Molecular marker related to physicochemical properties of apples, primer pair and application of molecular marker

By providing DNA methylation molecular markers M1, M2, and M3 of apple fruits and their primer pairs, the problem of regulating fruit acidity and sugar-acid ratio in apple breeding was solved, enabling early and precise screening and improving breeding efficiency, thus cultivating high-quality apple varieties.

CN121780756APending Publication Date: 2026-04-03SICHUAN AAS HORTICULTURE RES INST
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-19
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

The lack of epigenetic molecular markers for apple breeding in existing technologies makes it difficult to effectively regulate the acidity and sugar-acid ratio of the fruit, affecting fruit quality and market demand.

Method used

Three molecular markers, M1, M2, and M3, and their primer pairs related to the physicochemical properties of apples were provided. DNA methylation levels were detected by PCR amplification and sequencing analysis, which can be used to screen and breed apple varieties with high or low acidity and high or low sugar-acid ratio.

Benefits of technology

It enables early identification and precise screening of apple germplasm resources, improves breeding efficiency, assists in the breeding of superior varieties with low acidity and high sugar-acid ratio, and enhances fruit quality and market competitiveness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121780756A_ABST
    Figure CN121780756A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of plant breeding, in particular to a molecular marker related to physicochemical properties of apples, a primer pair and application of the molecular marker and the primer pair. The three epigenetic molecular markers related to the acidity character of the apple are identified by comparing the significant difference of the golden-crown apple in the plateau region of the west Sichuan and the superior line variation of the golden-crown apple in the aspect of the organic acid content of the golden-crown apple and the superior line variation. The markers are respectively positioned on the LOC103433316 gene body of the reference genome of the golden crown apple, and the promoter regions of the LOC103436249 gene and the LOC103448757 gene. According to the invention, a WGBS sequencing technology is adopted to carry out marker identification, and a BSP-PCR technology is adopted to carry out verification. When the molecular markers related to the acidity of the apples are used for breeding, excellent apple varieties with low acidity and high sugar-acid ratio can be effectively bred, and accurate and efficient molecular breeding is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant breeding technology, and in particular to molecular markers, primer pairs and their applications related to the physicochemical properties of apples. Background Technology

[0002] Apples are highly favored for their crisp, juicy flesh, sweet and sour flavor, and rich aroma. The main organic acid in apples is malic acid. Organic acids are crucial factors determining the flavor and quality of fruit, participating in photosynthesis, respiration, and the synthesis of phenols, amino acids, esters, and aromatic substances during the fruit's metabolism. Therefore, studying the accumulation mechanism of organic acids in apples is of great significance for improving fruit quality. Furthermore, fruit quality directly determines its commercial quality and market demand, and the acidity of apples is a significant factor affecting its taste and has a substantial impact on fresh fruit quality, juice processing quality, and market consumption.

[0003] DNA methylation is a conserved epigenetic modification that plays a crucial role in regulating gene expression and silencing transposons. DNA methylation is indispensable in plant growth and development. When plants encounter changes in environmental factors such as light and temperature, the state of DNA methylation alters, thereby affecting the expression of genes involved in organic acid biosynthesis and the accumulation of organic acids, ultimately helping plants cope with environmental changes.

[0004] Currently, there is relatively little research on epigenetics in apples, and the regulatory mechanism of DNA methylation on organic acid biosynthesis in apples remains unclear. Furthermore, there are no epigenetic molecular markers in apples that can be used for selecting superior traits. This invention aims to propose a DNA methylation molecular marker related to the acidity of high-altitude apples and its application. Summary of the Invention

[0005] The purpose of this invention is to provide molecular markers, primer pairs, and their applications related to the physicochemical properties of apples, in order to solve the problems existing in the prior art.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a molecular marker related to the physicochemical properties of apples, wherein the molecular marker includes one or more of M1, M2 and M3;

[0008] The nucleotide sequence of M1 is shown in SEQ ID NO.1; the nucleotide sequence of M2 is shown in SEQ ID NO.2; and the primer pair of M3 is shown in SEQ ID NO.3.

[0009] The physicochemical properties include acidity and sugar-acid ratio.

[0010] The present invention provides primer pairs for amplifying the above-mentioned molecular markers, wherein the primer pairs include primer pairs for amplifying M1, primer pairs for amplifying M2, and primer pairs for amplifying M3;

[0011] The primer pair for amplifying M1 includes NF1 with the nucleotide sequence shown in SEQ ID NO.4, NR1 with the nucleotide sequence shown in SEQ ID NO.5, WF1 with the nucleotide sequence shown in SEQ ID NO.6, and WR1 with the nucleotide sequence shown in SEQ ID NO.7;

[0012] The primer pair for amplifying M2 includes NF2 with the nucleotide sequence shown in SEQ ID NO.8, NR2 with the nucleotide sequence shown in SEQ ID NO.9, WF2 with the nucleotide sequence shown in SEQ ID NO.10, and WR2 with the nucleotide sequence shown in SEQ ID NO.11;

[0013] The primer pairs for amplifying M3 include NF3 (nucleotide sequence as shown in SEQ ID NO.12), NR3 (nucleotide sequence as shown in SEQ ID NO.13), WF3 (nucleotide sequence as shown in SEQ ID NO.14), and WR3 (nucleotide sequence as shown in SEQ ID NO.15).

[0014] This invention provides the application of the above-mentioned primer pairs in the preparation of products for identifying the physicochemical properties of apples, including acidity and sugar-acid ratio.

[0015] Optionally, the product includes reagents, reagent kits, and chips.

[0016] This invention provides a product for identifying the physicochemical properties of apples, the product comprising the primer pair described above; the physicochemical properties include acidity and sugar-acid ratio.

[0017] Optionally, the product includes reagents, reagent kits, and chips.

[0018] This invention provides the application of the above-mentioned primer pairs or products in identifying the physicochemical properties of apples, including acidity and sugar-acid ratio.

[0019] This invention provides a method for identifying the physicochemical properties of apples, the method comprising the following steps:

[0020] Genomic DNA of the apple to be tested was extracted and converted to sulfite to obtain the apple DNA to be tested;

[0021] Genomic DNA was extracted from Golden Delicious apples and converted to standard DNA via sulfite conversion.

[0022] Using the apple DNA to be tested and standard DNA as template DNA, PCR amplification was performed using the primers described above;

[0023] The amplified products were sequenced and the data were analyzed to obtain the methylation levels of the aforementioned molecular markers;

[0024] Determine the physicochemical properties of apples based on the obtained methylation levels;

[0025] The physicochemical properties include acidity and sugar-acid ratio.

[0026] Optionally, compared to Golden Delicious apples, if the methylation levels of M1, M2, and M3 are increased, the apple to be tested is an apple with low acidity and a high sugar-acid ratio; if the methylation levels of M1, M2, and M3 are decreased, the apple to be tested is an apple with high acidity and a low sugar-acid ratio.

[0027] This invention provides the use of the above-described molecular markers, primer pairs, or products in any of the following:

[0028] (1) Screen apple varieties with high acidity;

[0029] (2) Screen apple varieties with low acidity;

[0030] (3) Screen apple varieties with high sugar-acid ratio;

[0031] (4) Screen apple varieties with low sugar-acid ratio;

[0032] (5) Cultivate apple varieties with high acidity;

[0033] (6) Cultivate apple varieties with low acidity;

[0034] (7) Cultivate apple varieties with a high sugar-acid ratio;

[0035] (8) Cultivate apple varieties with low sugar-acid ratio.

[0036] The present invention discloses the following technical effects:

[0037] This invention uses Golden Delicious apples and their superior variants from the Sichuan-Western Plateau region as materials. By comparing the significant differences in organic acid content between the two, three epigenetic molecular markers related to apple acidity were identified. These markers are located on the LOC103433316 gene body of the Golden Delicious apple reference genome, and in the promoter regions of the LOC103436249 and LOC103448757 genes. This invention uses WGBS sequencing technology for marker identification and verifies them using BSP-PCR technology. The following objectives can be achieved by detecting the methylation status of these markers:

[0038] (1) Early identification and screening of acidity traits in apple germplasm resources: By detecting the methylation pattern of three molecular markers in the apple germplasm resources to be tested, the acidity performance of the fruit at the ripening period can be predicted, which can realize early, accurate and non-destructive screening of apple acidity traits, thereby assisting in the breeding of excellent apple varieties with low acidity and high sugar-acid ratio, and improving breeding efficiency and target.

[0039] (2) Assist in the selection of low-acid and high sugar-acid ratio apple varieties: In the process of hybridization breeding, bud mutation or seedling selection, the methylation pattern associated with low acidity in the above molecular markers is used as a positive selection indicator to screen hybrid offspring or superior single plants with low acidity, thereby accelerating the breeding process of new apple varieties with low acidity and high flavor quality.

[0040] (3) Targets for gene function research and epigenetic regulatory mechanism research: The genes containing the markers (LOC103433316, LOC103436249, LOC103448757) and their methylation status provide direct targets for studying the epigenetic regulatory network of malic acid metabolism.

[0041] In summary, the core of this invention lies in the first discovery and verification of a stable association between the DNA methylation status of the three specific gene regions and the acidity trait of highland apples, and the transformation of this discovery into specific markers and detection tools that can be used in molecular breeding practices. Attached Figure Description

[0042] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0043] Figure 1 The whole-genome DNA methylation pattern of golden crown and superior mutant materials;

[0044] Figure 2 Organic acid content in mature fruits of Golden Delicious and superior mutant materials;

[0045] Figure 3 The sugar-acid ratio of mature fruits of Golden Delicious and superior mutant materials;

[0046] Figure 4 A gel image for identifying PCR amplification products;

[0047] Figure 5 The methylation levels (WGBS and BSP-PCR, A) and gene expression levels (B) of the three epigenetic markers are shown. Detailed Implementation

[0048] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0049] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0050] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0051] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0052] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0053] Example 1

[0054] 1. Experimental Materials

[0055] Mature fruits of Golden Delicious apples (GD) and its low-acid variant (GDM) from the western Sichuan plateau region, collected and preserved by the apple team of the Institute of Horticulture, Sichuan Academy of Agricultural Sciences, were selected as the research subjects. Significant differences in organic acid content were observed between the two materials, providing an ideal control for identifying acidity-related epigenetic molecular markers. The Golden Delicious apple (GD) and variant (GDM) data are published in the literature "Multidimensional Transcriptomics Reveals the Key Genes and Pathways Regulating the Acidity of Apples," and the applicant has committed to distributing the data for 20 years from the date of application.

[0056] 2. Construction and differential analysis of whole-genome DNA methylation profiles

[0057] (1) High-quality genomic DNA was extracted from the fruit tissues of GD and GDM fruits, respectively;

[0058] (2) Use the EZ DNA Methylation-Gold™ Kit (or similar products) to perform sulfite conversion on DNA, so that unmethylated cytosine (C) is converted to uracil (U), while methylated C remains unchanged;

[0059] (3) Construct whole-genome sulfite sequencing libraries and perform paired-end sequencing on the Illumina NovaSeq 6000 platform, with a sequencing depth of no less than 30× genome coverage for each sample;

[0060] (4) Perform quality control and filtering on the raw sequencing data, and use software (Fastp) to remove low-quality reads and adapter sequences;

[0061] (5) The Cleandata was aligned to the Golden Delicious apple reference genome (GDDH13 v1.1), and the methylation levels of all cytosine sites in the whole genome at the CG, CHG, and CHH sequences were calculated using the methylation analysis software (BSMAP) to obtain WGBS data ( Figure 5 ), and then constructed whole-genome single-base resolution methyl groups for the two materials ( Figure 1 );

[0062] (6) Using bioinformatics methods (based on the MethylKit package in R language), with a 100bp sliding window as the basis, Fisher's exact test was used to identify methylation regions that are significantly different between GD and GDM.

[0063] 3. Identification of acidity-related epigenetic molecular markers

[0064] (1) The results of the differential methylation analysis above were integrated with the fruit transcriptome sequencing data performed at the same time. The accession number of the reference genome is GCF_002114115.1 (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_002114115.1 / ).

[0065] (2) Screen genes in or adjacent to differentially methylated regions, and perform hypergeometric distribution test in combination with differentially expressed genes across the whole genome to determine the significance of differential methylation regions in the differential regulation of gene expression.

[0066] (3) By enrichment analysis of differentially expressed genes regulated by differential methylation, candidate genes directly related to malic acid metabolism pathways such as the tricarboxylic acid cycle can be identified. This invention ultimately identified three key regions ( Figure 1 ):

[0067] The differentially methylated region (Chr04:8780291-18780691) is located in the gene LOC103433316 (NADP-malic acid enzyme).

[0068] The differentially methylated region (Chr05:23215814-23216214) is located in the promoter region of gene LOC103436249 (malate dehydrogenase) (approximately 2 kb upstream of the transcription start site).

[0069] The differentially methylated region (Chr11:37609900-37610300) is located in the promoter region of gene LOC103448757 (phosphoenolpyruvate carboxylase).

[0070] The three key regions above are designated M1-M3, and their nucleotide sequences are shown in SEQ ID NO.1-3, as follows:

[0071] M1 (LOC103433316):

[0072] TCCGCGCATGCCGTGAGTTGACCGATGCTGGGATGACGTCGCTCGCCAAACTGCAAAAGGTTGAAAGTCCCAAGCAGAACTATGGTGAAAAAGTTATTGTACAGTTCGAAGATTTTGCAAACCAATGCTTTCGAGCTGCTGGCCAAATAGAGCATCTCATCTCGTCGAGCTGCTGGGGATGGATGCAGAAGATT CTGTAGTTCTTGCAGGAGTTGTGGCAGCACTGAAGTTAATCGGTGGTTCCCTGTCTGAACATAGGTTTTTGTTCCTTGGCGCTGGAGAAGCTGGTACCGGTATAGCAGAACTAATAGCTCTTGAGATCTCGAAAAGGACAAAGTCCTGTGGAAGAAACCCGTAAGAAGATCTGCAGCAGGATTGATTGATTGATT ID NO.1)。

[0073] M2(LOC103436249):

[0074] ATAATTAAAATAAACAAATAAAACAAGGAGGACGAATGTTGTCCAATGTACTTATTTTCTAGAGTATAATGATAGCTTACATATTTTGACCATATGATCAGTAGTTGATATAATTAGTCCAGCTGCAAAGGAACCCAATTTAACGCTTAACCTTAGCTTATCACTGCAAAATGAACGAATGAATGATA CATATATCCATCCTTTCAGTCATTCATTAGATGATGTGTTTGAATGCCACTGGTACCAATGATAATTTTCATTACTCTGCACATAAATTGTTCTGCCAAAACAATTGTTCATAAAATTAAAGCATCCAAGTGCATTAATGAAAATATATTTATCTAAAGGAAGGCTTATCATAGCTTATCTATCTAAAGGAAGGCTTATCATAGGCTCATTTACCATTCQ ID NO.2)。

[0075] M3(LOC103436249):

[0076] TCCCATATAAAGAAGATTTCTATCGAAAACCAAGATTTGTACGTTCCTTAAGGGTGCGTTTGGTACGTGGGACGGGACGGGACGGAACGGGACGAGGCGTTCCGTTCCGCGTTTGGTGCGCCAAAAATGGGTGGAACGGGGCTGTTCCACGGAACAGATTTTGAGTGTTTTTGCGTTCCACCTCCCCCTGGAACGGGTTTGTT CCACGTTTGTGGAACGCAATGTTTTACCATTTTAAGACAAATATACCCCATGTCTTTTTCAAAAATTACACCTTCGTTCCGTCCCGTCCCGTCCGTCCCGTTCCGTCCATCTGCGTACCAAACGCACCCTAAAGGATTCATAAATCCACTAAAATCAAAGGGTTCATACAAATTCGAAATGGGTTTTCAAATTCAC (SEQ ID NO.3).

[0077] The regions described above were visualized using a genome browser (IGV) to confirm significant differences in the methylation patterns of the three molecular markers in step (3) between GD and GDM, and differences in the expression levels of related genes. Specifically, in GDM, the relative expression level of M1 was significantly higher than that in GD, and the methylation level of M1 (1) was significantly higher than that in GD (0.9); the relative expression level of M2 was significantly lower than that in GD, and the methylation level of M2 (0.69) was significantly higher than that in GD (0.37); the relative expression level of M3 was significantly lower than that in GD, and the methylation level of M3 (0.5) was significantly higher than that in GD (0.3). Statistical analysis showed that the acidity of GD (acidity of 1.04 mg·g-1FW) was significantly higher than that of GDM (acidity of 0.35 mg·g-1FW), and the sugar-acid ratio of GD (sugar-acid ratio of 0.83) was significantly lower than that of GDM (sugar-acid ratio of 1.54). The formula for calculating the methylation level is as follows:

[0078] ;

[0079] In this context, #C represents sequencing reads that support methylated cytosine, and #T represents sequencing reads that support unmethylated cytosine.

[0080] Therefore, the aforementioned three molecular markers were used as epigenetic molecular markers related to apple acidity. Compared with GD, if the methylation levels of M1, M2, and M3 in the tested apple were increased, the apple was low in acidity and high in sugar-acid ratio; if the methylation levels of M1, M2, and M3 in the tested apple were decreased, the apple was high in acidity and low in sugar-acid ratio. The correlation between the methylation levels of the three molecules and apple acidity and sugar-acid ratio is shown in Table 1.

[0081] Table 1. Correlation between methylation levels of three molecules and malic acidity and sugar-acid ratio.

[0082]

[0083] Example 2 Development of BSP-PCR Specific Primers

[0084] For the three molecular markers provided in Example 1, BSP-PCR specific primers were designed, as shown in Table 2.

[0085] Table 2 BSP-PCR Specific Primers

[0086]

[0087] Note: Y represents C or T, R represents A or G, N in the primer name represents inner primer, and W represents outer primer.

[0088] Example 3: Validation of the molecular markers obtained in Example 1 and the BSP-PCR specific primers obtained in Example 2.

[0089] (1) GD (n=12) and GDM (n=12) fruits collected from the orchard were used as verification materials. The organic acid content of the two materials was determined by high performance liquid chromatography. It was found that malic acid was the main organic acid in the mature GD and GDM fruits, and the organic acid content in the variant materials was only 30% of that in Golden Delicious. Figure 2 The sugar-acid ratio is nearly twice that of Kingcrown (a brand of fruit juice). Figure 3 ).

[0090] (2) Subsequently, DNA was extracted from GD and GDM fruits using a plant genomic DNA extraction kit, and the extracted DNA was transformed using Novizan's EpiArt Ultrafast DNA Methylation Bisulfite Kit (EM112).

[0091] (3) Using the treated DNA as a template, nested amplification was performed using TSINGKE Master Mix (blue) from TSINGKE Biotechnology. BSP-PCR specific primers are shown in Table 2. The nested amplification system is shown in Table 3, and the procedure is shown in Table 4.

[0092] Table 3 Nested amplification system

[0093]

[0094] Table 4 Nested Amplification Program

[0095]

[0096] (4) Perform agarose gel electrophoresis on the amplified PCR products (2 μL sample + 6 μL bromophenol blue) at 300V for 12 minutes to obtain the identification gel image and determine whether the target band of the expected fragment size has been amplified. Figure 4 );

[0097] (5) After the PCR amplification products are recovered by gel cutting, they are ligated into the T vector using the TA cloning kit. The ligation products are transformed and plated. Long single-clone plaques are sent to the sequencing department for sequencing. Ten single clones are selected from each plate for sequencing.

[0098] (6) The TA cloning sequencing results were analyzed using BiQAnalyzer software to statistically determine methylation and detect expression levels. By analyzing the retention ratio of cytosine in the sequencing results, the methylation degree and expression level of the three molecular markers in each sample, as well as the acidity and sugar-acid ratio of the fruit, were calculated. The results are shown in Table 3 and... Figure 5 As shown.

[0099] Table 5. Correlation between methylation levels of three molecules and malic acidity and sugar-acid ratio (mean).

[0100]

[0101] The results showed that the trend of methylation level changes measured by BSP-PCR specific primers was consistent with the previous WGBS data ( Figure 5 The results showed a high degree of consistency, and the changes in methylation levels measured by BSP-PCR specific primers were consistent with the trends in malic acidity and sugar-acid ratio, thus experimentally verifying the authenticity and reliability of these three epigenetic molecular markers.

[0102] Example 4: Application of Molecular Markers in Breeding Screening

[0103] The molecular markers provided by this invention can be used for early screening of apple hybrid offspring. The specific steps are as follows:

[0104] (1) Collect fruit tissue from hybrid seedling offspring;

[0105] (2) Extract DNA from the fruit and perform the above-mentioned BSP-PCR detection and sequencing analysis on M1-M3;

[0106] (3) Based on the sequencing results, calculate the methylation rate of the key sites of the marker. Select individual plants exhibiting a high methylation pattern similar to the low-acid parent (GDM) as potential superior plants with the low-acid trait;

[0107] (4) These pre-selected superior plants were then cultured and their fruit traits were measured to verify the effectiveness of marker selection. This method can rapidly narrow down the selection range from a large number of hybrid offspring, eliminate high-acid plants in advance, and significantly improve the selection efficiency and accuracy of low-acid and high-sugar-acid ratio target traits.

[0108] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker related to the physicochemical properties of apples, characterized in that, The molecular markers include one or more of M1, M2, and M3; The nucleotide sequence of M1 is shown in SEQ ID NO.1; the nucleotide sequence of M2 is shown in SEQ ID NO.2; and the primer pair of M3 is shown in SEQ ID NO.

3. The physicochemical properties include acidity and sugar-acid ratio.

2. A primer pair for amplifying the molecular marker of claim 1, characterized in that, The primer pairs include primer pairs for amplifying M1, primer pairs for amplifying M2, and primer pairs for amplifying M3; The primer pair for amplifying M1 includes NF1 with the nucleotide sequence shown in SEQ ID NO.4, NR1 with the nucleotide sequence shown in SEQ ID NO.5, WF1 with the nucleotide sequence shown in SEQ ID NO.6, and WR1 with the nucleotide sequence shown in SEQ ID NO.7; The primer pair for amplifying M2 includes NF2 with the nucleotide sequence shown in SEQ ID NO.8, NR2 with the nucleotide sequence shown in SEQ ID NO.9, WF2 with the nucleotide sequence shown in SEQ ID NO.10, and WR2 with the nucleotide sequence shown in SEQ ID NO.11; The primer pairs for amplifying M3 include NF3 (nucleotide sequence as shown in SEQ ID NO.12), NR3 (nucleotide sequence as shown in SEQ ID NO.13), WF3 (nucleotide sequence as shown in SEQ ID NO.14), and WR3 (nucleotide sequence as shown in SEQ ID NO.15).

3. The application of the primer pair according to claim 2 in the preparation of products for identifying the physicochemical properties of apples, characterized in that, The physicochemical properties include acidity and sugar-acid ratio.

4. The application according to claim 3, characterized in that, The products include reagents, reagent kits, and chips.

5. A product for identifying the physicochemical properties of apples, characterized in that, The product includes the primer pair as described in claim 2; the physicochemical properties include acidity and sugar-acid ratio.

6. The product according to claim 5, characterized in that, The products include reagents, reagent kits, and chips.

7. The application of the primer pair of claim 2 or the product of claim 5 or 6 in the identification of the physicochemical properties of apples, characterized in that, The physicochemical properties include acidity and sugar-acid ratio.

8. A method for identifying the physicochemical properties of apples, characterized in that, The method includes the following steps: Genomic DNA of the apple to be tested was extracted and converted to sulfite to obtain the apple DNA to be tested; Genomic DNA was extracted from Golden Delicious apples and converted to standard DNA via sulfite conversion. Using the apple DNA to be tested and standard DNA as template DNA, PCR amplification was performed using the primers described in claim 2; The amplified products were sequenced and the data were analyzed to obtain the methylation level of the molecular marker described in claim 1; Determine the physicochemical properties of apples based on the obtained methylation levels; The physicochemical properties include acidity and sugar-acid ratio.

9. The method according to claim 8, characterized in that, Compared to Golden Delicious apples, if the methylation levels of M1, M2, and M3 are increased, the apple being tested is an apple with low acidity and a high sugar-acid ratio; if the methylation levels of M1, M2, and M3 are decreased, the apple being tested is an apple with high acidity and a low sugar-acid ratio.

10. The use of the molecular marker of claim 1, the primer pair of claim 2, or the product of claim 5 or 6 in any of the following: (1) Screen apple varieties with high acidity; (2) Select apple varieties with low acidity; (3) Screen apple varieties with high sugar-acid ratio; (4) Screen apple varieties with low sugar-acid ratio; (5) Cultivate apple varieties with high acidity; (6) Cultivate apple varieties with low acidity; (7) Cultivate apple varieties with high sugar-acid ratio; (8) Cultivate apple varieties with low sugar-acid ratio.

Citation Information

Patent Citations

  • Method for continuously improving red characters of apples by combining continuous multi-generation bud mutation selection and cross breeding

    CN106613921A

  • Novel phytopharmaceutical compounds and compositions, preparation and uses thereof

    WO2019110538A1