Application of citrate synthase gene AtCS in regulation and control of anti-aging capability of seeds and method for screening seed anti-aging agent

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to application of a citrate synthase gene AtCS to regulation and control of seed aging resistance and a method for screening a seed anti-aging agent. The invention provides an application of a citrate synthase gene AtCS in aging resistance of seeds. The nucleotide sequence of the citrate synthase gene AtCS is as shown in SEQ ID NO. 1. The citric acid synthase gene AtCS (AtCS gene for short) is coded and positioned on citric acid synthase of mitochondria, and the AtCS gene plays a key role in regulating and controlling the steady state of reactive oxygen species and the aging resistance of seeds. Results of the embodiment show that after AtCS gene knockout mutant seeds are aged, the germination rate is remarkably reduced, membrane lipid peroxidation products are accumulated, an active oxygen scavenging system is damaged, the mutant can be used for screening seed anti-aging agents, and a new solution thought is provided for seed aging resistance.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the citrate synthase gene. AtCS Applications for regulating seed anti-aging ability and methods for screening seed anti-aging agents. Background Technology

[0002] Citrate synthase is the initiating and key rate-limiting enzyme of the tricarboxylic acid cycle, responsible for catalyzing the production of citrate, and plays a central role in cellular energy metabolism and the generation of reducing power (such as NADPH). Arabidopsis thaliana AtCS The gene has been cloned and its encoding of citrate synthase, located in mitochondria, has been clearly verified. However, plant gene regulatory networks are complex. AtCS Other functions of the gene have not been fully elucidated, and the known functions are limited.

[0003] Aging is a key challenge restricting agricultural production and germplasm resource preservation, with its core being oxidative damage caused by excessive accumulation of reactive oxygen species (ROS) in seeds during storage. Current strategies to enhance seed anti-aging capabilities mainly focus on increasing the activity of terminal antioxidant enzymes such as superoxide dismutase (SOD) and catalase (CAT). However, this "terminal scavenging" strategy has inherent limitations, including limited effectiveness and the potential to interfere with normal plant physiological metabolism. Therefore, exploring new targets and pathways for regulating seed aging from the "source" of energy metabolism rather than the "terminus" of ROS has significant theoretical value and application potential. Summary of the Invention

[0004] The purpose of this invention is to provide a citrate synthase gene. AtCS The application of regulating seed anti-aging ability and the method of screening seed anti-aging agents, the citrate synthase gene AtCS It can regulate the homeostasis of reactive oxygen species in seeds and their anti-aging ability, and can be used to screen anti-aging agents.

[0005] This invention provides a citrate synthase gene. AtCS Application of the citrate synthase gene in seed anti-aging AtCS The nucleotide sequence is shown in SEQ ID NO.1.

[0006] As a preferred embodiment, the application includes: reducing the citrate synthase gene. AtCS Increased expression levels reduce the plant's resistance to aging.

[0007] This invention also provides a method for knocking out the citrate synthase gene. AtCS The sgRNA, whose coding sequence targets AtCS The gene target includes the sequence shown in SEQ ID NO.2.

[0008] This invention also provides a citrate synthase gene AtCS Related biological materials, including recombinant vectors or recombinant bacteria containing the sgRNA described in the above scheme.

[0009] The present invention also provides an Arabidopsis thaliana plant, wherein the citrate synthase gene is present in the Arabidopsis thaliana plant. AtCS The expression level was suppressed.

[0010] The present invention also provides a method for constructing Arabidopsis thaliana plants according to the above scheme, comprising the following steps: introducing the sgRNA or the biological material described in the above scheme into Arabidopsis thaliana plants.

[0011] The present invention also provides the application of Arabidopsis thaliana plants described in the above scheme or Arabidopsis thaliana plants obtained by the above construction method in screening seed anti-aging agents.

[0012] This invention also provides a method for screening seed anti-aging agents, comprising the following steps: treating seeds of Arabidopsis thaliana plants and wild-type Arabidopsis thaliana seeds respectively with the test compound to obtain two groups of treated seeds; comparing the detection indicators of the two groups of treated seeds; the detection indicators include germination rate; If the test compound can improve the germination rate of Arabidopsis thaliana seeds and has no significant effect on wild-type Arabidopsis thaliana seeds, the test compound is determined to be a potential seed anti-aging agent.

[0013] As a preferred embodiment, after obtaining the two groups of treated seeds, the method further includes: artificially aging the two groups of treated seeds; the detection index also includes: reactive oxygen species scavenging capacity.

[0014] As a preferred embodiment, the potential seed anti-aging agent includes citric acid and / or spermidine.

[0015] Beneficial effects: This invention provides a citrate synthase gene. AtCS Application of the citrate synthase gene in seed anti-aging AtCS The nucleotide sequence is shown in SEQ ID NO.1. The citrate synthase gene of this invention... AtCS (abbreviation) AtCS The gene encodes citrate synthase, which is located in the mitochondria. AtCS Genes play a crucial role in regulating reactive oxygen species homeostasis and anti-aging ability in seeds. The results of the examples show that... AtCS Seeds from gene knockout mutants showed a significant decrease in germination rate after aging, accumulation of membrane lipid peroxidation products, and damage to the reactive oxygen species scavenging system. This mutant can be used to rapidly and accurately screen for seed anti-aging agents, providing a new solution for seed anti-aging.

[0016] This invention also provides the knockout of the citrate synthase gene. AtCS The sgRNA or biological material can be used to knock out the citrate synthase gene. AtCS Construct knockout mutants.

[0017] This invention also provides an Arabidopsis thaliana plant, wherein the citrate synthase gene in the Arabidopsis thaliana plant (hereinafter referred to as the mutant) of this invention is present. AtCS Expression levels were suppressed. The seed germination rate of the mutant described in this invention was significantly reduced. Potential seed anti-aging agents could be screened by comparing the germination rates of mutant seeds with those of wild-type seeds. The establishment of this mutant system provides an effective tool for high-throughput screening of plant anti-aging regulators and elucidation of seed senescence mechanisms.

[0018] This invention also provides a method for screening seed anti-aging agents, comprising the following steps: treating seeds of Arabidopsis thaliana plants and wild-type Arabidopsis thaliana seeds respectively with a test compound to obtain two groups of treated seeds; comparing the detection indicators of the two groups of treated seeds; the detection indicators include germination rate; if the test compound can improve the germination rate of Arabidopsis thaliana seeds and has no significant effect on wild-type Arabidopsis thaliana seeds, the test compound is determined to be a potential seed anti-aging agent. The method of this invention can efficiently screen potential seed anti-aging agents by comparing the germination rates of mutant seeds and wild-type seeds, and the method is simple and easy to operate. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0020] Figure 1 This image shows the results of PCR identification of positive clone colonies after transformation of Escherichia coli DH5α with the recombinant plasmid pEGAtCas9PcUBI-AtCS; lane M is the DL2000 DNA Marker; lanes 1-10 are colony amplification products; lane - is the negative control; lane + is the positive control, with the expected target band at 1700bp. Figure 2 for AtCS A schematic diagram of the construction of the gene knockout vector (pEGAtCas9PcUBI-AtCS); Figure 3 This is a preliminary PCR screening diagram of Arabidopsis thaliana T1 generation transgenic plants; the expected target band is 449bp; lane M is the DL700 DNA Marker; lanes 1-30 are the amplification products of the test lines; Figure 4 Phenotypic diagram of Arabidopsis thaliana plants; where WT represents wild-type Arabidopsis thaliana; Ko represents...AtCS Gene knockout mutant; Ko+CS is a gene knockout mutant treated with exogenous citric acid. AtCS Gene knockout mutants; Figure 5 This study compares the physiological indicators of seeds after aging under different treatments; where A represents germination rate; B represents malondialdehyde (MDA) content; C represents hydrogen peroxide content; and D represents ATP content. Figure 6 This study compares the antioxidant and metabolic activities of seeds after aging under different treatments; where A represents superoxide dismutase activity; B represents citric acid content; and C represents the NADPH / NADP ratio. + D represents the rate of cellular respiration. Figures 5 - 6 Different lowercase letters indicate significant differences between groups at the p < 0.05 level. All data described in this invention were analyzed using one-way ANOVA and Tukey post-hoc test. Detailed Implementation

[0021] This invention provides a citrate synthase gene. AtCS Application of the citrate synthase gene in seed anti-aging AtCS The nucleotide sequence is shown in SEQ ID NO.1. This invention relates to the citrate synthase gene. AtCS (abbreviation) AtCS The gene () is encoded by the Arabidopsis thaliana locus AT3G58750, which encodes citrate synthase located in the mitochondria. AtCS Genes play a crucial role in regulating the homeostasis of reactive oxygen species and the anti-aging ability of seeds, and can be applied to seed anti-aging.

[0022] As one implementation, the application includes: reducing the citrate synthase gene. AtCS Expression levels reduce plant anti-aging ability. As one implementation method, reducing plant anti-aging ability includes: reducing seed germination rate, increasing malondialdehyde content in seeds, and increasing electrolyte leakage rate. Example results show that... AtCS The germination rate of gene knockout mutant seeds decreased significantly after aging, with the accumulation of membrane lipid peroxidation products and damage to the reactive oxygen species scavenging system.

[0023] This invention also provides a method for knocking out the citrate synthase gene. AtCS The sgRNA, whose coding sequence targets AtCS The gene target includes the sequence shown in SEQ ID NO.2. In this invention, the sgRNA sequence is based on... AtCS By designing gene exons, it is possible to achieve... AtCS Gene knockout.

[0024] This invention also provides a citrate synthase gene AtCSThe relevant biological materials include recombinant vectors or recombinant bacteria containing the sgRNA described in the above-described scheme. As one embodiment, the base vector for the recombinant vector is the pCAMBIA1300 vector. As one embodiment, the method for constructing the recombinant vector includes: constructing an sgRNA expression cassette; inserting the sgRNA expression cassette into the base vector to obtain the recombinant vector. As one embodiment, the base bacterium for the recombinant bacteria includes Agrobacterium; as one embodiment, the construction of the recombinant bacteria includes: introducing the recombinant vector into Agrobacterium to obtain the recombinant bacteria.

[0025] The present invention also provides an Arabidopsis thaliana plant, wherein the citrate synthase gene is present in the Arabidopsis thaliana plant. AtCS Expression levels are suppressed. In this invention, the suppression occurs by knocking out or down the citrate synthase gene. AtCS The Arabidopsis thaliana plant (hereinafter referred to as the mutant) described in this invention ​ The gene expression level is suppressed, and the anti-aging ability is reduced, making it suitable for screening seed anti-aging agents. This invention does not specifically limit the source of the original Arabidopsis thaliana plants used for the suppression modification; conventional Arabidopsis thaliana in the field can be used.

[0026] This invention also provides a method for constructing Arabidopsis thaliana plants according to the above-described scheme, comprising the following steps: introducing the sgRNA or the biological material described in the above-described scheme into Arabidopsis thaliana plants. As one embodiment, this invention introduces the recombinant bacteria into Arabidopsis thaliana plants; as one embodiment, the introduction method includes inflorescence immersion. As one embodiment, the inflorescence immersion method includes: immersing the inflorescence of an Arabidopsis thaliana plant in the bolting and flowering stage into OD... 600 The bacteria were immersed in a recombinant bacterial suspension at approximately 0.8 g / L for 30 seconds, with gentle agitation during this period. After inoculation, the plants were removed and excess bacterial solution was aspirated. They were then co-cultured under dark, high-humidity conditions for 2 days. As one implementation method, after the co-culture, the infected Arabidopsis plants were transferred to normal conditions for cultivation until T0 generation seeds were harvested. As one implementation method, the normal conditions were: a photoperiod of 16 h light followed by 8 h darkness; and a light intensity of 100–150 μmol·m⁻¹ during the light period. -2 ·s -1 The temperature was 22±2℃, and the temperature during the dark period was 18±2℃; the relative humidity was 50%~60%.

[0027] After harvesting the T0 generation seeds, the present invention cultured the T0 generation seeds on a medium containing hygromycin to obtain T1 generation plants. As one embodiment, the final concentration of the hygromycin was 50 mg / L. After obtaining the T1 generation plants, the present invention extracted DNA from the leaves of the T1 generation plants and performed PCR genotyping to obtain the genome... ​T1 generation positive plants with gene mutation. As one implementation method, the primer sequences for PCR genotyping are shown in SEQ ID NO.16 and SEQ ID NO.17.

[0028] The genome was obtained ​ Following the T1 generation of positive plants with gene mutations, self-pollination selection is also conducted to obtain stably heritable plants. ​ Gene knockout homozygous lines. As one implementation method, the self-crossing selection includes: [the process of selecting homozygous gene knockout lines from the genome]. ​ T1 generation positive plants with gene mutations were self-pollinated, and their offspring (T2 generation) were subjected to hygromycin resistance segregation ratio analysis and PCR genotyping. Single plants without hygromycin resistance segregation and identified as homozygous mutants by PCR were selected. The self-pollinated offspring (T3 generation) of these plants are the stably heritable mutants. ​ Gene knockout homozygous lines, i.e., the self-crossed offspring (T3 generation) are... ​ Gene deletion homozygous inheritance is stable.

[0029] This invention also provides the application of the Arabidopsis thaliana plants described in the above-described scheme or the Arabidopsis thaliana plants obtained by the construction method described above in screening seed anti-aging agents. The citrate synthase gene in the Arabidopsis thaliana plants described in this invention... ​ When the expression level is suppressed, the seed's anti-aging ability decreases and the germination rate drops significantly. Potential seed anti-aging agents can be screened by comparing the germination rates of mutant seeds and wild-type seeds. The establishment of this mutant system provides an effective tool for high-throughput screening of plant anti-aging regulators and elucidating the mechanism of seed senescence.

[0030] This invention also provides a method for screening seed anti-aging agents, comprising the following steps: treating seeds of Arabidopsis thaliana plants and wild-type Arabidopsis thaliana seeds respectively with the test compound to obtain two groups of treated seeds; comparing the detection indicators of the two groups of treated seeds; the detection indicators include germination rate; If the test compound can improve the germination rate of Arabidopsis thaliana seeds and has no significant effect on wild-type Arabidopsis thaliana seeds, the test compound is determined to be a potential seed anti-aging agent.

[0031] This invention uses seeds of *Arabidopsis thaliana* plants and wild-type *Arabidopsis thaliana* seeds as samples to screen for seed anti-aging agents. In this invention, the seeds of the *Arabidopsis thaliana* plant (mutant) are denoted as Ko seeds, and the seeds of the wild-type *Arabidopsis thaliana* are denoted as WT seeds. As one implementation method, the wild-type *Arabidopsis thaliana* and the *Arabidopsis thaliana* plant are homologous plants. Selecting wild-type *Arabidopsis thaliana* seeds homologous to the mutant can avoid interference from other factors and improve the screening accuracy. The homologous plants referred to in this invention are plant individuals with the same genetic background, differing only at the target gene locus or in specific trait-related regions.

[0032] In one implementation method, the Ko seeds are randomly divided into two groups, denoted as the Ko group and the Ko + test compound group; the WT seeds are also randomly divided into two groups, denoted as the WT group and the WT + test compound group. The Ko group and WT group are collectively referred to as the control group, and the Ko + test compound group and WT + test compound group are collectively referred to as the test compound group. By comparing the germination rates of the seeds in the control group and the test compound treatment group, the present invention can observe the effect of the test compound on the seed germination rate, thereby screening for potential seed anti-aging agents.

[0033] This invention utilizes test compounds to treat WT+ and Ko+ test compound groups separately, obtaining treated test compound groups. As one embodiment, the treatment includes immersion. As another embodiment, the immersion time is 24 h; the immersion temperature is 4°C; and the immersion conditions are dark conditions. The immersion time of this invention ensures that the test compounds are fully absorbed and produce stable biological effects, while avoiding non-specific toxicity or complex secondary reactions caused by excessively long treatment times, which is beneficial for capturing the direct and initial pharmacological effects of the compounds. The core of the 4°C treatment is to inhibit cellular basal metabolism. This simultaneously reduces the inherent metabolic background differences between wild-type (WT) and gene knockout (Ko) plants, making the subtle phenotypic changes produced by the compounds acting on specific pathways more clearly highlighted, significantly improving the signal-to-noise ratio, and facilitating accurate identification of compound effects dependent on the target gene. The invention's limitation to dark conditions eliminates interference from variables such as photosynthesis, biological clock, or photodegradation that may be caused by light, ensuring environmental consistency across all treatment groups and protecting the stability of photosensitive compounds, thereby guaranteeing high experimental reproducibility. These conditions collectively create a clean, controlled standard treatment window that can sensitively and specifically reveal the true differences of compounds between WT and Ko plants, laying a reliable foundation for the precise screening of lead compounds acting on target pathways. The synergistic optimization of the soaking treatment conditions in this invention ensures the accuracy, sensitivity, and reproducibility of the screening results.

[0034] After obtaining the treated test compound group, the present invention conducts a germination experiment on the seeds of the control group and the treated test compound group, and compares the seed detection indicators; the detection indicators include germination rate. As one embodiment, the germination experiment includes: sterilizing the seed surface, sowing in MS medium, and subjecting the seeds to 16 h of light at a light intensity of 100-120 μmol·m⁻¹. -2 ·s -1 The plants were cultured in darkness for 8 hours at a constant temperature of 22±2℃, and the germination rate was calculated after 10 days. As one implementation method, the detection indicators also included reactive oxygen species scavenging capacity and malondialdehyde content. The citrate synthase gene of the Arabidopsis thaliana plant described in this invention...​ Inhibiting the expression level can reduce the germination rate and reactive oxygen species scavenging capacity of plants and increase the malondialdehyde content. If the compound to be tested is a potential seed anti-aging agent, seed treatment can improve the seed germination rate and reactive oxygen species scavenging capacity and reduce the malondialdehyde content.

[0035] In one implementation method, after obtaining the treated test compound group, the method further includes: pre-treating and artificially aging the seeds of the control group and the treated test compound group. In one implementation method, the pre-treatment includes: equilibrating the seeds for 3 days to obtain pre-treated seeds; the equilibration temperature is 20°C; and the equilibration humidity is 85%. Seeds from different batches and sources may have different initial moisture contents. Without pre-treatment, seeds with high moisture content will absorb more water in the high-temperature and high-humidity aging environment, leading to excessively vigorous internal reactions, potentially resulting in direct death or aging far exceeding expectations. Conversely, seeds with low moisture content may not react sufficiently, resulting in inadequate aging. This leads to inconsistent seed aging processes, resulting in highly variable experimental data (such as germination rate), unreliable results, and an inability to make effective comparisons. The pretreatment described in this invention balances all seeds under a mild temperature (20°C) and target humidity (85%) to fully absorb or desorb moisture, ultimately achieving a stable and uniform initial moisture content that is in equilibrium with the 85% relative humidity environment. This ensures that all seeds start from the same point when entering the harsh 42°C aging environment, avoiding errors.

[0036] After obtaining pretreated seeds, the present invention subjectes the pretreated seeds to artificial aging treatment. As one embodiment, the artificial aging treatment includes: placing the pretreated seeds in a desiccator containing a saturated KCl solution (relative humidity 85%) and treating them at 42°C for 5 days. The artificial aging treatment of the present invention can simulate harsh environments to accelerate the seed aging process and evaluate the anti-aging ability of the test compounds.

[0037] In one implementation, the potential seed anti-aging agent includes citric acid and / or spermidine. This invention utilizes a seed anti-aging agent screening method to screen for citric acid and spermidine, which can improve seed anti-aging ability. Example results show that exogenous application of citric acid can enhance the antioxidant capacity of plants, alleviate oxidative damage caused by aging, and improve seed germination vigor and seedling growth under aging stress, thus enabling its use in breeding to improve seed anti-aging ability. After treating *Allium tuberosum* seeds with citric acid, the germination rate of citric acid-treated *Allium tuberosum* seeds was higher than that of the untreated control group with prolonged storage time. Speridine can improve the germination rate of seeds after aging treatment and can be used for further development of seed anti-aging agents.

[0038] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1 ​ Gene effect verification experiment (1) sgRNA design and synthesis according to ​ The nucleotide sequence of the gene (SEQ ID NO.1) was used to design specific sgRNAs targeting its exon regions. Using the CRISPR-P 2.0 online design tool, targets with low off-target risk were screened, and two targets (sgRNA-AtCS1 and sgRNA-AtCS2) were finally selected. Their target sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively, as detailed in Table 1.

[0040] Table 1 sgRNA target sequences

[0041] ​ The nucleotide sequence of the gene is shown in SEQ ID NO.1: 5'-aagattgtttcttcttcttcttcttcgcttccttcctttgaaattgaattcagatatttttttaaaattttttgagaggaagaa ​ GTGAAAGCTAGATTAGCCGTTCTCACCGCGCATTTGGCGGTGTCTGATACCGTCGGATTGGAACAGGTGTTG ​ g ​ ​ GTATGTAACGGATTTGTAATCCTGAACAGAATTGTGGAATCGAGTTAGTTTTATCTGAATTTTGATTCGTCTCACCTAATTTTCCCTGAATATGATAAGGAATTTGATGGATTTGCATGTTTGGTGTGCAG ​ AAGGGGCTGAAGTTGTACGATCCtggttacttgaacacggctc ​ TTCGATCTTCGATTTGTTACATCGACGGAG ​ ​ GTAAGTCTTTATCAATCTCGTTGCTTATTCTTGTTGTTGTTGTTGCTTATTTTACTTTTGTGGCGTCTACTTGTGGAAAAGAAAATGTCTTGAAAATTGTGTCTCTCTTAGTGTCGTGTTAAAATTCCCCTTTTTTTGTCTCCAG ​ ​GTGAAATTTCTACTCTTTCGTTATTTGGATTTTCATACTAGTGCAAATTCCAAACTTTGTATCAGAATGCAAATCCAAACCAAAGAGGATTTTGAAAATGATTTCTTGTCAAGTGTACAAGTTGTTTGTCTTGCTTGTAAACCATGTCTATTAAGGATACTGGATTCTCTTTCTAGTATTAGTACCTTATGTCTTACTCGCCGTTGTGAATATAGTTATGTGTATATGCTTAGTAAAAGAATTTTCTATGGATTTTTGATCTGAGACGATTTCTGAATGTTTTTGCAG ​ ​ ​ GTAAGTTTTGAAATCCTGTTCTTTTCGTACTGTCAAGATGCCTTTTTCTGAAAATGGCTATGCCAACTCGATTTTCTTTCATTGGGTGCAG ​ ​ GTATTGTTCTATCTGTTGATGATTTGTTTCCTTAACGTATCTGTGTATAAGTTGCGGGACTAGAAAAGGGTTTACAACGTGTTTGCAG ​ ​ GTACTTTCCCCTCTTTCTTCTGTCTTTATTTGATTTAACACTTGCATTTTAAAAGGGTAGTCAGAAAAACTGTGTTTCTTTAGTCAGTTTAAATCTGTTTCAAGCTTCAAACGTGTCTGTAACACAGGATACATTCTTTAATCTTCAATTGATTACAG ​ ​ GTACTTATCAGTTATCACTGATTAGAGATATTCATTTAGACTTCTTTGAGTGTTTAAATCAGTATTGTGTTTCTGCAG TGGTGTTGATGTGTACACCGCATGTGC TGGAGCTGTTGGGGCGCTTTATGGTCCACTTCATGGTGGCGCGAACGAGGCCGTGCTTAAGATGTTAGCAGAGATT GGGACTGCTGAAAATATTCCAGATTTCATTGAAGGCGTGAAGAACAG GTAACTCAATGCTTAATAACTACAAGCACCAAGTACTCTGAATTGTGGTGAGTCATGCCGGTAATGTTATATCCCTTTTCTATGTTCTCAG AAAGAGGAAGATGT CAGGTTTTGGACATCGTGTTTACAAAAACTATGACCCCCGAGCAAAAGTTATAAAAAAACTGGCAGATGAAGTGTT CTCCATTGTTGGTAGGGATCCTCTCATCGAGGTACTGTAGATCCTTGTGCTCACGTATCTCTCCTAGTATTTGGTTGTCAAAAAAATTCTTATATAACATGACTGTGGGTTAAATTTTGTTTTGACGGATGATGTTTTCAG GTAGCAGTTGC TCTAGAGAAGGCGGCACTGTCTGATGAATATTTTGTTAAGAGAAAGCTGTACCCAAATGTTGATTTCTACTCTGGA TTAATCTATAG GTAAGACATTGCTGATTCATCTGACATAGACCCTGTAACCATTAAGTTCTTTACCTGAACCTTGTGTTGGTAATTGAAATGGGGGAAAAACACAG GGCAATGGGATTCCCACCAGAATTCTTCACAGTCCTGTTCGCAGTC CCGCGTATGGCTGGATACTTGTCACACTGGCGTGAGTCGTTAGATGATCCTGACACTAGGATCATGAGACCCCAAC AG GTAAAATACATAACTTGTTTGATAGATCAAAAGGTTTATAGTTTGAGCTAACTGAATTGTGTGGCTGCATATAG GCCTATACTGGAGTGTGGATGAGGCATTACGAGCCAGTGAGAGAACGAACGTTATCAAGTGATTCGGATAAGGATA AGTTTGGTCAAGTTTCCATTTCGAATGCATCAAGAAGGCGTTTAGCTGGATCATCTGCCCTTTAG tctcaatcctaatactcaccaataaagaagaaaacattgggatacctctgggaaaacaagagagtc-3'; where the box contains the target sequence; bold italicized bases are PAM sites; underlined regions are exons; lowercase base sequences are those located upstream and downstream of the start and stop codons; and the others are intron sequences.

[0042] (2) Overlap extension PCR and nested PCR amplification of sgRNA expression cassette The sgRNA expression cassette was amplified using overlap extension PCR combined with nested PCR technology. The primer sequences used are shown in Table 2.

[0043] Table 2 Primers for amplifying sgRNA expression cassettes

[0044] In the table, the lowercase bases in the primer Cas-9-AtU6-29 sequence are sequences on the small promoter; the lowercase base ggtctc in the primers Pps-R, Pgs-2, Pps-2 and Pgs-L sequences is the recognition site of the restriction endonuclease BsaⅠ; the lowercase bases immediately before and after ggtctc are sticky end sequences.

[0045] ① First round of PCR amplification of U6 promoter and gRNA: The first round of PCR amplified the U6 promoter (using UF / Cas-9-AtU6-26 or UF / Cas-9-AtU6-29 as primers, primer information is shown in Table 2, and amplification system is shown in Table 3) and gRNA (using gRNA-R / Cas-9-gRT1 and gRNA-R / Cas-9-gRT2 as primers, primer information is shown in Table 2, and amplification system is shown in Table 4), and the reaction procedure is shown in Table 5; Table 3 pU6 amplification system

[0046] Table 4 gRNA amplification system

[0047] Table 5 PCR reaction procedure

[0048] ② Second-round PCR amplification of the sgRNA expression cassette: Using the first-round PCR product as a template, the second-round PCR amplified the complete sgRNA expression cassette using Pps-R / Pgs-L primers (primer information is shown in Table 2, amplification system is shown in Table 6) through overlap extension, as shown in Table 7. The PCR product was detected by 1.0% agarose gel electrophoresis, and the expected band of 500-700 bp was excised and purified using a gel extraction kit.

[0049] Table 6 sgRNA expression cassette amplification system

[0050] Table 7 sgRNA expression cassette amplification program

[0051] (3) Carrier construction A CRISPR / Cas9 knockout vector was constructed using Golden Gate cloning technology. The purified sgRNA expression cassette obtained in the previous steps was ligated into the backbone of a plant binary expression vector pEGAtCas9PcUBI (purchased from Wuhan Aidijing Biotechnology Co., Ltd., which contains the BsaI-HF recognition site and the Cas9 protein coding sequence, forming a CRISPR / Cas9 expression cassette based on the pCAMBIA1300 plant binary expression vector, with the Cas9 gene driven by the maize ubiquitin promoter (PcUbi) and the sgRNA scaffold driven by the Arabidopsis thaliana AtU6-26 promoter inserted into its GUS reporter gene region, to obtain the Golden Gate ligation reaction product. The reaction mixture contained: 1.5 μL of 10×CutSmart Buffer, 1.5 μL of 10 mM ATP, 1 μL of BsaI-HF restriction endonuclease (10 U / μL), 1 μL of T4 DNA ligase (35 U / μL), approximately 30 ng of linearized vector backbone, and a purified sgRNA expression cassette (added at a vector to fragment molar ratio of 1:3). Sterile ddH2O was added to a total volume of 15 μL. The reaction mixture was placed in a PCR instrument and the following program was run: 37℃ for 5 min, 20℃ for 5 min, for 15 cycles; followed by 50℃ for 5 min, and 80℃ for 10 min.

[0052] (4) Plasmid transformation The Golden Gate ligation reaction product was transformed into *E. coli* DH5α competent cells using a heat shock method to obtain transformants. These transformants were then plated on LB agar containing 50 mg / L kanamycin and incubated upside down at 37°C for 16 h. Single colonies were then picked. The single colonies growing on the plates may contain the pEGAtCas9PcUBI-AtCS recombinant plasmid clone.

[0053] Using selected single colonies as templates, PCR identification of single colonies was performed using universal vector primers E9-F and RB-R (sequences shown in Table 2). If the PCR amplification product showed a specific band at the expected size position (approximately 1700 bp) when detected by agarose gel electrophoresis, it indicated that the colony may contain a recombinant plasmid of the expected size and could be used as a positive clone candidate.

[0054] Test results as follows Figure 1As shown, plasmids were further extracted from colonies displaying the expected bands, and Sanger sequencing was performed using primers E9-F and RB-R to confirm that the sgRNA expression cassette had been correctly inserted into the vector multiple cloning site and that the sequence was error-free. The recombinant CRISPR / Cas9 knockout vector pEGAtCas9PcUBI-AtCS was finally obtained, and its vector map is shown below. Figure 2 As shown.

[0055] Example 2 (1) Preparation of inoculum and inflorescence inoculum: The recombinant plasmid pEGAtCas9PcUBI-AtCS successfully constructed in Example 1 was introduced into competent cells of Agrobacterium tumefaciens GV3101 by heat shock method. After transformation, the cells were screened on LB solid medium containing 50 mg / L rifampin and 50 mg / L kanamycin to finally obtain the Agrobacterium tumefaciens engineered strain containing the target gene.

[0056] The Agrobacterium engineered strain containing the target gene was resuspended in 1 / 2 MS liquid medium, and then the surfactant Silwet L-77 was added. The volume percentage of Silwet L-77 in the suspension was 0.02%. The concentration of the engineered bacterial suspension was adjusted to OD0.05. 600 The value was 0.8, and the engineered bacteria suspension was obtained and immediately used for inflorescence infection.

[0057] Wild-type Arabidopsis thaliana (Columbia-0 ecotype) plants in the bolting and flowering stage (early flowering period) were selected. After removing the formed siliques, the inflorescences were immersed in the OD. 600 The culture was immersed in an engineered bacterial suspension with a pH of 0.8 for 30 seconds. During the immersion process, the suspension was gently agitated to ensure full contact. After immersion, excess bacterial suspension was gently aspirated or blotted dry with sterile filter paper. The culture was then incubated in the dark at 80%–90% humidity for 2 days. After that, the culture was transferred to normal light and temperature conditions until the T0 generation seeds were harvested.

[0058] The normal light and temperature conditions are as follows: a photoperiod of 16 hours of light followed by 8 hours of darkness; and a light intensity of 100–150 μmol·m⁻² during the light period. -2 ·s -1 The temperature was 22±2℃, and the temperature during the dark period was 18±2℃; the relative humidity was 50%~60%.

[0059] (2) Screening of positive plants Preparation of screening medium: Using 1 / 21 MS medium as the base medium, add 1% sucrose and 0.8% agar, adjust the pH to 5.8, sterilize by high temperature and high pressure, and when the medium cools to about 50℃~60℃, aseptically add filtered sterilized hygromycin (Roche) to a final concentration of 50 mg / L, mix well, and pour into plates for later use.

[0060] After sterilizing the T0 generation seeds described in step (1), they were sown in a selection medium containing 50 mg / L hygromycin and cultured under light. The light conditions were 16 h of light followed by 8 h of darkness, with a light intensity of 100–120 μmol·m⁻¹. -2 ·s -1 The temperature was kept constant at 22±2℃ until the seeds germinated, yielding Arabidopsis thaliana T1 generation plants. Positive seedlings were then selected from the Arabidopsis thaliana T1 generation plants.

[0061] T1 generation Arabidopsis plants were screened. Fresh young leaves were collected from the T1 plants when they had grown to the 6th-8th true leaves but had not yet bolted, serving as the positive seedling leaf group. Wild-type Arabidopsis was used as the negative control. Genomic DNA was extracted from the positive seedling leaves using the CTAB method. Using the genomic DNA from the positive seedling leaves as a template, primers shown in SEQ ID NO.16 and SEQ ID NO.17 (see Table 8) were used to... AtCS Gene target regions were amplified by PCR and sequenced to identify their mutation types.

[0062] The results are as follows Figure 3 As shown, a specific band of the same size as the positive control (449 bp) was detected in the transformed plants. Of the 30 Arabidopsis thaliana plants co-transformed, 14 were confirmed as positive by PCR. Sanger sequencing was performed by Sangon Biotech (Shanghai) Co., Ltd., and the results showed that both alleles of 12 samples had identical base insertions, indicating double heterozygous insertion mutations (see Table 9), demonstrating successful gene knockout. Table 9 shows that the insertion sites all correspond to the target sequence shown in SEQ ID NO. 2.

[0063] Table 8 AtCS Genotype identification primers for gene knockout strains

[0064] Table 9 AtCS Genotyping of gene knockout lines

[0065] Note: Bold italics indicate inserted bases. Example 3: Artificial aging treatment of seeds The T1 generation positive seedlings described in Example 2 were continuously self-pollinated until the T3 generation homozygous Arabidopsis seeds were harvested; these were designated as knockout plants. AtCS Genetically aged Arabidopsis seeds were used for subsequent experiments.

[0066] Wild-type Arabidopsis seeds and seeds from the T3 generation homozygous line were equilibrated at 20℃ and 85% humidity for 3 days. The seeds were then placed in empty petri dishes, and these dishes were placed in a desiccator containing saturated KCl solution (85% relative humidity) for aging at 42℃ for 5 days to obtain aged wild-type Arabidopsis seeds (denoted as WT+A) and knockout seeds. AtCS Genetically aged Arabidopsis seeds (denoted as Ko+A).

[0067] (1) Seed germination experiment: wild-type Arabidopsis thaliana seeds (denoted as WT) and knockout seeds were used. [[ID=2 Arabidopsis thaliana seeds with the gene (denoted as Ko), wild-type aging Arabidopsis thaliana seeds (denoted as WT+A), and knockout genes. ​ Aged Arabidopsis thaliana seeds (denoted as Ko+A) were used as samples. 300 seeds were prepared for each group, and these 300 seeds were divided into three equal replicates for seed germination experiments. The experimental procedure was as follows: After surface sterilization, the seeds were sown in MS medium and exposed to light for 16 h at a light intensity of 100–120 μmol·m⁻¹. -2 ·s -1 Germination was carried out in darkness for 8 hours and at a constant temperature of 22±2℃. Germination rate was calculated after 10 days, and the results are as follows. ​ As shown in Figure A.

[0068] according to ​ As shown in Figure A, under normal conditions without aging treatment, the germination rate of Ko seeds was 47.33%, significantly lower than the 79.33% of WT seeds. After artificial accelerated aging treatment, the germination rate of Ko+A group seeds further decreased to 29.33%, also significantly lower than the 64.67% of WT+A group. These results indicate that knocking out... ​ The gene can significantly reduce the germination ability and anti-aging ability of Arabidopsis seeds.

[0069] (2) Observation of Arabidopsis growth status: After germination, Arabidopsis thaliana from the WT and Ko treatment groups were cultured under normal light and temperature conditions for 3-4 weeks. The appearance of Arabidopsis thaliana from different groups was then recorded. The results are as follows: ​ As shown. The normal light and temperature conditions are as follows: a photoperiod of 16 hours of light followed by 8 hours of darkness; and a light intensity of 100–150 μmol·m⁻² during the light period. -2 ·s -1 The temperature is 22±2℃, and the temperature during the dark period is 18±2℃; the relative humidity is approximately 50%~60%.

[0070] according to ​ It can be seen that the growth status of transgenic seedlings is significantly worse than that of wild-type Arabidopsis thaliana under the same treatment.

[0071] (3) Determination of anti-aging physiological indicators: The malondialdehyde (MDA) content in Arabidopsis seeds of the WT, Ko, WT+A and Ko+A groups was determined by the thiobarbituric acid method; the hydrogen peroxide (H2O2) content was determined by spectrophotometry; the ATP content was determined by a kit and the superoxide dismutase (SOD) activity was determined by spectrophotometry (all kits were purchased from Solarbio); the citric acid (CA) content was determined by a citric acid content detection kit (purchased from Solarbio, catalog number: BC2154); and the NADPH / NADP ratio was determined by a NADP / NADPH quantitative kit (purchased from Bioss, catalog number: AK303). + Tissue respiration rate was determined using the oxygen electrode method, as described in [Li Hesheng. Principles and Techniques of Plant Physiological and Biochemical Experiments [M]. Higher Education Press, 2000.]. The results are as follows: ​ B~D and ​ As shown.

[0072] The results showed that, under the same treatment, the malondialdehyde (MDA) and hydrogen peroxide (H2O2) content of the transgenic line (Ko) were significantly higher than those of the wild type (WT), while the ATP (adenine triphosphate) content and antioxidant enzyme (superoxide dismutase) activity were significantly lower than those of the wild type, indicating that knockout... ​ Genes can enhance cell membrane lipid peroxidation damage and disrupt membrane structural integrity, thereby effectively reducing seed vigor and stress resistance.

[0073] Example 4: Effect of exogenous citric acid on the recovery of seed vigor in knockout lines Knockout in Example 3 ​ Arabidopsis thaliana seeds were randomly divided into two groups: one denoted as Ko+CS and the other as Ko+CS+A. 300 seeds were prepared for each group, and each group was divided into three replicates for a seed germination experiment. The experimental steps were as follows: After surface sterilization, the seeds were soaked in a 1 mM citric acid (CS) solution for 24 h. The seeds were then subjected to aging treatment according to the method in Example 3, with other steps identical to Example 3. The germination rate results are as follows: ​ As shown in Figure A; the growth status of Arabidopsis thaliana in the Ko+CS group was observed in the same manner as in Example 3, and the results are as follows. ​ As shown; the anti-aging physiological indicators were measured in the same way as in Example 3, and the results are as follows. ​ B~D and ​ As shown.

[0074] Depend on ​ and ​ It is evident that the addition of citric acid significantly improved... ​The germination rate of seeds from knockout lines (Ko and Ko+A) was significantly reduced, and the decline in germination rate after artificial accelerated aging treatment was also significantly decreased. Simultaneously, the growth vigor of the corresponding seedlings was also improved to some extent. ​ This result indicates that exogenous citric acid supplementation can partially compensate for... ​ The physiological defects caused by gene deletion effectively enhance the germination ability and anti-aging ability of knockout line seeds, suggesting... ​ Genes may regulate seed vigor and stress response by influencing citric acid metabolism or related signaling pathways. Further evidence suggests that citric acid can enhance plant resistance to aging.

[0075] Example 5: Verification of Citric Acid's Ability to Enhance Plant Anti-Aging Capacity Wild onion seeds were randomly divided into two groups, designated as the experimental group and the control group, with 300 seeds prepared for each group. The seeds were then divided into three equal portions as three replicates for the seed germination experiment. The specific procedures are as follows: Experimental group: After surface disinfection of sand onion seeds, they were soaked in a 1 mM citric acid (CS) solution for 24 h and then stored. The germination rate of sand onion seeds was measured in the same year, 2 years, 4 years, 6 years and 8 years of storage. The results are shown in Table 10.

[0076] Control group: The procedure was the same as the experimental group, except that citric acid was not used for soaking. The germination rate of sand onion seeds is shown in Table 10.

[0077] Table 10 Germination rate of sand onion seeds

[0078] Table 10 shows that the germination rate of *Allium tuberosum* seeds gradually decreased with prolonged storage time. The germination rate of *Allium tuberosum* seeds treated with citric acid was higher than that of the untreated seeds in the control group. This indicates that the germination rate of *Allium tuberosum* seeds using the method described in this invention... ​ Seed anti-aging agents screened from gene knockout Arabidopsis thaliana seeds can improve the anti-aging ability of plant seeds.

[0079] Example 6: Screening of plant anti-aging regulators Method 1: Using wild-type Arabidopsis thaliana seeds from Example 3, knockout ​ Arabidopsis seeds (denoted as Ko) were used as samples and randomly divided into 3 groups. Each treatment group had 300 seeds, which were then divided into three replicates for seed germination experiments. The specific groupings are as follows: WT group: Germination experiment using wild-type Arabidopsis thaliana seeds.

[0080] Ko group: Utilizing knockout ​ Germination experiments were conducted on Arabidopsis thaliana seeds with genetically modified genes.

[0081] WT+Spd group: Wild-type Arabidopsis seeds were soaked in 0.8 mM spermidine (Spd) for 24 h and then subjected to germination experiments.

[0082] Ko+Spd group: Knockout ​ Arabidopsis thaliana seeds were soaked in 0.8 mM spermidine (Spd) for 24 h before germination experiments were conducted.

[0083] The germination experiment was conducted in the same manner as in Example 3. The germination rate was calculated after 10 days, and the results are shown in Table 11.

[0084] Method 2: Using wild-type Arabidopsis thaliana seeds from Example 3, knockout ​ Arabidopsis seeds (denoted as Ko) were used as samples and randomly divided into 3 groups. Each treatment group had 300 seeds, which were then divided into three replicates for seed germination experiments. The specific groupings are as follows: Group WT+A: Wild-type Arabidopsis seeds were aged and then subjected to germination experiments.

[0085] Group Ko+A: Knockout ​ After aging, Arabidopsis thaliana seeds with genetically modified genes were subjected to germination experiments.

[0086] Ko+Spd+A group: Knockout ​ Arabidopsis thaliana seeds were soaked in 0.8 mM spermidine (Spd) for 24 h, then aged before germination experiments were conducted.

[0087] The aging treatment and germination experiment procedures for each group were the same as in Example 3. The germination rate was calculated after 10 days, and the results are shown in Table 11.

[0088] Table 11 Screening of plant anti-aging agents

[0089] By comparing the germination rates of mutant Arabidopsis thaliana seeds and wild-type Arabidopsis thaliana seeds before and after treatment, potential seed anti-aging agents can be screened. Table 11 shows that spermidine can increase the germination rate of mutant Arabidopsis thaliana seeds, indicating that spermidine can enhance seed anti-aging ability.

[0090] It can be seen that, utilizing the present invention... ​ Using gene knockout seeds as samples, substances that enhance the anti-aging ability of plant seeds can be screened for subsequent development of seed anti-aging agents.

[0091] In summary, this invention successfully constructed Arabidopsis thaliana. ​Gene knockout vectors were developed, and transgenic Arabidopsis lines were obtained using Agrobacterium-mediated inflorescence staining. A series of functional analyses confirmed the knockout effect. ​ The gene can significantly reduce the germination rate and anti-aging ability of Arabidopsis seeds. This invention not only elucidates... ​ The biological functions of genes have provided experimental evidence and also provided important germplasm materials and technical basis for using genetic engineering technology to improve the stress resistance of plant seeds. Meanwhile, with ​ Using gene knockout seeds as targets, plant anti-aging regulators can be screened, providing new solutions for improving seed stress resistance.

[0092] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Citrate synthase gene AtCS Its application in seed anti-aging is characterized by, The citrate synthase gene AtCS The nucleotide sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The applications include: reducing citrate synthase gene levels. AtCS Increased expression levels reduce the plant's resistance to aging.

3. A gene knockout method for citrate synthase AtCS The sgRNA is characterized by, The sgRNA coding sequence targets AtCS The gene target includes the sequence shown in SEQ ID NO.

2.

4. A gene related to citrate synthase AtCS The related biomaterials are characterized by, The biological material includes a recombinant vector or recombinant bacteria containing the sgRNA of claim 3.

5. An Arabidopsis thaliana plant, characterized in that, The citrate synthase gene in the Arabidopsis thaliana plant AtCS The expression level was suppressed.

6. The method for constructing Arabidopsis thaliana plants according to claim 5, characterized in that, The procedure includes the following steps: introducing the sgRNA of claim 3 or the biological material of claim 4 into Arabidopsis thaliana plants.

7. The use of the Arabidopsis thaliana plant according to claim 5 or the Arabidopsis thaliana plant obtained by the construction method according to claim 6 in screening seed anti-aging agents.

8. A method for screening seed anti-aging agents, characterized in that, The process includes the following steps: treating the seeds of the Arabidopsis thaliana plant described in claim 5 and the seeds of wild-type Arabidopsis thaliana with the test compound to obtain two groups of treated seeds; comparing the detection indicators of the two groups of treated seeds; the detection indicators include germination rate; If the test compound can improve the germination rate of Arabidopsis thaliana seeds and has no significant effect on wild-type Arabidopsis thaliana seeds, the test compound is determined to be a potential seed anti-aging agent.

9. The method according to claim 8, characterized in that, After obtaining the two groups of seeds after treatment, the method further includes: artificially aging the two groups of seeds; the detection index also includes: active oxygen scavenging ability.

10. The method according to claim 8 or 9, characterized in that, The potential seed anti-aging agents include citric acid and / or spermidine.

Images