treated with non-barbiturate hypnotics such as chloral hydrate or benzodiazepines. In some embodiments, seizures may be treated with, for example, levetiracetam. In some embodiments, the additional treatment is siRNA therapy.

[0218] In some implementations, the subject has or is suspected of having cutaneous porphyria. Cutaneous porphyria can be congenital erythropoietic porphyria (CEP), hepatic erythropoietic porphyria (HEP), tarda porphyria (PCT), or erythropoietic protoporphyria and X-linked porphyria (EP / XLP). In some implementations, the subject has, is suspected of having, or has already had acute porphyria. Acute porphyria can be acute intermittent porphyria (AIP), hereditary coprophyria (HCP), variant porphyria (VP), or δ-aminolevulinic acid dehydratase deficiency porphyria (ADP).

[0219] As will be understood by those skilled in the art, several tests can be used to diagnose diseases or conditions associated with ALAS1 overexpression in subjects and / or to assess the status of diseases or conditions in subjects. Subjects may have elevated urinary porphyrinogen (PBG), elevated urinary aminolevulinic acid (ALA), elevated urinary porphyrin, elevated fecal porphyrin, elevated plasma porphyrin, or any combination thereof, compared to reference values.

[0220] Following administration of the composition, the levels of urobilinogen (PBG), uroaminolevulinic acid (ALA), uroporphyrin, fecal porphyrin, plasma porphyrin, or any combination thereof in the subject may be reduced.

[0221] In some embodiments, the subject has or is suspected of having a mutation in at least one gene selected from the group consisting of: ALAS2, ALAD, HMBS, UROD, UROS, CPOX, PPOX, and FECH. The mutation can result in reduced expression, stability, and / or activity of the RNA and / or protein product of at least one gene. The mutation can be dominant or recessive. In some embodiments, the subject has a mutation in one copy of the gene (e.g., is heterozygous for the mutation). In some embodiments, the subject has a mutation in both copies of the gene (e.g., is homozygous for the mutation). In some embodiments, the mutation is dominant, for example, one copy of the mutation is sufficient to produce the mutant phenotype. In some embodiments, the mutation is recessive, for example, both copies of the gene are mutated to produce the phenotype.

[0222] In some embodiments, the target tissue for the compositions and methods described herein is liver tissue. In some embodiments, the target cells for the compositions and methods described herein are hepatocytes.

[0223] In some embodiments, the pharmaceutical composition can be administered via aerosol delivery, nasal delivery, vaginal delivery, rectal delivery, sublingual delivery, ocular delivery, local delivery, surface delivery, intracisional delivery, intraperitoneal delivery, oral delivery, intramuscular injection, intravenous injection, subcutaneous injection, intranodular injection, intratumoral injection, intraperitoneal injection, and / or intradermal injection, or any combination thereof. Administration can be local or systemic. Systemic administration includes enteral and parenteral administration. In some embodiments, more than one administration can be used to achieve desired gene expression levels at various intervals (e.g., daily, weekly, monthly, or yearly).

[0224] Pharmaceutical compositions may be administered to subjects in appropriate amounts. As used herein, the term "pharmaceutical effective amount" means the amount of a pharmaceutical composition that will elicit a desired therapeutic effect and / or biological or medical response in a tissue, system, animal, or human. Administration may result in a desired reduction in ALAS1 gene expression, such as a desired reduction in the levels of ALAS1 protein and one or more porphyrins.

[0225] Example Some aspects of the implementation schemes discussed above are further disclosed in detail in the following embodiments, which are not intended to limit the scope of this disclosure in any way.

[0226] Example 1 Methods for editing the ALAS1 gene This embodiment provides methods and compositions for editing the ALAS1 gene in, for example, mouse, monkey, and human cells.

[0227] Editing efficiency was tested in mouse, monkey, and human cell lines. Prior to transfection, cell lines were plated in 100 μL of medium per well in 96-well flat-bottomed tissue culture plates. MK2 (rhesus monkey kidney cell line) was plated one day before transfection, while Huh-7-Cas9 (human hepatocellular carcinoma cell line with constitutive SpCas9 expression) and AML12 (mouse hepatocyte cell line with constitutive SpCas9 expression) were plated on the day of transfection. Cells were plated at the following concentrations: Huh-7-Cas9: 15,000 cells / well, MK2: 20,000 cells / well, and AML12-Cas9: 30,000 cells / well. For transfection, 150 ng / well of guide material was used for Huh-7-Cas9 and AML12-Cas9, and 200 ng / well of guide material and 200 ng / well of Cas9 was used for MK2, using MessengerMAX Lipofectamine (Thermo Scientific, Waltham, MA). The plates were then incubated at 37°C. After 24 hours, the transfection mixture was removed and replaced with 100 μL of fresh medium. Cells were incubated for another 48 hours, and DNA was then isolated from the cells using the Quick-DNA 96 kit (Zymo Research, Irvine, CA). For each unique guide material, PCR was run to amplify the region of interest, and TIDE analysis was performed to determine the guide material-specific editing level.

[0228] The exemplary editing efficiencies of gRNA disclosed in this article are shown in Figures 1-3 And in Table 3.

[0229] For experiments using primary human hepatocytes (PHH, see Table 4 for example), PHH cells were thawed in 25 mL of hepatocyte thawing media (Lonza, Basel, Switzerland). Cells were centrifuged at 100 × g for 8 minutes, resuspended in 4 mL of hepatocyte plating media with plating media supplement (Lonza, Basel, Switzerland), and counted. Cells were brought to a density of 0.65 × 10⁶ cells / mL. 6 At a concentration of cells / mL, 500 μL of cells / well were seeded into CellAdhere. TM Type I collagen-coated 24-well plates (STEMCELL, Vancouver, BC). For the first hour after seeding, the plates were shaken back and forth every 10 minutes to ensure even cell distribution. The plates were then incubated at 37°C with 5% CO2. After 24 hours, the culture medium was removed and replaced with 500 μL of pre-warmed hepatocyte culture media (Lonza, Basel, Switzerland). In some experiments, INVITROGRO CP medium + TORPEDO antibiotic mixture (BioIVT, Westbury, NY) was used for thawing, seeding, and culturing cells.

[0230] PHH cells were transfected with gRNA and Cas9 mRNA at a 1:3 ratio using MessengerMAX Lipofectamine (Thermo Scientific, Waltham, MA). The culture medium was changed 3 days after transfection. Cells were incubated at 37°C and 5% CO2 for a total of 6 days. DNA was isolated from cells using the QIAamp 96 DNA QIAcube HT kit (QIAGEN, Hilden, Germany). PCR was run to amplify the region of interest, and TIDE analysis or amplicon sequencing was performed to determine the guide-specific editing level. Exemplary editing efficiencies of the gRNAs disclosed herein are shown in [reference needed]. Figure 4 And in Table 4.

[0231] Tables 1 and 2 below show the gRNA spacer sequence (and the corresponding PAM-strand protospacer (e.g., target) sequence and PAM).

[0232] Table 1: Human / Monkey Target and gRNA Sequences

[0233] Table 2: Mouse target and gRNA sequences

[0234] Table 3: Editing efficiency of publicly available ALAS1 gRNAs

[0235] Table 4: Editing efficiency of publicly available ALAS1 gRNA in primary human hepatocytes

[0236] Example 2 Methods for editing the ALAS1 gene in mouse liver This embodiment provides an exemplary method for editing ALAS1 in mouse liver.

[0237] Item application plan Warm the animal with a heat lamp for approximately 5 minutes. Place the mouse in a restraint device and clean its tail with an isopropanol swab. Administer lipid nanoparticles (LNPs) formulated with Cas9 mRNA and mALAS1_E2_G5 (SEQ ID NO: 38), xmhcALAS1_E4_G17 (SEQ ID NO: 29), or mALAS1_E5_G11 (SEQ ID NO: 45) gRNA via bolus injection into one of the lateral tail veins at 1.0 mg / kg and 2.0 mg / kg. After administration, withdraw the needle and apply pressure directly with a gauze square until hemostasis is achieved, then return the animal to its cage.

[0238] Tissue collection for molecular analysis Remove the liver and place it on a cutting board. Take a piece approximately 5 mm in size. 3 The tissue was collected and placed in vials containing grinding beads. The vials were then placed under dry ice to rapidly freeze the tissue.

[0239] Molecular analysis DNA was isolated from rapidly frozen mouse livers using the DNeasy Blood and Tissue Kit (QIAGEN, Hilden, Germany), following the manufacturer's protocol. PCR was then run to amplify the region of interest, and TIDE analysis was performed to determine the total editing level. Exemplary results are shown below. Figure 5 .

[0240] Example 3 Methods for editing the ALAS1 gene in hepatocytes This embodiment provides an exemplary method for editing ALAS1 in human cells (e.g., primary human hepatocytes).

[0241] Primary human hepatocytes (PHH) from six donors were thawed in 15 mL of INVITROGRO CP medium + TORPEDO antibiotic mixture (BioIVT, Westbury, NY). Cells were centrifuged at 100 × g for 8 min, resuspended in 4 mL of INVITROGRO CP medium + TORPEDO antibiotic mixture (BioIVT, Westbury, NY) and counted. The cell count was adjusted to 0.65 × 10⁶ cells / mL. 6 A concentration of cells / mL was used. 500 μL of cells / well were seeded into Celladhere. TM Type I collagen-coated 24-well plates (STEMCELL, Vancouver, BC). For 1 hour post-inoculation, the plates were shaken back and forth every 10 minutes to ensure uniform cell dispersion, and the plates were incubated at 37°C with 5% CO2. The next day, the medium was removed and replaced with 500 μL of pre-warmed INVITROGRO CP medium + TORPEDO antibiotic mixture (BioIVT, Westbury, NY), containing appropriate amounts of lipid nanoparticles (LNPs) formulated with Cas9 mRNA and xhALAS1_E5_G5 (SEQ ID NO: 30). Three days post-LNP treatment, DNA was isolated from the cells using the QIAamp 96 DNA QIAcube HT kit (QIAGEN, Hilden, Germany). PCR was run to amplify the regions of interest, and amplicon sequencing was performed to determine the total editing level. Exemplary results are shown in [image / description]. Figure 6 middle.

[0242] The goal of ALAS1 gene editing was to knock down ALAS1 protein expression. To evaluate the efficacy of protein knockdown and editing, one primary human hepatocyte and one primary NHP hepatocyte were thawed in 15 mL of INVITROGRO CP medium + TORPEDO antibiotic mixture (BioIVT, Westbury, NY). Cells were centrifuged at 100 × g for 8 min, resuspended in 4 mL of INVITROGRO CP medium + TORPEDO antibiotic mixture (BioIVT, Westbury, NY), and counted. The cell count was adjusted to 0.65 × 10⁶ cells / year. 6 A concentration of cells / mL was used. 500 μL of cells / well were seeded into Celladhere. TMType I collagen-coated 24-well plates (STEMCELL, Vancouver, BC). For 1 hour post-inoculation, the plates were shaken back and forth every 10 minutes to ensure uniform cell dispersion, and the plates were incubated at 37°C with 5% CO2. The next day, the medium was removed and replaced with 500 μL of pre-warmed INVITROGRO CP medium + TORPEDO antibiotic mixture (BioIVT, Westbury, NY), containing appropriate amounts of lipid nanoparticles (LNPs) formulated with Cas9 mRNA and xhALAS1_E5_G5 (SEQ ID NO: 30). Three days post-LNP treatment, the medium was replaced with fresh, pre-warmed medium. On day 5 post-LNP treatment, DNA was isolated from the cells using the QIAamp 96 DNA QIAcube HT kit (QIAGEN, Hilden, Germany), and protein lysates were extracted. PCR was run to amplify regions of interest on the DNA, and amplicon sequencing was performed to determine the overall editing level. ALAS1 protein expression levels were determined using a capillary-based immunoassay and expressed as relative expression between treated and untreated samples. Exemplary results are shown in... Figures 9A-9B middle.

[0243] Example 4 Methods for editing the ALAS1 gene in vivo This embodiment provides methods and data related to in vivo editing of ALAS1.

[0244] NHP Data Methods Lipid nanoparticles (LNPs) formulated with Cas9 mRNA and xhAlAS1_E5_G5gRNA (SEQ ID NO: 30) were administered intravenously at 2.0 mg / kg to cynomolgus monkeys (NHP). ALAS1 editing in the liver was evaluated using amplicon sequencing of isolated DNA using the DNeasy Blood and Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. Figure 8 ).

[0245] In at least some of the previously described embodiments, one or more elements used in one embodiment may be used interchangeably in another embodiment, unless such substitution is technically impractical. Those skilled in the art will understand that various other omissions, additions, and modifications can be made to the methods and structures described above without departing from the scope of the claimed subject matter. All such modifications and changes are intended to fall within the scope of the subject matter defined by the appended claims.

[0246] Regarding the use of substantially any plural and / or singular terms herein, those skilled in the art can convert from plural to singular and / or from singular to plural where appropriate for the context and / or application. For clarity, various singular / plural arrangements may be explicitly set forth herein. As used in this specification and the appended claims, unless the context clearly indicates otherwise, the singular forms “a / an” and “the” include the plural referent. Unless otherwise stated, any reference to “or” herein is intended to cover “and / or”.

[0247] Those skilled in the art will understand that, in general, the terminology used herein, and especially in the appended claims (e.g., the body of the appended claims), is typically intended as “open-ended” terms (e.g., the term “including” should be interpreted as “including but not limited to”, the term “having” should be interpreted as “having at least”, the term “includes” should be interpreted as “including but not limited to”, etc.). Those skilled in the art will further understand that if a particular number of claims is intended to be presented, such intention will be explicitly stated in the claims, and if such a statement is absent, such intention does not exist. For example, to aid understanding, the appended claims may include the introductory phrases “at least one” and “one or more” to introduce the claims. However, the use of such wording should not be construed as meaning that introducing a claim statement with the indefinite article “a(a)” or “an” would limit any specific claim in a claim statement containing such an introduction to an embodiment containing only one such statement, even when the same claim includes the introductory wording “one or more” or “at least one” and indefinite articles such as “a(a)” or “an” (e.g., “a(a)” and / or “an” should be interpreted as meaning “at least one” or “one or more”); the same applies to the use of definite articles to introduce a claim statement. Furthermore, even if a specific number in an introductory claim statement is explicitly stated, those skilled in the art will recognize that such a statement should be interpreted as meaning at least the number stated (e.g., simply stating “two statements” without other modifiers means at least two statements or two or more statements). Furthermore, in cases where conventions such as "at least one of A, B, and C" are used, this syntactic structure is generally intended to be understood by a person skilled in the art (e.g., "a system having at least one of A, B, and C" will include, but is not limited to, systems having a single A, having a single B, having a single C, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). In cases where conventions such as "at least one of A, B, or C" are used, this syntactic structure is generally intended to be understood by a person skilled in the art (e.g., "a system having at least one of A, B, or C" will include, but is not limited to, systems having a single A, having a single B, having a single C, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.).Those skilled in the art will further understand that, in practice, any separate words and / or wording presenting two or more alternative terms, whether in the specification, claims or drawings, should be understood to take into account the possibility of including one, any, or both terms.

[0248] Furthermore, when features or aspects of this disclosure are described in terms of the Markush group, those skilled in the art will recognize that this disclosure is also described in terms of any individual member or subgroup of the Markush group.

[0249] As those skilled in the art will understand, for any and all purposes, such as providing a written description, all scopes disclosed herein also include any and all possible subscopes and combinations of subscopes. Any listed scope can be readily identified as sufficiently descriptive and such scopes can be decomposed into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each scope discussed herein can be readily decomposed into a lower third, middle third, and upper third, etc. As those skilled in the art will also understand, all language such as “up to,” “at least,” “greater than,” “less than,” etc., includes the stated numbers and refers to a scope that can subsequently be decomposed into subscopes as discussed above. Finally, as those skilled in the art will understand, a scope includes members of each individual. Thus, for example, a group having 1-3 items means a group having 1, 2, or 3 items. Similarly, a group having 1-5 items means a group having 1, 2, 3, 4, or 5 items, and so on.

[0250] While various aspects and embodiments have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. The various aspects and embodiments disclosed herein are for illustrative purposes and are not intended to limit the true scope and spirit pointed to by the appended claims.

Claims

1. A guide RNA (gRNA) for targeting 5'-aminolevulinic acid synthase 1 (… ALAS1 The genomic locus contains a spacer sequence that has 80% sequence identity with any of the sequences in SEQ ID NO: 25-48 and 83-112.

2. The gRNA according to claim 1, wherein the gRNA comprises a spacer sequence comprising any one of SEQ ID NO: 25-48 and 83-112.

3. The gRNA according to claim 1, wherein the gRNA comprises a spacer sequence comprising any one of SEQ ID NO: 25-37 and 100-112.

4. The gRNA according to claim 1, wherein the gRNA comprises a spacer sequence, the spacer sequence comprising the sequence of SEQ ID NO: 45, SEQ ID NO: 83, SEQ ID NO: 86 or SEQ ID NO:

87.

5. The gRNA according to claim 1, wherein the gRNA comprises a spacer sequence, the spacer sequence comprising the sequence of SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 29 or SEQ ID NO:

30.

6. The gRNA according to any one of claims 1-5, wherein the gRNA is capable of inducing targeting of the ALAS1 A cleavage efficiency of at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% for genomic loci.

7. The gRNA of claim 6, wherein the gRNA is capable of inducing targeting of the ALAS1 The cleavage efficiency is at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the genomic loci.

8. The gRNA of claim 6, wherein the gRNA is capable of inducing targeting of the ALAS1 The cleavage efficiency of the genomic locus is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%.

9. The gRNA according to any one of claims 1-8, wherein the gRNA is a single guide RNA (sgRNA).

10. The gRNA according to any one of claims 1-9, wherein the gRNA is a chemically modified gRNA.

11. The gRNA of claim 10, wherein the chemically modified gRNA comprises one or more phosphate thioester bonds and / or one or more 2'-O-methyl nucleotides at the 3' end, the 5' end, or both.

12. The gRNA according to any one of claims 10-11, wherein no more than 50% of the nucleotides of the gRNA contain a 2'-O-methyl modification.

13. The gRNA according to any one of claims 10-12, wherein about 48% of the nucleotides of the gRNA contain a 2'-O-methyl modification, wherein the 5' end of the gRNA contains three phosphate thioester bonds, and / or wherein the 3' end of the gRNA contains three phosphate thioester bonds.

14. A composition comprising (a) a gRNA of any one of claims 1-13 or a polynucleotide encoding a gRNA of any one of claims 1-13, and (b) a Cas9 endonuclease or a nucleic acid encoding a Cas9 endonuclease.

15. A composition comprising: (a) Targeting 5'-aminolevulinic acid synthase 1 ( ALAS1 The guide RNA (gRNA) of a genomic locus, or the nucleic acid encoding said gRNA; and (b) Endonuclease or nucleic acid encoding endonuclease.

16. A composition comprising: (a) Targeting 5'-aminolevulinic acid synthase 1 ( ALAS1 The guide RNA (gRNA) of a genomic locus, or the nucleic acid encoding said gRNA; and (b) Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease.

17. The composition according to any one of claims 15-16, wherein the gRNA is a single guide RNA (sgRNA).

18. The composition according to any one of claims 15-17, wherein the gRNA is a chemically modified gRNA.

19. The composition of claim 18, wherein the chemically modified gRNA comprises one or more phosphate thioester bonds and / or one or more 2'-O-methyl nucleotides at the 3' end, 5' end, or both.

20. The composition according to any one of claims 18-19, wherein no more than 50% of the nucleotides of the gRNA contain a 2'-O-methyl modification.

21. The composition according to any one of claims 18-20, wherein no more than 48% of the nucleotides of the gRNA contain a 2'-O-methyl modification, wherein the 5' end of the gRNA contains three phosphate thioester bonds, and / or wherein the 3' end of the gRNA contains three phosphate thioester bonds.

22. The composition according to any one of claims 14-21, wherein the Cas9 endonuclease is selected from the group consisting of: Streptococcus pyogenes (… S. Pyogenes Cas9, Staphylococcus aureus ( S. aureus Cas9, Neisseria meningitidis ( N. meningitidis Cas9, Streptococcus thermophilus ( S. thermophilus CRISPR1 Cas9, Streptococcus thermophilus CRISPR3 Cas9, and Treponema pallidum ( T. denticola Cas9.

23. The composition according to any one of claims 14-22, wherein the composition comprises (a) the ALAS1 gRNA and (b) the Cas9 endonuclease, and the ALAS1 gRNA and Cas9 endonuclease were formulated into ribonucleoprotein particles (RNPs).

24. The composition according to any one of claims 14-22, wherein the composition comprises (a) a coding ALAS1 The nucleic acid of gRNA and (b) the nucleic acid encoding Cas9 endonuclease, wherein (a) and / or (b) are present on the viral vector.

25. The composition of claim 24, wherein the viral vector is an adeno-associated virus vector.

26. The composition according to any one of claims 14-23, wherein (a) the gRNA or nucleic acid encoding the gRNA, (b) the Cas9 endonuclease or nucleic acid encoding the Cas9 endonuclease, or both, are complexed with liposomes or lipid nanoparticles (LNPs).

27. The composition of claim 26, wherein the lipid nanoparticles comprise one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-conjugated lipids.

28. The composition of claim 26, wherein the lipid nanoparticles comprise cholesterol, polyethylene glycol (PEG) lipids, or both.

29. A method for treating 5'-aminolevulinic acid synthase 1 (aminolevulinic acid synthase 1) in subjects with appropriate need. ALAS1 A method for treating a disease or symptom caused by overexpression, comprising administering to the subject any one of the compositions of claims 14-28, thereby treating the subject for the disease or symptom caused by overexpression. ALAS1 Diseases or symptoms caused by overexpression.

30. A method for treating a subject who has or is suspected of having porphyria, comprising administering to the subject a substance containing 5'-aminolevulinic acid synthase 1 (… ALAS1 A combination of gRNAs from genomic loci to treat porphyria.

31. A method for treating 5'-aminolevulinic acid synthase 1 (aminolevulinic acid synthase 1) in subjects with appropriate need. ALAS1 Methods for overexpressing diseases or symptoms include administering to the subject a composition comprising more than one nanoparticle in combination with the following substances: (a) Targeting 5'-aminolevulinic acid synthase 1 ( ALAS1 The guide RNA (gRNA) of a genomic locus or the nucleic acid encoding said gRNA; and (b) Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, thereby treating the subject with [condition caused by] ALAS1 Diseases or symptoms caused by overexpression.

32. The method according to any one of claims 30-31, wherein the composition is the composition according to any one of claims 14-28.

33. The method according to any one of claims 30-32, wherein the targeting... ALAS1 The gRNA of the genomic locus contains a spacer sequence, which contains either of the sequences in SEQ ID NO: 25-48 and 83-112.

34. A method for treating a subject with or suspected of having porphyria, comprising administering to the subject a composition comprising more than one nanoparticle compounded with: (a) Targeting 5'-aminolevulinic acid synthase 1 ( ALAS1 The guide RNA (gRNA) of a genomic locus or the nucleic acid encoding said gRNA; and (b) Cas9 endonuclease or nucleic acid encoding Cas9 endonuclease, thereby treating porphyria.

35. The method of claim 34, wherein the target is ALAS1 The gRNA of the genomic locus contains a spacer sequence, which contains either of the sequences in SEQ ID NO: 25-48 and 83-112.

36. The method according to any one of claims 31-35, wherein the Cas9 endonuclease is selected from the group consisting of: Streptococcus pyogenes Cas9, Staphylococcus aureus Cas9, Neisseria meningitidis Cas9, Streptococcus thermophilus CRISPR1 Cas9, Streptococcus thermophilus CRISPR3 Cas9, and Treponema denticulatum Cas9.

37. The method according to any one of claims 31-36, wherein the more than one nanoparticle is a lipid nanoparticle.

38. The method of claim 37, wherein the lipid nanoparticles comprise one or more neutral lipids, charged lipids, ionizable lipids, steroids, and polymer-conjugated lipids.

39. The method of claim 37, wherein the lipid nanoparticles comprise cholesterol, polyethylene glycol (PEG) lipids, or both.

40. The method according to any one of claims 29-39, comprising administering the composition to the subject in a single dose of (a) and (b) total nucleic acids at about 0.1 mg / kg, 0.3 mg / kg, 0.6 mg / kg, 1.0 mg / kg or 2.0 mg / kg.

41. The method according to any one of claims 29-40, wherein the method comprises administering the composition to the subject in a single dose.

42. The method according to any one of claims 29-40, wherein the composition is administered to the subject two or more times.

43. The method of claim 42, wherein the interval between each of the two or more applications is about two weeks to about four weeks.

44. The method of claim 42, wherein the interval between each of the two or more applications is at least three months.

45. The method according to any one of claims 29-44, wherein the subject... ALAS1 The expression of was reduced in the subjects; optionally, wherein ALAS1 The expression of [the substance] was reduced in the liver of the subject; and said reduction was relative to (a) the subject's [expression] prior to administration of the composition. ALAS1 (a) expression; (b) in one or more untreated subjects ALAS1 Expression; and / or (c) healthy subjects ALAS1 The reference level of expression.

46. ​​The method of claim 45, wherein the subject ALAS1 The expression of [a substance] decreased by at least 20% after the application.

47. The method according to any one of claims 45-46, wherein the subject... ALAS1 The expression of [the substance] was reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% after the application.

48. The method of claim 47, wherein after the application ALAS1 mRNA levels are reduced by at least 90%.

49. The method according to any one of claims 47-48, wherein the level of ALAS1 protein is reduced by at least 75% after the administration.

50. The method according to any one of claims 45-49, wherein the reduction lasts for at least two weeks, at least three weeks, at least four weeks, or at least one month.

51. The method according to any one of claims 29-50, further comprising administering to the subject a therapeutically effective amount of at least one additional therapeutic agent.

52. The method of claim 51, wherein the additional therapeutic agent is hydroxymethemoglobin, argininemethemoglobin, ALAS1 siRNA or combinations thereof.

53. The method according to any one of claims 29-52, wherein the subject has or is suspected of having cutaneous porphyria, wherein the cutaneous porphyria is congenital erythropoietic porphyria (CEP), hepatic erythropoietic porphyria (HEP), delayed cutaneous porphyria (PCT), or erythropoietic protoporphyria and X-linked porphyria (EP / XLP).

54. The method according to any one of claims 29-53, wherein the subject has, is suspected of having, or has already had acute porphyria, wherein the acute porphyria is acute intermittent porphyria (AIP), hereditary coprophyria (HCP), variant porphyria (VP), or δ-aminolevulinic acid dehydratase deficiency porphyria (ADP).

55. The method of claim 54, wherein the frequency of acute porphyria attacks in the subject is reduced compared to the subject before administration.

56. The method according to any one of claims 29-55, wherein the subject has elevated plasma and / or urinary bilirubinogen (PBG), elevated plasma and / or urinary aminolevulinic acid (ALA), elevated urinary porphyrins, elevated fecal porphyrins, elevated plasma porphyrins, or any combination thereof; optionally, compared to reference values.

57. The method of claim 56, wherein, after administration of the composition, the levels of plasma and / or urobilinogen (PBG), plasma and / or urinary aminolevulinic acid (ALA), urinary porphyrin, fecal porphyrin, plasma porphyrin, or any combination thereof in the subject are reduced.

58. The method according to any one of claims 29-57, wherein after administration of the composition, the urine of the subject... ALAS1 A decrease in mRNA levels; and said decrease is relative to (a) the subject prior to administration of the composition. ALAS1 (a) mRNA levels in one or more untreated subjects; (b) mRNA levels in one or more untreated subjects ALAS1 mRNA levels; and / or (c) healthy subjects ALAS1 Reference level for mRNA.

59. The method according to any one of claims 29-58, wherein the subject has or is suspected of having a mutation in at least one gene selected from the group consisting of: ALAS2 , ALAD , HMB S, UROD , UROS , CPOX , PPOX and FECH Optionally, the mutation results in a decrease in the expression, stability, and / or activity of the RNA and / or protein products of the at least one gene.

Images