BCG3973 gene knock-down recombinant bacillus calmette guerin vaccine strain as well as construction method and application thereof

By blocking BCG_3973 gene expression using CRISPRi/dCas9sth1 technology, a recombinant BCGkd vaccine was constructed, which addressed the shortcomings of BCG vaccine in heterologous infection protection and immune training, and significantly enhanced the immune function of macrophages and the infection protection effect in mice.

CN121780404APending Publication Date: 2026-04-03DALIAN MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-04-03

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses a BCG3973 gene knocked-down recombinant bacillus calmette guerin vaccine strain as well as a construction method and application thereof. According to the invention, a CRISPRi / dCas9th1 technology is utilized to block RNA polymerase movement in space through a compound formed by crRNA, dCas9 protein and sgRNA at a transcriptional level, so that the expression of the BCG3973 gene in the BCG vaccine is inhibited. After being treated by the recombinant bacillus calmette guerin bacterial strain, the immune-related pathways of macrophages, such as a cytokine-cytokine receptor action pathway, a Ca < + + > signal pathway and pathways such as PPAR and JAK-STAT, are obviously increased, and IL-1beta, TNF-alpha, antiviral protein and calmodulin with higher levels are expressed, so that the recombinant bacillus calmette guerin bacterial strain has stronger bactericidal ability on escherichia coli. Mouse in-vivo experiments show that the recombinant bacillus calmette-guerin bacterial strain has a very good protection effect on escherichia coli infection and endotoxemia caused by lipopolysaccharide, and shows higher survival rate and stronger capability of eliminating heterologous substance infection under attack of a lethal dose of Candida albicans.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a recombinant BCG vaccine with BCG_3973 gene knockdown, its construction method, and its applications. This invention belongs to the field of pharmaceutical technology. Background Technology

[0002] Bacille Calmette–Guérin (BCG) has been used for over 100 years as the only approved vaccine for the prevention of tuberculosis. [1] Every year, approximately 352 million newborns in about 180 countries and regions worldwide receive BCG at birth. It can be said that BCG is the most widely administered and safest vaccine in human history. [2] In addition to inducing traditional anti-tuberculosis and anti-tumor (non-invasive bladder cancer) immunity, BCG can also induce non-specific effects (NSEs) that are beneficial to the body. [3] The main benefits are as follows: In addition to reducing the incidence of tuberculosis, BCG vaccination in newborns and infants can also reduce leprosy caused by *Mycobacterium leprae* and Brinell's ulcers caused by *Mycobacterium abscessus*. Regarding viral infections, BCG vaccination can reduce the incidence of neonatal sepsis. [4] And the incidence of acute lower respiratory tract infections caused by respiratory syncytial virus (RSV). [5] These two diseases are the leading causes of death in newborns and premature infants; results from a randomized controlled phase III clinical trial of BCG in individuals aged 65 and older showed... [6] BCG vaccination can delay the first infection and reduce the incidence of upper respiratory tract infections and pneumonia. BCG vaccination can also increase antibody levels against H1N1 influenza, promote pertussis vaccine response, promote human papillomavirus clearance, and reduce yellow fever vaccine-associated viremia. [7-8] Furthermore, BCG's non-specific effects are also reflected in its immunomodulatory effects on malignant tumors such as bladder cancer and melanoma, and on neurological disorders such as multiple sclerosis and type 1 diabetes. [9] Therefore, in addition to focusing on traditional anti-tuberculosis immunity, BCG optimization should also take into account its induced non-specific effects against heterologous infections.

[0003] The primary mechanism of BCG-induced nonspecific effects is trained immunity. This refers to the "memory" formed by innate immune cells (monocytes / macrophages, natural killer cells, and dendritic cells) after receiving antigen stimulation, similar to adaptive immunity, which enables them to produce a stronger immune response against unrelated pathogens.

[10] The most clearly demonstrated aspect is that after BCG is phagocytosed by innate immune cells via PAMP and PRR recognition, the cell wall lysis product muramyldipeptide (MDP) binds to the nucleotide-binding oligomerization domain receptor NOD2 within the innate immune cell, initiating the NOD2-Rip pathway, activating AKT-mTOR signaling, causing chromatin to change from dense to loose, and altering the epigenetic modifications of histones.

[11] Specifically, increased trimethylation of histone H3K4, increased acetylation of H3K27, and decreased trimethylation of H3K9 in the upstream promoter regions of TNF-α, IL-1β, and IL-6 genes activate the expression of downstream pro-inflammatory cytokines such as IL-1β, IL-6, and TNF-α, thereby exerting an immune-training effect. Therefore, optimizing BCG vaccine by regulating MDP levels has a feasible basis.

[0004] Peptidoglycan (PG) is the skeletal framework of bacterial cell walls, maintaining bacterial shape and determining their physiological functions. During bacterial growth and reproduction, PG synthesis and degradation are dynamic processes requiring the coordinated participation of approximately dozens of enzymes. Based on their sites of action on peptidoglycan, peptidoglycan hydrolases can be classified into glycosidases, N-acetylmurayl-L-alanine amidases, and peptidases, among others.

[12] N-acetylmurayl-L-alanine amidase hydrolyzes the amide bond between MurNAc and L-alanine in PG. Almost every bacterium contains several N-acetylmurayl-L-alanine amidases. N-acetylmurayl-L-alanine amidases play important roles in the cell wall cycle, inversion, and remodeling of mycobacteria. Reported N-acetylmurayl-L-alanine amidases in Mycobacterium tuberculosis include Ami1 (Rv3717), Ami2 (Rv3915), Ami3 ​​(Rv3811), and Ami4 (Rv3594).

[13] Ami1 and Ami2 (also known as CwlM) belong to the amidase superfamily 3, while Ami3 ​​and Ami4 belong to the amidase superfamily 2. Differences exist in the distribution of signal peptides, catalytic sites, and peptidoglycan-binding domains among these four amidases, suggesting functional specificity for each enzyme. Furthermore, Ami1 to Ami4 are highly conserved in mycobacteria, and each Ami in *Mycobacterium smegmatis* and BCG is 100% identical to each Ami1 in *Mycobacterium tuberculosis*. Ami2 (CwlM) has been shown to play a central role in activating MurA in the initiation of proteoglycan synthesis. The gene encoding Ami2 (CwlM) in *BCG*, BCG_3973, shares 100% homology with Ami2 (Rv3915) in *Mycobacterium tuberculosis*, but its function is unknown.

[0005] References mentioned in the background art:

[0006] [1] Global tuberculosis report 2023. Geneva: World Health Organization; 2024.

[0007] [2] Wang Xinyao, Jiang Meili, Pang Yuanjie, et al. Current status of tuberculosis disease burden in China [J]. Chinese Journal of Epidemiology, 2024, 45(6): 857-864.

[0008] [3] Nilofer Naqvi, Yashika Ahuja, et al. BCG's role in strengthening immune responses: Implications for tuberculosis and comorbiddiseases. Infection, Genetics and Evolution 2025,127,105703.

[0009] [4]Aaby P, Netea MG, Benn CS. Beneficial non-specific effects of livevaccines against COVID-19 and other unrelated infections. Lancet Infect Dis2023, 23(1): e34-e42.

[0010] [5]Kumar NP, Padmapriyadarsini C, Rajamanickam A, Bhavani PK, NancyA, Jeyadeepa B,Renji RM, Babu S. BCG vaccination induces enhanced humoral responses in elderly individuals. Tuberculosis (Edinb) 2023, 139: 102320.

[0011] [6] Miriam Angulo,Carlos Angulo,Trained immunity-based vaccines: Avision from the one health initiative.Vaccine 2025,43(2),126505

[0012] [7] Jeyanathan M, Vaseghi-Shanjani M, Afkhami S, Grondin JA, Kang A,D'Agostino MR, Yao Y,Jain S, Zganiacz A, Kroezen Z, Shanmuganathan M, SinghR, Dvorkin-Gheva A, Britz-McKibbin, P, Khan WI, Parenteral induction of BCG. lung-resident memory macrophages and trained immunity via thegut-lung axis. Nat Immunol 2022, 23(12): 1687-1702.

[0013] [8] Dominguez-Andres J, Dos Santos JC, Bekkering S, Mulder WJM, vander Meer JWM, Riksen NP,Joosten LAB, Netea MG. Trained immunity: adaptationwithin innate immune mechanisms. Physiol Rev 2023, 103(1): 313-346.

[0014] [9]van Leent, MMT, Priem, B. Mandy MT, Schrijver DP, Dreu A.de, Hofstraat SRJ, Zwolsman R., Beldman TJ, Netea MG, Mulder WJM,Regulating trained immunity with nanomedicine. Nat Rev Mater 2022, 7, 465–481.

[0015]

[10] Gillard J, Blok BA, Garza DR, Venkatasubramanian PB, Simonetti E,Eleveld MJ, Berbers GAM, van Gageldonk PGM, Joosten I, de Groot R, de BreeLCJ, van Crevel R, de Jonge MI, Huynen MA, Netea MG, Diavatopoulos DA. BCG-induced trained immunity enhances acellular pertussis vaccination responsesin an explorative randomized clinical trial. NPJ Vaccines 2022, 7(1): 21.

[0016]

[11] Ziogas A, Novakovic B, Ventriglia L, Galang N, Tran KA, Li W,Matzaraki V, van Unen N, Schlüter T, Ferreira AV, Moorlag SJCFM, Koeken VACM,Moyo M, Li X, Baltissen MPA, Martens JHA, Li Y, Divangahi M, Joosten MAB, Nehlanga LGM, MMM. Long-term histone lactylation connects metabolic andepigenetic rewiring in innate immune memory. Cell. 2025,188(11):2992-3012.

[0017]

[12] .Torrens G, Cava F. Mechanisms conferring bacterial cell wallvariability and adaptivity. Biochem Soc Trans. 2024,52(5):1981-1993

[0018]

[13] Senzani S, Li D, Bhaskar A, Ealand C, Chang J, Rimal B, Liu C,Joon Kim S, Dhar N, Kana B. An Amidase_3 domain-containing N-acetylmuramyl-L-alanine amidase is required for mycobacterial cell division. Sci Rep 2017, 7(1):1140 Summary of the Invention

[0019] The purpose of this invention is to provide a recombinant BCG vaccine with BCG_3973 gene knockdown, its construction method, and its application.

[0020] To achieve the above objectives, the present invention employs the following technical means:

[0021] The inventors hypothesized that CwlM, encoded by the BCG_3973 gene, can regulate intracellular degradation products of BCG and subsequent immune signaling pathways, and is a potential target for regulating BCG training immunization. Therefore, the inventors utilized CRISPRi / dCas9 in wild-type BCG (ATCC 35734). sth1 The system, at the transcriptional level, inhibits gene expression in the wild-type BCG strain BCG_3973 by site-specifically blocking RNA polymerase movement through a complex formed by crRNA, sgRNA, and dCas9 proteins. This resulted in the construction of a recombinant BCG strain with inhibited BCG_3973 gene expression (hereinafter referred to as BCG). kd (Plant). BCG kd Compared to wild-type BCG, the strain exhibits characteristics such as smaller colonies, weakened or even lost acid resistance, cell adhesion, wrinkled cell walls, elongated cells, and a thinner outer membrane structure during cell division. At the in vitro cellular level, after heat inactivation, BCG... kd Transcriptome analysis of BCG-treated macrophages and wild-type BCG-treated macrophages showed that BCG... kd Treatment of macrophages has led to the development of immune-related pathways such as the cytokine-cytokine receptor pathway and Ca2+. ++ Significant changes were observed in signaling pathways, including PPAR and JAK-STAT, and the bacteria exhibited stronger bactericidal activity against *E. coli*. In vivo mouse experiments showed that after BCG treatment... kd Immunized mice, compared to the control group, exhibited higher survival rates and stronger ability to clear heterologous infections after being challenged with a lethal dose of Candida albicans. The BCG provided by this invention... kdIt can improve the training immunity level induced by BCG and is expected to become a candidate vaccine against heterologous bacterial or substance infections.

[0022] Based on the above research, this invention first proposes a recombinant BCG strain with BCG_3973 gene knockdown, named BCG. kd The recombinant BCG strain was obtained by knocking down the BCG_3973 gene of BCG using CRISPR / dCas9sth1 technology.

[0023] The preferred sequence of the knockdown BCG_3973 gene is shown in SEQ ID No. 1.

[0024] Preferably, when using CRISPR / dCas9sth1 technology to knock down the BCG_3973 gene, the sgRNA sequence used is shown in SEQ ID No. 2.

[0025] Preferably, the recombinant BCG strain is obtained by the following method:

[0026] (1) Design primers for sgRNA oligoes

[0027] The primer sequences are shown below:

[0028] top oligo 5'-GGGAAAATGACCGTCGACCAGCCCGGT-3'

[0029] bottom oligo: 5'-AAACACCGGGCTGGTCGACGGTCATTT-3'

[0030] (2) Primer annealing

[0031] The primers designed in step (1) were annealed to form double-stranded sgRNA oligoes;

[0032] (3) Digest pLJR965 plasmid with enzymes and recover the large fragment.

[0033] The CRISPRi backbone plasmid pLJR965 was digested with BsmBI-v2 enzyme, and the large fragments after agarose gel electrophoresis were recovered.

[0034] (4) Connect the large fragment after pLJR962 digestion to sgRNA oligoes.

[0035] Use T4 ligase to ligate the sgRNAoligoes in step (2) and the large fragment in step (3);

[0036] (5) The ligation product was transformed into Escherichia coli and positive clones were screened.

[0037] The ligation product from step (4) was transformed into E. coli, positive clones were screened, plasmids were extracted and sequenced, and the successfully constructed plasmid was named pLJR965-sgRNA.

[0038] (6) Construction of recombinant BCG strain by electroporation of pLJR965-sgRNA with BCG strain

[0039] The pLJR965-sgRNA plasmid, which was validated by sequencing in step (5), was electroconverted into BCG competent cells and plated on 7H10 plates containing kanamycin.

[0040] (7) Induction culture of BCG_3973 gene knockout strain

[0041] The positive clone colonies from step (6) were inoculated into 7H9 liquid medium containing kanamycin, and tetracycline was added for induction to obtain the recombinant BCG_3973 gene knockdown strain.

[0042] Preferably, the annealing conditions in step (2) are 95℃ for 2 min, and then decreasing to 25℃ at a rate of 0.1℃ / s.

[0043] Preferably, in step (7), the induction concentration of tetracycline is 50 ng / ml-200 ng / ml.

[0044] Preferably, in step (7), the induction concentration of tetracycline is 100 ng / ml.

[0045] Furthermore, the present invention also proposes the application of the recombinant BCG strain in the preparation of drugs for treating heterologous bacterial or substance infections.

[0046] Preferably, the heterologous bacteria or substances include Escherichia coli, Candida albicans, and lipopolysaccharide.

[0047] Preferably, the drug is a vaccine.

[0048] Compared with the prior art, the beneficial effects of the present invention are:

[0049] This invention discloses a recombinant BCG vaccine strain with BCG_3973 gene knockdown. This invention utilizes CRISPRi / dCas9 sthThe technology inhibits BCG_3973 gene expression in BCG at the transcriptional level by spatially blocking RNA polymerase movement through a complex formed by crRNA, dCas9 protein, and sgRNA. Transcriptome analysis of macrophages treated with heat-inactivated recombinant BCG strains and those treated with wild-type BCG strains showed that macrophages treated with recombinant BCG strains exhibited reduced expression in immune-related pathways such as the cytokine-cytokine receptor pathway and Ca2+. ++ Significantly elevated levels were observed in signaling pathways, including PPAR and JAK-STAT, and higher levels of IL-1β, TNF-α, antiviral proteins, and calmodulin were expressed, resulting in stronger bactericidal activity against Escherichia coli. In vivo mouse experiments showed that mice immunized with this recombinant BCG strain, compared to the BCG control group, exhibited excellent protection against E. coli infection and lipopolysaccharide-induced endotoxemia. Furthermore, under lethal doses of Candida albicans challenge, they demonstrated higher survival rates and stronger ability to clear heterologous bacterial or substance infections. Attached Figure Description

[0050] Figure 1 The BCG_3973 gene knockdown strain is BCG kd Knockout principle diagram;

[0051] Figure 2 The partial sequencing results of the PLJR965-sgRNA integration plasmid constructed in this invention for inducing cwlM(BCG_3973) gene knockdown (underlined is the complementary sequence of the sgRNA sequence of SEQ ID No. 2).

[0052] Figure 3 BCG induced by different concentrations of ATC kd Gene expression levels of cwlM (BCG_3973) in wild-type BCG;

[0053] Figure 4 BCG on solid culture medium kd Comparison of colony characteristics (A) and colony area (B) between wild-type BCG and wild-type BCG after 7 weeks of continuous culture, ***, p<0.001;

[0054] Figure 5 BCG liquid culture medium kd Acid-fast staining results for wild-type BCG;

[0055] A. Magnification 1000×; B, C. Using ImageJ software, compare positive bacteria (B) and morphologically abnormal bacteria (C) among 200 bacteria, repeated 3 times, **, p<0.01; ***, p<0.001;

[0056] Figure 6For BCG kd Scanning electron microscopy results of wild-type BCG;

[0057] Figure 7 For BCG kd Transcriptome analysis results of macrophages treated with wild-type BCG;

[0058] A. Volcano plot of differentially expressed genes; B. Bar chart of KEGG Pathway enrichment results;

[0059] Figure 8 For BCG kd Expression levels of IL-1β (A), TNF-α (B), antiviral protein (C), and calmodulin (D) in macrophages treated with wild-type BCG; (*, p<0.05; **, p<0.01; ***, p<0.001).

[0060] Figure 9 For BCG kd The phagocytic and bactericidal abilities of macrophages treated with wild-type BCG against Escherichia coli;

[0061] A is the experimental flowchart, B is the CFU count results at different time points; *, p<0.05; **, p<0.01;

[0062] Figure 10 For BCG kd Comparison of serum C-reactive protein levels and bacterial load in various organs of mice immunized with wild-type BCG after E. coli challenge;

[0063] A. Animal immunization flowchart; B. Mouse serum C-reactive protein level; C. Liver bacterial load and CFU count; D. Spleen bacterial load and CFU count; E. Kidney bacterial load and CFU count. *, p<0.05; **, p<0.01; ***, p<0.001;

[0064] Figure 11 For BCG kd Serum C-reactive protein levels and spleen HE staining results in mice immunized with wild-type BCG and challenged with lipopolysaccharide.

[0065] A. Animal immunization flowchart; B. Mouse serum C-reactive protein content; C. Spleen HE staining; *, p<0.05; **, p<0.01; ***, p<0.001;

[0066] Figure 12 For BCG kd Survival rate and organ CFU count results of mice challenged with a lethal dose of Candida albicans by wild-type BCG immunization;

[0067] A. Animal immunization flowchart; B. Mouse survival rate; C. Liver Candida albicans CFU count; D. Kidney Candida albicans CFU count; *, p<0.05; **, p<0.01; ***, p<0.001; Detailed Implementation

[0068] The technical solutions of the present invention will be described in detail below with reference to specific embodiments and accompanying drawings. The embodiments described herein are specific implementations of the present invention, used to illustrate the concept of the present invention; these descriptions are explanatory and exemplary, and should not be construed as limiting the implementation methods or the scope of protection of the present invention. In addition to the embodiments described herein, those skilled in the art can employ other obvious technical solutions based on the content disclosed in the claims and specification of this application. These technical solutions include those that make any obvious substitutions and modifications to the embodiments described herein.

[0069] Unless otherwise specified, all reagents and equipment used in the following examples were purchased from commercial sources.

[0070] Example 1: Construction of CwlM (BCG_3973) gene knockdown strain (BCG kd )

[0071] BCG_3973 gene knockdown strain (BCG kd Knockout principle diagram as follows Figure 1 As shown.

[0072] 1. Design primers for sgRNA oligoes

[0073] The primers contain the sequence shown in SEQ ID No:2, with 5'-GGGA-3' added to the 5' end of the sequence shown in SEQ ID No:2 as a top oligo, and 5'-AAAC-3' added to the 5' end of the complementary strand of the sequence shown in SEQ ID No:2 as a bottom oligo.

[0074] top oligo 5'-GGGAAAATGACCGTCGACCAGCCCGGT-3' (SEQ ID NO.3)

[0075] bottom oligo: 5'-AAACACCGGGCTGGTCGACGGTCATTT-3' (SEQ ID NO.4)

[0076] 2. Primer annealing

[0077] The top oligo and bottom oligo designed in step 1 were annealed under the following annealing conditions: 95℃ for 2 min, then decreasing to 25℃ at a rate of 0.1℃ / s.

[0078] 3. Digest the pLJR965 plasmid with enzymes and recover the large fragment.

[0079] The CRISPRi backbone plasmid (pLJR965) was digested with BsmBI-v2 enzyme, and the large fragment (8443bp) after agarose gel electrophoresis was recovered.

[0080] 4. Ligate the large fragment digested by pLJR962 with sgRNA oligoes.

[0081] The sgRNAoligoes from step 2 and the large fragment from step 3 were ligated using T4 ligase.

[0082] 5. The ligation product was transformed into E. coli and positive clones were screened.

[0083] The ligation product from step 4 was transformed into E. coli Nova blue, and positive clones were selected based on kanamycin resistance and named pLJR965-sgRNA.

[0084] 6. Sequencing verification of pLJR965-sgRNA positive clones

[0085] The positive clones from step 5 were selected, plasmids were extracted and sequenced, and the sequencing primer sequence was 5'-TTCCTGTGAAGAGCCATTGATAATG-3' (SEQ ID NO.5). Figure 2 The sequencing results are shown below. The underlined sequences are the target sequences of the sgRNA, proving that pLJR965-sgRNA was successfully constructed.

[0086] 7. Recombinant BCG strain was constructed by electroporation of pLJR965-sgRNA into wild-type BCG strain (ATCC 35734).

[0087] The pLJR965-sgRNA plasmid, which was validated by sequencing in step 6, was electrotransformed into wild-type BCG competent cells and plated on 7H10 plates containing kanamycin. Visible colonies appeared in about 4 weeks.

[0088] 8. CwlM (BCG_3973) gene knockdown strain (BCG kd Induction culture

[0089] The positive clones from step 7 were inoculated into 7H9 liquid medium containing kanamycin and cultured stably for at least three generations. The mixture was then diluted at a ratio of 1:50 and inoculated into 7H9 liquid medium. Under the same culture conditions, a tetracycline non-induced group (0 ng / ml) and an induced group (ATc) of 50 ng / ml, 100 ng / ml, and 200 ng / ml were established.

[0090] 9. CwlM (BCG_3973) gene knockdown strain (BCG) kd ) verification

[0091] The culture induced for approximately 10 days in step 8 was collected, bacterial RNA was extracted, and then BCG was detected using real-time quantitative PCR (RT-qPCR). kd The mRNA expression of the BCG_3973 gene was determined using the following mRNA primer sequences:

[0092] Upstream primer: 5'TTCTTTCAACGCGCGGTAGG3' (SEQ ID NO.6);

[0093] Downstream primer: 5'GTAACGTCGCCCTTGAGTTG3' (SEQ ID NO.7)

[0094] The internal reference gene is sigA. The results are as follows: Figure 3 As shown, compared to the non-induced group (ATc, 0 ng / ml), the gene expression level of BCG_3973 in the induced group was negatively correlated with the ATC concentration; the higher the induced ATC concentration, the lower the expression of the BCG_3973 gene, i.e., the greater the knockdown. Under ATC induction at 50, 100, and 200 ng / ml, the BCG_3973 gene expression decreased by approximately 17.87%, 32.42%, and 58.69% compared to the non-induced group, respectively. Considering that CwlM (BCG_3973) may be essential for BCG growth, this invention selected 100 ng / ml as the BCG concentration. kd The subsequent experiments induced the concentration.

[0095] Example 2: CwlM (BCG_3973) gene knockdown strain (BCG) kd Biological characteristics

[0096] 1. Description of bacterial colony characteristics

[0097] BCG kdThe bacterial suspension was evenly spread on 7H10 solid medium plates supplemented with OADC and ATc (100 ng / ml). The plates were incubated at room temperature for 10-20 minutes until the bacterial suspension was absorbed by the agar. The plates were then inverted and incubated at 37°C for approximately 7 weeks, with colony characteristics recorded weekly. A non-induced BCG group was used as a control, cultured under the same conditions. Results are as follows: Figure 4 A and Figure 4 As shown in B, starting from the third week, BCG kd Compared to the non-induced BCG group, the growth rate of the bacteria was slower, and the colony area was significantly lower than that of the non-induced wild-type BCG group.

[0098] 2. Results of bacterial acid-fast staining

[0099] Pick BCG kd Single colonies of wild-type BCG in the non-induced group were inoculated into 5 ml of 7H9 liquid medium containing 10% ADC and incubated at 37°C and 125 rpm for 2 weeks. Acid-fast staining was then performed on smears. The results under a light microscope after acid-fast staining are shown below. Figure 5 As shown in Figure A, the vast majority of bacteria in the non-induced BCG group exhibited typical mycobacterial morphology: acid-fast, slender and slightly curved, ranging in size from 1-4 μm, arranged singly, branched, or in clusters. In contrast, BCG... kd They exhibited weak acid resistance, with some bacteria even losing their acid resistance. Some bacterial cells became longer and thicker, and most were arranged singly. Using ImageJ software, positive-positive bacteria and morphologically abnormal bacteria were counted among 200 bacteria, and the results are as follows: Figure 5 B and Figure 5 As shown in C, BCG kd The rate of acid-fast positive bacteria was significantly lower than that of the wild-type BCG group (p<0.01), while the rate of abnormal bacteria was significantly higher than that of the wild-type BCG group (p<0.001).

[0100] 3. Bacterial scanning electron microscopy observation

[0101] Pick BCG kd Single colonies of wild-type BCG in the non-induced group were inoculated into 5 ml of 7H9 liquid medium containing 10% ADC, incubated at 37°C and 125 rpm for 2 weeks, centrifuged at 3000g for 10 minutes, and the bacterial cells were collected. After washing the bacteria three times with sterile PBS, they were fixed with 2.5% glutaraldehyde and subjected to scanning electron microscopy. The results are as follows: Figure 6 As shown, compared to the regular bacillus morphology of wild-type BCG in the non-induced group, BCG... kd The bacteria tend to stick together, and their cell folds are atypical.

[0102] Example 3: CwlM (BCG_3973) gene knockdown strain (BCG) kd Application of regulating training immunity

[0103] 1. BCG at the cellular level kd Regulating the bactericidal ability of human macrophages

[0104] (1) BCG kd Results of regulating human macrophage immune pathways

[0105] Collect BCG in the logarithmic growth phase kd Wild-type BCG was heat-inactivated (56°C, 30 min), dried, and weighed. A bacterial suspension was prepared using physiological saline to a final concentration of 10 μg / ml. (The text then abruptly shifts to a seemingly unrelated topic: 1×10⁻⁶...) 6 After treating human macrophages with a concentration of THP-1 at / ml for 24 hours, centrifuging to remove extracellular bacteria, and inducing differentiation using PMA, the cells were collected for transcriptome analysis. Results are as follows: Figure 7 As shown, macrophages treated with recombinant BCG showed upregulation of 298 genes and downregulation of 108 genes (7A). GO enrichment analysis of differentially expressed genes was performed, categorized by molecular function (MF), biological process (BP), and cellular component (CC). The top 30 GO terms with the lowest p-value (i.e., the most significant enrichment) in each GO category were selected and presented, as shown in 7B. The altered genes were mainly concentrated in immune-related pathways such as the cytokine-cytokine receptor pathway, the viral protein-cytokine receptor pathway, and the Ca2+ pathway. ++ Transcriptome analysis of the two groups showed that BCG signaling pathways, as well as pathways such as PPAR and JAK-STAT (7B). kd It has the potential to regulate the bactericidal ability of human macrophages.

[0106] (2) BCG kd Application of regulating the secretion of Th1 cytokines by human macrophages

[0107] Collect BCG in the logarithmic growth phase kd Wild-type BCG was heat-inactivated (56°C, 30 min), dried, and weighed. A bacterial suspension was prepared using physiological saline to a final concentration of 10 μg / ml. (The text then abruptly shifts to a seemingly unrelated topic: 1×10⁻⁶...) 6 After being treated with THP-1 human macrophages at a concentration of / ml for 24 hours, centrifuged to remove extracellular bacteria, and induced to differentiate using PMA, the macrophages were cultured at rest for 24 hours. Then, phage experiments with *E. coli* were performed at a multiplicity of infection (MOI) of 5:1. After 20 minutes of treatment, residual extracellular bacteria were washed off, and the infection T0 point was recorded. Cells were collected at 0 and 1 hour, RNA was extracted, and the levels of IL-1β, TNF-α, antiviral proteins, and calmodulin in the cells were measured. The results are as follows: Figure 8 As shown, compared to the wild-type BCG group, BCG kd After treatment, macrophages expressed higher levels of IL-1β ( Figure 8 A), TNF-α ( Figure 8 B), antiviral proteins ( Figure 8 C) and calmodulin ( Figure 8 D).

[0108] (3) BCG kd Application of regulating the bactericidal ability of human macrophages against Escherichia coli

[0109] Collect BCG in the logarithmic growth phase kd Wild-type BCG was heat-inactivated (56°C, 30 min), dried, and weighed. A bacterial suspension was prepared using physiological saline to a final concentration of 10 μg / ml. (The text then abruptly shifts to a seemingly unrelated topic: 1×10⁻⁶...) 6 After treating human macrophages with a concentration of / ml of THP-1 for 24 hours, centrifugation was used to remove extracellular bacteria. Differentiation was induced using PMA, followed by 24 hours of resting culture. Then, phage assays were performed on E. coli at a multiplicity of infection (MOI) of 10:1. After 20 minutes of treatment, residual extracellular bacteria were washed away, and the cells were treated with gentamicin for 30 minutes, marked as T0. Cells were collected at T0 and T1h (1 hour later). Cells were lysed using Triton-100, and CFU counts were performed to compare the differences in phagocytic and bactericidal abilities of macrophages. The experimental procedure is as follows: Figure 9 As shown in A, the results are as follows: Figure 9 As shown in B, at point T0, passing through BCG kd The macrophages treated with BCG showed a higher phagocytic capacity for Escherichia coli than the control group (p<0.05); at T1h, after BCG treatment... kd The treated macrophages also showed higher bactericidal activity against Escherichia coli than the control group (p<0.05).

[0110] 2. BCG at the animal level kd Protective effect against heterologous Escherichia coli infection after immunization

[0111] (1) BCG at the animal level kd Protective effect against heterologous Escherichia coli infection after immunization

[0112] Six- to eight-week-old female Balb / c mice were selected and divided into four groups of ten mice each. Approximately 10 mg / L was injected via the tail vein. 6 CFU's BCG kd Wild-type BCG, administered with E. coli (10) 4 weeks after injection. 6 CFU (Cholecystokinin Fumarate) attack was administered, with a saline control group and an attack control group included. The specific immunization procedure is as follows: Figure 10 As shown in Figure A. Blood was collected from the eyeballs 24 hours after the attack to determine the content of acute-reactive proteins; liver, spleen, and kidney tissue homogenates were collected and the bacterial load per mg was counted on solid LB agar plates. Results are as follows. Figure 10 As shown in B, compared to the E. coli challenge control group, wild-type BCG and BCG kdImmunization effectively reduced serum C-reactive protein levels in mice (p<0.01), and BCG... kd The C-reactive protein (CRP) levels in the immunized group were lower than those in the BCG group (p<0.01). CFU results from liver and spleen tissues showed that, compared to the saline control group, the levels in the challenge group, wild-type BCG, and BCG were significantly lower. kd All immunized groups had organ-borne bacteria, but the amount of bacteria carried varied significantly. Figure 10 CD). Compared to the attack control group, wild-type BCG and BCG kd The number of organelle-bearing bacteria in the liver, spleen, and kidneys of the immunized group was significantly reduced, and BCG levels were also significantly lower. kd The bacterial load was lower in the mouse BCG group compared to the wild-type BCG group. These results all indicate that mouse BCG... kd The protective effect against heterologous Escherichia coli infection after immunization.

[0113] (2) BCG at the animal level kd Protective effect against lipopolysaccharide-induced endotoxemia after immunization

[0114] Six- to eight-week-old female Balb / c mice were selected and divided into four groups of ten mice each. Approximately 10 mg / L was injected via the tail vein. 6 CFU's BCG kd Wild-type BCG was administered LPS (2.5 mg / kg) and challenged 4 weeks after injection. A saline control group and a challenge control group were also included. The specific immunization procedure is as follows: Figure 11 As shown in Figure A. Blood was collected from the eyeball 24 hours after the attack to determine the content of acute-reactive proteins; spleen tissue was taken for HE staining. Results are as follows... Figure 11 As shown in B, compared to the LPS-attacked control group, wild-type BCG and BCG kd Immunization effectively reduced serum C-reactive protein levels in mice (p<0.01); in addition, BCG... kd The reduction in serum C-reactive protein was more significant than that of BCG (p<0.01). HE staining of spleen tissue also showed a trend consistent with that of serum C-reactive protein. Figure 11 C). Wild-type BCG and BCG kd Immunity can significantly reduce the degree of inflammatory damage to the spleen, BCG kd Compared to the wild-type BCG group, it can significantly delay the inflammatory response of LPS-induced endotoxemia.

[0115] (3) BCG at the animal level kd Protection against lethal doses of Candida albicans after immunization

[0116] Six- to eight-week-old female Balb / c mice were selected and divided into four groups of ten mice each. Approximately 10 mg / L was injected via the tail vein. 6 CFU's BCG kdWild-type BCG, administered at a lethal dose (10) two weeks after injection. 5 Mice were challenged via the retroocular vein with one (number) Candida albicans sample. Survival rates were calculated weekly for 8 consecutive weeks. A control group was also challenged with Candida albicans. The specific immunization procedure is as follows: Figure 12 As shown in A, BCG kd Two weeks after challenge with wild-type BCG Candida albicans, kidney and liver tissue homogenates were collected, and CFU of Candida albicans were counted using YPD agar plates. Mouse survival rate was as follows: Figure 12 As shown in B, under lethal doses of Candida albicans challenge, wild-type BCG and BCG, compared to the Candida albicans challenge control group, kd Immunization improved the survival rate of mice (p<0.05). BCG and BCG... kd The results of the two comparisons show that BCG kd The BCG group showed a higher survival rate compared to the wild-type BCG group (p<0.05). The CFU count of Candida albicans in kidney tissue two weeks post-challenge also showed that BCG... kd The immunized group, compared to the wild-type BCG group, had a stronger ability to clear heterologous infections. Figure 12 CD, p<0.05).

Claims

1. A recombinant BCG strain with BCG_3973 gene knockdown, named BCG kd Its characteristics are, The recombinant BCG strain was obtained by knocking down the BCG_3973 gene of the BCG strain using CRISPR / dCas9sth1 technology.

2. The recombinant BCG strain as described in claim 1, characterized in that, The sequence of the knockdown expressed BCG_3973 gene is shown in SEQ ID No.

1.

3. The recombinant BCG strain as described in claim 1, characterized in that, When knocking down the BCG_3973 gene using CRISPR / dCas9sth1 technology, the sgRNA sequence used is shown in SEQ ID No.

2.

4. The recombinant BCG strain according to any one of claims 1-3, characterized in that, Obtained by constructing using the following method: (1) Design primers for sgRNA oligoes The primer sequences are shown below: top oligo 5'-GGGAAAATGACCGTCGACCAGCCCGGT-3' bottom oligo: 5'-AAACACCGGGCTGGTCGACGGTCATTT-3' (2) Primer annealing The primers designed in step (1) were annealed to form double-stranded sgRNA oligoes; (3) Digest pLJR965 plasmid with enzymes and recover the large fragment. The CRISPRi backbone plasmid pLJR965 was digested with BsmBI-v2 enzyme, and the large fragments after agarose gel electrophoresis were recovered. (4) Ligating the large fragment digested by pLJR962 with sgRNA oligoes Use T4 ligase to ligate the sgRNA oligoes in step (2) and the large fragment in step (3); (5) The ligation product was transformed into Escherichia coli and positive clones were screened. The ligation product from step (4) was transformed into E. coli, positive clones were screened, plasmids were extracted and sequenced, and the successfully constructed plasmid was named pLJR965-sgRNA. (6) Construction of recombinant BCG strain by electroporation of pLJR965-sgRNA with BCG strain The pLJR965-sgRNA plasmid, which was validated by sequencing in step (5), was electroconverted into BCG competent cells and plated on 7H10 plates containing kanamycin. (7) Induction culture of BCG_3973 gene knockout strain The positive clone colonies from step (6) were inoculated into 7H9 liquid medium containing kanamycin, and tetracycline was added for induction to obtain the recombinant BCG_3973 gene knockdown strain.

5. The recombinant BCG strain as described in claim 4, characterized in that, The annealing conditions in step (2) are 95℃ for 2 min, then decreasing to 25℃ at a rate of 0.1℃ / s.

6. The recombinant BCG strain as described in claim 4, characterized in that, In step (7), the induction concentration of tetracycline is 50 ng / ml-200 ng / ml.

7. The recombinant BCG strain as described in claim 6, characterized in that, In step (7), the induction concentration of tetracycline is 100 ng / ml.

8. The use of the recombinant BCG strain according to any one of claims 1-7 in the preparation of a medicament for treating heterologous bacterial or substance infections.

9. The application as described in claim 8, characterized in that, The heterologous bacteria or substances mentioned include Escherichia coli, Candida albicans, and lipopolysaccharides.

10. The application as described in claim 8, characterized in that, The drug mentioned is a vaccine.