Morchella strain ZY-1 and artificial cultivation method and identification thereof

Abstract

The invention relates to a morchella strain ZY-1 as well as an artificial cultivation method and identification thereof, and belongs to the technical field of biology. The morchella strain ZY-1 is preserved in the Guangdong Microbiological Culture Collection Center in China on April 11, 2023, and the preservation number is GDMCC No: 63340. The morchella strain is strong in hypha growth vigor, thick and strong, fast in spawn running, less in pollution and strong in impurity resistance, hyphae can normally grow at the temperature of 5-35 DEG C, sporocarp can be generated at the temperature of 10-26 DEG C, and the temperature application range is wide; fruiting is early and neat, and the yield is high and stable; sporocarp is pagoda-shaped, fungus caps are large, brown, commodity is good, fungus fragrance is strong, the content of amino acid, protein, fat, calcium, iron, zinc and the like is rich, the product is superior to that of a control group, and high application value and good market prospects are achieved.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a Morchella strain ZY-1 and an artificial cultivation method and identification thereof. BACKGROUND

[0002] Morchella is Fungi, Ascomycota, Pezizomycetes, Pezizales, Morchellaceae and Morchella. Morchella is a fungus for food and medicine. It has a unique flavor and is rich in nutrients, containing various amino acids and organic germanium needed by the human body. It has been used as a high-grade nutritional supplement for the human body in countries such as Europe and the United States. The domestication and cultivation technology of Morchella in China can be traced back to 1983, and has a history of more than 30 years. The domestication and cultivation process of Morchella in China can be divided into "pure bionic cultivation", "under-forest bionic cultivation", "indoor bionic cultivation", "mycorrhizal cultivation technology", "bionic cultivation using fungus material" and today's "artificial cultivation technology of Morchella" according to the degree of human intervention, strain technology and environmental control.

[0003] Morchella mainly grows in humus layer of broad-leaved forest or mixed forest of coniferous and broad-leaved trees. It mainly grows in sandy soil rich in humus or brown soil, brown soil, etc. Although Yunnan has rich wild germplasm resources, there is no report on accurate evaluation and systematic research.

[0004] There are many technical bottlenecks and industry pain points in the current cultivation of Morchella. High-quality strains are scarce and have poor stability, most of which are wild isolates or simple domesticated varieties. The strains are mixed and seriously degenerated, and there are great differences in different regions and crops. Farmers use their own strains or unapproved strains, which further exacerbates the confusion and makes it difficult to produce on a large scale. The standardization degree of cultivation technology is very low, the formula of culture medium and cultivation mode are chaotic, and the key indicators are based on experience. Production management is not refined enough, and temperature and humidity, light are all subjective, which affects yield and quality. The ability to resist extreme climate is weak, the facility is simple, the damage rate of greenhouse is more than 60% in the snow disaster in southern China in 2018, and there is a lack of emergency plan, resulting in large disaster losses. The means of disease and pest control is single, relying on chemical agents, which has safety hazards and no early warning. Post-production processing and industry chain support are insufficient, post-harvest loss rate is high, technical popularization is weak, and advanced technology is difficult to popularize. These shortcomings are superimposed, which restricts the yield and quality improvement, makes it lack of resilience when responding to natural risks and market competition, and seriously hinders the high-quality development of the industry.

[0005] Therefore, how to overcome the deficiencies of the prior art is a problem to be solved in the current biotechnology field. SUMMARY

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a morel strain ZY-1 and its artificial cultivation method and identification.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of this invention provides a morel strain ZY-1, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection, China on April 11, 2023, with accession number GDMCC No: 63340.

[0008] A second aspect of the present invention provides a method for the artificial cultivation of the above-mentioned morel strain ZY-1, comprising the following steps: Step (1), strain preparation: The mother strain obtained from the morel tissue isolation is revitalized with the mother strain culture medium and then inoculated into the original strain culture bottle for expansion culture. After the mycelium has filled the culture bottle, the original strain is transferred to the cultivation container for culture. After the mycelium has filled the cultivation container, the cultivation is finally transferred into the cultivation bag and cultured until the mycelium has filled the bag. Step (2), cultivation management: transport the cultivation bags obtained in step (1) to the cultivation site and carry out ridge planting; Step (3), harvesting fruiting bodies: harvest when the fruiting bodies have grown to maturity and the cap ridge and pit are clearly defined; at this time, the weight is the heaviest stage in the entire production process, the flesh is thick and elastic, and has a rich morel aroma. The mother culture medium comprises the following raw materials by weight: 199-201 parts potato, 19-21 parts glucose, 17-19 parts agar, 1.9-2.1 parts yeast powder, 0.19-0.21 parts magnesium sulfate, 990-1010 parts distilled water, and a pH of 6.5-7.5. The original culture medium in the original culture bottle includes the following raw materials by weight: 74-76 parts wheat, 9.8-10.2 parts humus, 7.8-8.2 parts wheat bran, 4.9-5.1 parts biomass raw material, 0.9-1.1 parts lime, and 0.9-1.1 parts gypsum; the biomass raw material is sawdust or rice husk. The culture medium in the cultivation bag includes the following raw materials by weight: 64-66 parts wheat, 14-16 parts biomass raw material, 7.7-8.3 parts wheat bran, 9.5-10.5 parts humus, 0.9-1.1 parts lime, and 0.9-1.1 parts gypsum; the biomass raw material is cottonseed hulls, sawdust, rice hulls, or corn cobs.

[0009] Furthermore, the mother culture medium comprises the following raw materials by weight: 200 parts potato, 20 parts glucose, 18 parts agar, 2 parts yeast powder, 0.2 parts magnesium sulfate, and 1000 parts distilled water; The original culture medium in the original culture bottle includes the following raw materials by weight: 75 parts wheat, 10 parts humus, 8 parts wheat bran, 5 parts biomass raw material, 1 part lime, and 1 part gypsum; the biomass raw material is sawdust or rice husk. The culture medium in the cultivation bag includes the following raw materials by weight: 65 parts wheat, 15 parts biomass raw material, 8 parts wheat bran, 10 parts humus, 1 part lime, and 1 part gypsum; the biomass raw material is cottonseed hulls, sawdust, rice hulls, or corn cobs.

[0010] Furthermore, when the mother culture is rejuvenated using the mother culture medium, the culture temperature is 24℃; The culture temperature for scaling up the original culture in the culture flask was 21℃; When the original seed is transferred to the cultivar container for further cultivation, and when the cultivar is transferred to the cultivation bag for cultivation, the cultivation temperature is 21℃.

[0011] Furthermore, in step (2), cultivation is selected from March to May or September to November, and the cultivation site is selected from low-altitude plains to 3500 meters above sea level with sandy loam soil rich in humus; a shade shed is built using 4-6 needle shade nets with a shade rate of 85%-95%; before sowing, the soil moisture is adjusted to 22-25% and the temperature is 15-16℃.

[0012] Furthermore, temperature and humidity are controlled in stages during the fruiting period: During the primordia formation period, the greenhouse temperature should be controlled at 15-20℃ and the soil temperature at 7-12℃. During the primordium differentiation period, the controlled temperature is 10-22℃ and the humidity is 90-95%. During the young mushroom stage, the temperature should be controlled at 10-22℃ and the humidity at 85-90%. During the mushroom maturation stage, the temperature should be controlled at 8-24℃ and the humidity at 80-85%. During the fruiting period, the mushrooms need 500-1000 lux of diffused light and 2-3 hours of ventilation per day.

[0013] Furthermore, harvest the fruiting bodies promptly when they are mature, and then clean up any remaining mushrooms and replenish water to promote the next flush of fruiting.

[0014] A third aspect of the present invention provides a primer set for identifying morel strain ZY-1, said primer set comprising SSR-01 primer pair, SSR-02 primer pair, SSR-03 primer pair and SSR-04 primer pair; The sequences of the SSR-01 primer pair are as follows: SSR-01-F:ggactgtgcagtggttggta; SSR-01-R:cttgactccacacttctccca; The sequences of the SSR-02 primer pair are as follows: SSR-02-F:gagtacacgggcctctcaag; SSR-02-R: acatacatacaggcaggcgg; The sequences of the SSR-03 primer pair are as follows: SSR-03-F:tgccgggtggaggagataat; SSR-03-R:gatggagctgcgagaggatg; The sequences of the SSR-04 primer pair are as follows: SSR-04-F:tcctccaagaaccgcttacg; SSR-04-R: gcgaggagatggagaggac.

[0015] A fourth aspect of the present invention provides a kit containing the primer set described above for identifying morel strain ZY-1.

[0016] The fifth aspect of the present invention provides the application of the primer set or the kit described above for identifying morel strain ZY-1 in the identification of morel strain ZY-1.

[0017] In this invention, the fruiting bodies are harvested in a timely manner when they are mature. Mature fruiting bodies are defined as those that no longer increase in size and have distinct cap ridges.

[0018] This invention developed four pairs of SSR-specific primers for morel strain ZY-1: SSR-01 primer pair, SSR-02 primer pair, SSR-03 primer pair, and SSR-04 primer pair, which can distinguish morel strain ZY-1 from similar varieties.

[0019] Compared with the prior art, the beneficial effects of this invention are as follows: (1) This invention conducted a complete set of morphological and molecular biological identifications and molecular marker development on wild-collected morel mushroom resources with large fruiting bodies and excellent appearance. Pure strains were produced, and the optimal three-level spawn culture medium formula and the most suitable planting and fruiting conditions were optimized. After demonstration planting and five years of experimental research, the excellent morel mushroom cultivation variety ZY-1 was finally obtained and named "Zhongyuan No. 1". Starting from an excellent wild morel mushroom resource, this invention selected and bred an excellent morel mushroom variety for cultivation and promotion. It also developed a set of three-level spawn (mother spawn, original spawn, and cultivation spawn) spawn production technology and efficient planting technology for morel mushroom strain ZY-1. This is a systematic invention and research on good varieties, good techniques and good methods in the morel mushroom industry.

[0020] (2) Compared with the control group Qimei K, morel strain ZY-1 has a brown to dark brown cap that is not easily broken; while the control group Qimei K has a grayish-brown cap that is more easily broken. Most morel fruiting bodies are sold as fresh mushrooms. After being transported long distances in packaging boxes, the fragile fruiting bodies are scattered everywhere, which makes the product look less appealing. Therefore, morel strain ZY-1 has better marketability.

[0021] (3) Morel mushroom ZY-1 has a unique pagoda shape, with a large and uniform cap, averaging 7.48cm in length and 4.02cm in width at its widest point, far exceeding the cone-shaped mushroom of control group Seven Sister K (6.56cm in length and 3.28cm in width at its widest point). Morel mushroom ZY-1 has thick flesh, with obvious and deep pits in the brownish cap, thin and forked longitudinal ridges, and sloping and intersecting transverse ridges, paired with a short and stout cylindrical stem (slightly larger at the base). The overall shape meets the market's requirements for high-quality morel mushrooms with large caps and short stems, and has an excellent appearance and high market recognition.

[0022] (4) Under the same production conditions, the morel strain ZY-1 showed particularly outstanding yield, with an average fresh weight of 29.95g and a dry weight of 3.33g per mushroom, and a dry yield of 11.12%. In demonstration cultivation in multiple locations, the average yield of fresh mushrooms per mu reached 315.21kg, with the highest yield of 324.18kg per mu, which is 21.7% higher than the control strain Qimei K. Moreover, the mushrooms are uniform and consistent, with strong stability, which can provide a reliable yield guarantee for large-scale production.

[0023] (5) Morel strain ZY-1 exhibits excellent mycelial growth performance, with an optimal culture temperature of 24℃ and an average daily growth rate of approximately 1.34 cm. Although initially appearing white and slightly sparse, its density increases significantly with prolonged culture time, demonstrating strong vitality. Sclerotia form early and are distributed reasonably, beginning to form when the bag is nearly full, and are mostly concentrated in the upper part of the bag. If plastic or glass seed bottles are used, the number of sclerotia will be even greater, providing sufficient nutrients for fruiting body development. (6) Morel strain ZY-1 has good adaptability to cultivation. The optimal sowing period is when the soil temperature is below 15℃. Mycelia germinate rapidly 24-48 hours after sowing, with an average growth cycle of 110 days. The short production cycle makes it suitable for large-scale planting in fields and under forests, effectively improving planting efficiency and yield. Attached Figure Description

[0024] Figure 1 Photographs of pure mycelial cultures; Figure 2 Phylogenetic tree of morel strain ZY-1; wherein, Morchella septimelata CK is the control “Qimei K”; Morchella septimelata ZY01 is the morel strain ZY-1 of this invention; Figure 3 Gel image of SSR molecular marker for Morel strain ZY-1; Figure 4 Images of the antagonism test; (a) is a front view of the plate, (b) is a back view of the plate; Note: In the plate, the left side is morel strain ZY-1, and the right side is Seven Sisters K; Figure 5 Figures showing mycelial growth rates under different carbon source conditions; Figure 6 Graphs showing mycelial growth rates under different nitrogen source conditions; Figure 7 Figures showing mycelial growth rates under different inorganic salt conditions; Figure 8 Graphs showing mycelial growth rates under different temperature conditions; Figure 9 Figures showing mycelial growth rates under different pH conditions; Figure 10 The images show the fruiting status and ascocarps of the morel strain ZY-1 in a small-scale preliminary screening test; (a) shows the fruiting status; (b) shows the ascocarps. Figure 11 The images show the fruiting status and ascocarps of the morel strain ZY-1 in a small-scale secondary screening test; (a) shows the fruiting status; (b) shows the ascocarps. Figure 12 The images show the fruiting status and ascocarps of the morel strain ZY-1 in an intermediate test; (a) shows the fruiting status; and (b) shows the ascocarps. Figure 13 The demonstration cultivation effect of morel strain ZY-1 is shown; among them, A is Fengming Village, Yongbei Town, Yongsheng County, Lijiang City; B is Shuhe Village, Shitou Township, Yulong County, Lijiang City; C is Haba Village, Sanba Township, Shangri-La City; and D is the mature fruiting body of morel strain ZY-1. Figure 14 To compare the demonstration cultivation effect of strain "Qimei K"; A is Fengming Village, Yongbei Town, Yongsheng County, Lijiang City; B is Shuhe Village, Shitou Township, Yulong County, Lijiang City; C is Haba Village, Sanba Township, Shangri-La City; D is the mature fruiting body of control strain "Qimei K". Figure 15 Morel morphology diagram; where A: morel fruiting body; BD: asci; E: ascospores; scale bar: 1cm (A); 5 µm (B); 10 µm (C); 50 µm (D); 2µm (E).

[0025] The morel strain ZY-1 (Morchella sp.) of this invention was deposited on April 11, 2023, at the Guangdong Provincial Center for Microbial Culture Collection, China, accession number GDMCC No: 63340, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, Institute of Microbiology. Detailed Implementation

[0026] The present invention will now be described in further detail with reference to the embodiments.

[0027] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.

[0028] Example 1 A morel strain ZY-1 was deposited at the Guangdong Provincial Center for Microbial Culture Collection, China on April 11, 2023, with accession number GDMCC No: 63340.

[0029] The artificial cultivation method for the morel strain ZY-1 includes the following steps: Step (1), strain preparation: The mother strain obtained from the morel tissue isolation is revitalized with the mother strain culture medium and then inoculated into the original strain culture bottle for expansion culture. After the mycelium has filled the culture bottle, the original strain is transferred to the cultivation container for culture. After the mycelium has filled the cultivation container, the cultivation is finally transferred into the cultivation bag and cultured until the mycelium has filled the bag. Step (2), cultivation management: transport the cultivation bags obtained in step (1) to the cultivation site and carry out ridge planting; Step (3), harvesting fruiting bodies: harvest when the fruiting bodies have grown to maturity and the cap ridge and pit are clearly defined; at this time, the weight is the heaviest stage in the entire production process, the flesh is thick and elastic, and has a rich morel aroma. The mother culture medium comprises the following raw materials by weight: 199 parts potato, 19 parts glucose, 17 parts agar, 1.9 parts yeast powder, 0.19 parts magnesium sulfate, 990 parts distilled water, and pH 6.5. The original culture medium in the original culture bottle includes the following raw materials by weight: 74 parts wheat, 9.8 parts humus, 7.8 parts wheat bran, 4.9 parts biomass raw material, 0.9 parts lime, and 0.9 parts gypsum; the biomass raw material is sawdust or rice husk. The culture medium in the cultivation bag includes the following raw materials by weight: 64 parts wheat, 14 parts biomass raw material, 7.7 parts wheat bran, 9.5 parts humus, 0.9 parts lime, and 0.9 parts gypsum; the biomass raw material is cottonseed hulls, sawdust, rice hulls, or corn cobs.

[0030] Example 2 A morel strain ZY-1 was deposited at the Guangdong Provincial Center for Microbial Culture Collection, China on April 11, 2023, with accession number GDMCC No: 63340.

[0031] The artificial cultivation method for the morel strain ZY-1 includes the following steps: Step (1), strain preparation: The mother strain obtained from the morel tissue isolation is revitalized with the mother strain culture medium and then inoculated into the original strain culture bottle for expansion culture. After the mycelium has filled the culture bottle, the original strain is transferred to the cultivation container for culture. After the mycelium has filled the cultivation container, the cultivation is finally transferred into the cultivation bag and cultured until the mycelium has filled the bag. Step (2), cultivation management: transport the cultivation bags obtained in step (1) to the cultivation site and carry out ridge planting; Step (3), harvesting fruiting bodies: harvest when the fruiting bodies have grown to maturity and the cap ridge and pit are clearly defined; at this time, the weight is the heaviest stage in the entire production process, the flesh is thick and elastic, and has a rich morel aroma. The mother culture medium comprises the following raw materials by weight: 201 parts potato, 21 parts glucose, 19 parts agar, 2.1 parts yeast powder, 0.21 parts magnesium sulfate, 1010 parts distilled water, and a pH of 6.5-7.5. The original culture medium in the original culture bottle includes the following raw materials by weight: 76 parts wheat, 10.2 parts humus, 8.2 parts wheat bran, 5.1 parts biomass raw material, 1.1 parts lime, and 0.9-1.1 parts gypsum; the biomass raw material is sawdust or rice husk. The culture medium in the cultivation bag includes the following raw materials by weight: 66 parts wheat, 16 parts biomass raw material, 8.3 parts wheat bran, 10.5 parts humus, 1.1 parts lime, and 0.9-1.1 parts gypsum; the biomass raw material is cottonseed hulls, sawdust, rice hulls, or corn cobs.

[0032] In step (2), cultivation is carried out from March to May. The cultivation site is selected in a sandy loam soil rich in humus, from a low-altitude plain to an altitude of 3500 meters. A shading shed is built using a 4-needle shading net with a shading rate of 85%. Before sowing, the soil moisture is adjusted to 22-25%, and the maximum temperature is 15℃.

[0033] Temperature and humidity should be controlled in stages during the fruiting period: During the primordia formation period, the greenhouse temperature should be controlled at 15-20℃ and the soil temperature at 7-12℃. During the primordium differentiation period, the controlled temperature is 10-22℃ and the humidity is 90-95%. During the young mushroom stage, the temperature should be controlled at 10-22℃ and the humidity at 85-90%. During the mushroom maturation stage, the temperature should be controlled at 8-24℃ and the humidity at 80-85%. During the fruiting period, the mushrooms need 500-1000 lux of diffused light and 2 hours of ventilation per day.

[0034] Harvest the fruiting bodies when they are mature, and then clean up any remaining mushrooms and replenish the water to promote the next flush of fruiting.

[0035] Example 3 A morel strain ZY-1 was deposited at the Guangdong Provincial Center for Microbial Culture Collection, China on April 11, 2023, with accession number GDMCC No: 63340.

[0036] The artificial cultivation method for the morel strain ZY-1 includes the following steps: Step (1), strain preparation: The mother strain obtained from the morel tissue isolation is revitalized with the mother strain culture medium and then inoculated into the original strain culture bottle for expansion culture. After the mycelium has filled the culture bottle, the original strain is transferred to the cultivation container for culture. After the mycelium has filled the cultivation container, the cultivation is finally transferred into the cultivation bag and cultured until the mycelium has filled the bag. Step (2), cultivation management: transport the cultivation bags obtained in step (1) to the cultivation site and carry out ridge planting; Step (3), harvesting fruiting bodies: harvest when the fruiting bodies have grown to maturity and the cap ridge and pit are clearly defined; at this time, the weight is the heaviest stage in the entire production process, the flesh is thick and elastic, and has a rich morel aroma. The mother culture medium comprises the following raw materials by weight: 200 parts potato, 20 parts glucose, 18 parts agar, 2 parts yeast powder, 0.2 parts magnesium sulfate, and 1000 parts distilled water. The original culture medium in the original culture bottle includes the following raw materials by weight: 75 parts wheat, 10 parts humus, 8 parts wheat bran, 5 parts biomass raw material, 1 part lime, and 1 part gypsum; the biomass raw material is sawdust or rice husk. The culture medium in the cultivation bag includes the following raw materials by weight: 65 parts wheat, 15 parts biomass raw material, 8 parts wheat bran, 10 parts humus, 1 part lime, and 1 part gypsum; the biomass raw material is cottonseed hulls, sawdust, rice hulls, or corn cobs.

[0037] When the mother culture is rejuvenated using the mother culture medium, the culture temperature is 24℃; The culture temperature for scaling up the original culture in the culture flask was 21℃; When the original seed is transferred to the cultivar container for further cultivation, and when the cultivar is transferred to the cultivation bag for cultivation, the cultivation temperature is 21℃.

[0038] In step (2), cultivation is carried out from September to November. The cultivation site is selected in a sandy loam soil rich in humus, from a low-altitude plain to an altitude of 3500 meters. A shading shed is built using a 4-6 needle shading net with a shading rate of 85%-95%. Before sowing, the soil moisture is adjusted to 22-25%, and the maximum temperature is 16℃.

[0039] Temperature and humidity should be controlled in stages during the fruiting period: During the primordia formation period, the greenhouse temperature should be controlled at 15-20℃ and the soil temperature at 7-12℃. During the primordium differentiation period, the controlled temperature is 10-22℃ and the humidity is 90-95%. During the young mushroom stage, the temperature should be controlled at 10-22℃ and the humidity at 85-90%. During the mushroom maturation stage, the temperature should be controlled at 8-24℃ and the humidity at 80-85%. During the fruiting period, the mushrooms need 500-1000 lux of diffused light and 3 hours of ventilation per day.

[0040] Harvest the fruiting bodies when they are mature, and then clean up any remaining mushrooms and replenish the water to promote the next flush of fruiting.

[0041] The primer set used to identify the morel strain ZY-1 includes the SSR-01 primer pair, the SSR-02 primer pair, the SSR-03 primer pair and the SSR-04 primer pair. The sequences of the SSR-01 primer pair are as follows: SSR-01-F:ggactgtgcagtggttggta; SSR-01-R:cttgactccacacttctccca; The sequences of the SSR-02 primer pair are as follows: SSR-02-F:gagtacacgggcctctcaag; SSR-02-R: acatacatacaggcaggcgg; The sequences of the SSR-03 primer pair are as follows: SSR-03-F:tgccgggtggaggagataat; SSR-03-R:gatggagctgcgagaggatg; The sequences of the SSR-04 primer pair are as follows: SSR-04-F:tcctccaagaaccgcttacg; SSR-04-R: gcgaggagatggagaggac.

[0042] Example 4 The difference between Example 4 and Example 3 is as follows: In step (2), cultivation is carried out from September to November. The cultivation site is selected in a sandy loam soil rich in humus, from a low-altitude plain to an altitude of 3500 meters. A shading shed is built using a 5-needle shading net with a shading rate of 90%. Before sowing, the soil moisture is adjusted to 22-25%, and the maximum temperature is 1.5℃.

[0043] Temperature and humidity should be controlled in stages during the fruiting period: During the primordia formation period, the greenhouse temperature should be controlled at 15-20℃ and the soil temperature at 7-12℃. During the primordium differentiation period, the controlled temperature is 10-22℃ and the humidity is 90-95%. During the young mushroom stage, the temperature should be controlled at 10-22℃ and the humidity at 85-90%. During the mushroom maturation stage, the temperature should be controlled at 8-24℃ and the humidity at 80-85%. During the fruiting period, the mushrooms need 500-1000 lux of diffused light and 2 hours of ventilation per day.

[0044] Harvest the fruiting bodies when they are mature, and then clean up any remaining mushrooms and replenish the water to promote the next flush of fruiting.

[0045] Everything else is the same.

[0046] Application Examples I. Source of Morel strain ZY-1 On September 6, 2020, the inventor collected wild morel mushrooms in Yongsheng County, Lijiang City, and obtained pure strains through tissue isolation and purification.

[0047] II. Isolation, purification, and identification of Morel strain ZY-1 1. Separation and purification (tissue separation) Small pieces of internal tissue from wild morel mushrooms were cut near an alcohol lamp and placed on potato dextrose agar (PDA) medium. After germination and purification, pure strains were obtained. Under the same culture conditions, mycelial growth (growth rate, thickness, density, etc.) was compared. Strains with weak mycelial growth were eliminated, and the strain with the best mycelial growth, capable of producing fruiting bodies, was selected. This resulted in morel strain ZY-1, named "Zhongyuan No. 1". A photograph of its pure culture is shown below. Figure 1 As shown.

[0048] 2. Molecular identification A suitable amount of pure cultured mycelium was scraped and ground with liquid nitrogen (or a grinder). Total DNA was extracted using a plant genomic DNA extraction kit (Shanghai Sangon Biotech Co., Ltd.). RNA polymerase chain reaction (PCR) was used to amplify ITS, LSU, and tef1-a primers. The specific base composition of the primers is shown in Table 1. The PCR reaction system (25 μL) included: 2.5 μL PCR reaction buffer, 2.5 μL 0.2% BSA, 2 μL dNTP (2.5 mM), 0.5 μL each of forward and reverse primers (100 pmol / μL), 0.2 μL 5 U / μL Taq DNA polymerase, 1 μL DNA solution, and 15.8 μL sterile ddH2O.

[0049] Table 1 Primers and base composition used for PCR amplification The ITS PCR cycle is as follows: initial denaturation at 94°C for 5 min; repeated 35 cycles of 94°C for 30 s, 53°C for 30 s, and 72°C for 50 s, with a final extension at 72°C for 10 min.

[0050] The LSU PCR cycle was as follows: initial denaturation at 94°C for 5 min; 35 cycles of 94°C for 30 s, 52°C for 30 s, 72°C for 1 min, and finally extension at 72°C for 10 min.

[0051] The PCR cycle for tef1-a was as follows: initial denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, denaturation at 55℃ for 30 s, denaturation at 72℃ for 50 s, extension at 72℃ for 10 min, repeated for 35 cycles.

[0052] The amplified product was stored at 4°C.

[0053] (1) Accurately weigh 1g of agarose using an electronic balance and dissolve it in 100mL of TBE (tris(hydroxymethyl)aminomethane-boric acid-ethylenediaminetetraacetic acid). Heat the solution in a microwave oven on medium heat for 2.0min until it becomes clear and transparent. When the temperature reaches 65℃, add 1μL of nucleic acid dye and shake well. Pour the solution into a silica gel plate and allow it to cool. Place the plate in an electrophoresis pool and use a pipette to spot the sample. The spotting volume is 5μL. The electrophoresis voltage is 160V, the current is 90A, and the time is 15min. After electrophoresis in 1.0×TBE buffer, observe, photograph, and record the results using an ultraviolet gel imaging system. Detect the concentration of the extracted DNA. Send positive products to Shanghai Sangon Biotech for sequencing. Use ITS, LSU, and tef1-a forward primers to send successful PCR products to Sangon Biotech for sequencing. When the sequence contains heterozygous INDELs or indeterminate sites, perform bidirectional sequencing on the sample to splice the amplified region or verify the indeterminate sites. The ITS fragment was matched with the NCBI database and identified as Morchella septimelata.

[0054] The characteristic sequences of Morel strain ZY-1 are as follows: ITS, nrLSU, and tef1α, as shown in SEQ ID NO.7~SEQ ID NO.9.

[0055] ITS is: acagaaaagggcagccgaggggccaaccagggctagtagctttacgttgttgaacgtcctggaacggacccggagccgcccccatctaaacactctgcgtacccatcccaccttgcttcccccggccatccgctggggggaggaacaacaaccaaaactctttgtgaagaaacagacgtcagaatcataaccaaaaaaaagttaaaactttcaacaacggatctcttggttcccacatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccctctggtattccggggggcatgcctgttcgagcgtcataaaaacctcctcccccttcgggtttgattactatcgttggggggtattggcctactgggaaagcgatttggcaattgccttcccactgtcctaaatacacttagacccgcctccagatgcgacagcaccgaggccatcaaccgtggagttatggaataccgttctccacacgccgatggcaaaccggtcgcagttgcgggcgtaaattggagccctcttcaggaccctcgtggcctagcatccaccatacatattttgacctcggatcaggtagggatacccgctgaact (SEQ ID NO.7) The LSU is: ctcaaattttaaagctggcatcttcggtgtccgcgttgtaattttgtgaggcatctccgggtagggcgccggcctaagttccttggaacaggacgtcacagagggtgagaatcccgtgcttggctggctgtccccgtccatgtgaggtgtcttcgacgagtcgagttgtttgggaatgcagctcaaaatgggtggtaaatttcatctaaagctaaatattggtgggagaccgatagcgcacaagtagagtgatcgaaagatgaaaagcactttgaaaatagagttaaaaagtacgtgaaattgttgaaagggaagcgcttgagatcagacttcggtagggggtgatcagccgtccttctgggcggtgcacttgcccctctccgggccagcatcggttgaggcggcgggataaaggtcccgggaatgtggctccttcgcgggagtgttatagcccgggtgaatgccgccagtctcgaccgaggaccgcacccgcaagggttaggatgcttggcataatggtcttcagcgacccgtcttgaaacacggaccaaggagtctaacatctatgcgagtgtttgggtgtcaaacccttgcgcgaaatgaaagtgaacggaggtgggaacccgcaagggcgcaccatcgaccggtcctgaagtcttctgaaggatctgagtaggagcatagctgttgggacccgaaagatggtgaactatgcctgaatagggtgaagccagaggaaactctggtggaggctcgcagcggttctgacgtgcaaatcgatcgtcaa (SEQ ID NO.8) tef1α is: tgccgctggtgtaagttcttaccatatcgttggatttttttaacattcactaattacttcgcatcacagactggtgagttcgaggctggtatctccaaggatggtcagacccgtgagcacgctcttctcgcctacacccttggtgttaagcagctcattgttgccatcaacaagatggacactaccaagtggtctgaggatcgtttcaaggaaattgtcaaggaaacatccaactttatcaagaaggttggatacaaccccaagactgttgccttcgttcctatctctggattcaacggttagtaaccttcctctcctcaattttaacattgtctaacatccatctgtcaggtgacaacatgattgactcctcctccaactgcccctggtacaagggatgggagaaggagaccaaggctggaaagtcttctggaaagaccctccttgacgccattgactctattgagcccccaacccgtcctaccgagaagcctctccgtcttcctctccaggatgtctacaagattggtggtat (SEQ ID NO.9) (2) The mycelial ITS sequence of morel strain ZY-1 was spliced ​​in both forward and reverse directions and compared with the NCBI database. The results showed that the ITS sequence of morel strain ZY-1 had a 100% similarity to the sequence of Morchella septimelata (JQ618559); the LSU sequence of morel strain ZY-1 had a 100% similarity to the sequence of Morchella importuna (CCBAS932). The tef1-α sequence of morel strain ZY-1 had a 97.00% similarity to the sequence of Morchella importuna (HT 114); the control "Qimei K" and "Qimei Morel" (Morchella septimelata) (HKAS62863) were compared. The control "Qimei K" is an existing variety introduced in Sichuan Province. The sequence comparison results showed that the sequence similarity rate was 99.69%. Morel strain ZY-1 and the control "Qimei K" both have a high similarity to Morchella septimelata. Based on the fact that macrofungi have a gene similarity of more than 97%, they are generally considered to be the same species. Therefore, it is preliminarily determined that morel strain ZY-1 and control "Qimei K" are both Morchella septimelata. However, there are certain differences in molecular sequence and clade. Therefore, they are different strains of the same species.

[0056] (3) Phylogenetic analysis of morel strain ZY-1 Based on the NCBI alignment results of the ITS sequences, relevant reference sequences were downloaded from GenBank. Twenty-seven reference sequences were selected for maximum likelihood (ML) phylogenetic analysis. The combined RAxML dataset analysis generated an optimal score tree, with leading values ​​of maximum likelihood (ML) greater than 60% displayed in the nodes.

[0057] Phylogenetic analysis showed that morel strain ZY-1 and the control "Qimei K" formed a separate branch with the previously reported morel *Morchella septimelata* in the morel phylogenetic tree, and obtained 100% support (e.g., ...). Figure 2 Based on morphological analysis, it was determined that "morel strain ZY-1 is Morchella septimelata, which is the same species as the control strain, but there are certain differences in genetic distance."

[0058] III. SSR Molecular Markers 1. DNA extraction The tested bacterial strain (pure strain obtained by tissue isolation and purification) was transferred to potato dextrose agar solid medium and cultured at 25°C for 15 days. Mycelia were then collected. Genomic DNA was extracted from the mycelia using the DE711-50 kit from Jinsha Biotechnology. The purity and concentration of the DNA were detected by agarose gel electrophoresis and biospectrophotometry.

[0059] 2. Genome sequencing After DNA extraction, purification, and library construction, the samples (using mycelia of the test strain cultured at 25℃ for 5 days) were sequenced using sequencing technology on a sequencing platform. SSR sites were searched for in the genome sequence of Morel strain ZY-1.

[0060] 3. Development of SSR primers based on genome sequencing results Based on morel genome data, four pairs of SSR primers were developed and screened to distinguish morel strain ZY-1 from the control “Qimei K” using SSR-01 primer pair, SSR-02 primer pair, SSR-03 primer pair, and SSR-04 primer pair. The detailed information of the labeled primers is shown in Table 2.

[0061] Table 2 SSR marker primer information 4. PCR amplification SSR-labeled PCR amplification was performed on the extracted DNA using SSR molecular markers. The PCR amplification system consisted of a total volume of 25 μL, including: 12.5 μL of Sangon 2×T5 Super PCR Mix (with black dye); 1 μL each of SSR-labeled forward and reverse primers (both at a concentration of 0.1 mmol / μL); 1 μL of template DNA; and 9.5 μL of sterile ddH2O. The PCR reaction conditions were: 95℃ for 2 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 30 s, for 38 cycles; and 72℃ for 5 min. To ensure the accuracy of identification, three replicate experiments were performed. The control "Qimei K" was also replicated three times under the same conditions.

[0062] 5. Electrophoresis Electrophoresis was performed using polyacrylamide gel, followed by silver staining to reveal bands: 48 mL of 1×TBE solution; 12 mL of Acr-Bis (19:1); 1 mL of 10% APS solution; 100 μL of 10% TEMED; pour the gel immediately after preparation, removing air bubbles. After the gel solidifies, perform electrophoresis; the sample volume is 1 μL per well, and the electrophoresis conditions are 270V constant voltage for 1.5 h. After electrophoresis, wash the gel twice with distilled water; add 400 mL of 10% silver nitrate solution and shake on a shaker for 8 min; after silver staining, wash twice with water; add sodium hydroxide and formaldehyde for color development (6 g NaOH, 400 mL distilled water, 2 mL formaldehyde solution).

[0063] Table 3 Comparison of amplified fragment sizes of primers in Morel strain ZY-1 and control "Seven Sisters K" As shown in Table 3, the SSR primers Zhongyuan 1 SSR-01, Zhongyuan 1 SSR-02, Zhongyuan 1 SSR-03, and Zhongyuan 1 SSR-04 can distinguish Morel strain ZY-1 from the control "Qimei K". The sizes of the specific fragments amplified by Morel strain ZY-1 are 145, 149, 144, and 142 bp, respectively, while the sizes of the fragments from the control "Qimei K" are 141, 133, 168, and 160 bp, respectively. This indicates that there are genetic differences between the two strains.

[0064] IV. Antagonism Test The procedure was performed according to the national industry standard "Differential Identification of Edible Fungi Strains - Antagonistic Reaction" (NY / T 1845-2010). Morel strain ZY-1 and the control strain "Qimei K" were inoculated into potato dextrose agar (PDA) for activation. Then, 0.5 cm diameter inoculation blocks of 3-day-old mycelium were taken using a punch, spaced 30 mm apart, and placed 15 mm from the center of the plate with mycelia facing upwards. The plates were incubated at 24°C for 2-3 days, with three replicates, and the antagonistic phenomenon of mycelia at the colony boundaries between strains was observed.

[0065] Antagonism test results as follows Figure 4 As shown, the results indicate that morel strain ZY-1 and the control strain "Qimei K" have a strong antagonistic reaction and no affinity, forming raised antagonistic lines, indicating that they are different strains (varieties) of morel. Morel strain ZY-1 has faster mycelial growth, while the control strain "Qimei K" has denser mycelia.

[0066] V. Artificial Cultivation Method of Morel Strain ZY-1 1. Mother culture medium and its preparation The mother culture medium formula is a modified potato glucose agar medium (PDA): 200g potato, 20g glucose, 18g agar, 2g yeast powder, 0.2g magnesium sulfate, and 1000mL distilled water. The method for preparing the improved potato glucose culture medium is as follows: (1) Cooking: Peel the potatoes, wash and slice them, weigh 200g, add 1000mL of water, heat and boil until the potato slices are soft but not mushy, and filter with six layers of gauze.

[0067] (2) Preparation ratio: Add 20g glucose, 20g agar, 2g yeast powder and 0.2g magnesium sulfate to the filtrate, add water to make up to 1L, and stir to dissolve.

[0068] (3) Dispensing and sterilization: After dissolving, dispense the solution into test tubes while still hot, generally filling 1 / 5 to 1 / 4 of the test tube length. After dispensing, plug the tubes with cotton plugs, 50 plugs per bundle, and wrap one end of the test tube opening tightly with kraft paper. After wrapping, place the test tubes in an autoclave and sterilize at 121℃ for 20 minutes.

[0069] (4) Slant placement: After sterilization, take out the test tube while it is still hot and place it on the workbench to form a slant. Usually, the length of the slant is 1 / 2 of the test tube. After solidification, place it in a clean and dry place for later use.

[0070] The mother culture was isolated using a tissue isolation method, which has advantages such as simplicity, convenience, stable genetic traits, and strong regeneration ability. Fresh fruiting bodies were collected, and impurities at the base were scraped off with a knife. The bodies were then wiped with cotton balls (after squeezing out the alcohol solution) and placed in petri dishes. The dishes were then transferred to a clean bench, and hands were sterilized. Inoculation needles, forceps, and blades were flammed over an alcohol lamp for later use. Tissue blocks measuring 0.5cm × 0.5cm were cut using a scalpel and inoculated into the culture medium. After purification and culture, the mother culture was obtained.

[0071] 2. Culture media for primary and cultivated strains and their preparation The original culture medium formula is as follows: The original culture medium in the original culture bottle includes the following raw materials by weight: 75 parts wheat, 10 parts humus, 8 parts wheat bran, 5 parts biomass raw material, 1 part lime, and 1 part gypsum; the biomass raw material is sawdust or rice husk. The culture medium in the cultivation bag includes the following raw materials by weight: 65 parts wheat, 15 parts biomass raw material, 8 parts wheat bran, 10 parts humus, 1 part lime, and 1 part gypsum; the biomass raw material is cottonseed hulls, sawdust, rice hulls, or corn cobs.

[0072] The method for preparing the original culture medium is as follows: (1) Ingredients and pretreatment: Weigh the raw materials according to the formula. Biomass raw materials and wheat bran need to be pre-wetted with water in advance; wheat needs to be soaked in water with 0.2% lime by mass concentration in advance; dissolve the required gypsum and lime in water first, and then sprinkle them on biomass raw materials and wheat bran. Add water while stirring, pile and simmer for 1 hour, and stir again until uniform. (2) Mixing and bottling (packing): Mix all raw materials evenly, with a moisture content of about 60%. Use breathable cap tissue culture bottles for the original culture and use spawn bags for the cultivated culture. Pack the bottles (bags) tightly and punch holes in the center for easy inoculation. (3) Sterilization: Before sterilization, cold air needs to be completely removed to ensure that the bacteria in the sterilization package are completely killed. The original culture bottle is placed in an autoclave and sterilized at 121°C and 0.103MPa for 2 hours; (4) Inoculation of the primary culture: Place the sterilized primary culture bottles into the inoculation room and sterilize them with a UV lamp for half an hour before inoculation. Strict aseptic procedures must be followed during the operation. Cut the mother culture into small pieces and inoculate them in the center of the culture medium. After inoculation, move all the primary culture bottles into the incubation room and control the temperature at 22℃. When the mycelium in the culture bottles has covered 1 / 3 of the bag, lower the temperature of the incubation room to 21℃. Check the primary culture bottles for contamination by other microorganisms at least once a week. If contaminated, remove the contaminated bottles from the incubation room immediately and record the growth of the morel mycelium.

[0073] The method for preparing the culture medium for the cultivar is as follows: (1) Ingredients and pretreatment: Weigh the raw materials according to the formula. Biomass raw materials and wheat bran need to be pre-wetted with water in advance; wheat needs to be soaked in water with 0.2% lime by mass concentration in advance; dissolve the required gypsum and lime in water first, and then sprinkle them on biomass raw materials and wheat bran. Add water while stirring, pile and simmer for 1 hour, and stir again until uniform. (2) Bagging: Mix all raw materials evenly and use (14-15)cm×(28-30)cm×0.05cm polyethylene bags for bagging. When filling, ensure that the bag height is basically consistent and the tightness is appropriate. Compact the culture medium as you add the material. The filling should be tight. Then, use a perforator to make a hole with a diameter of 1.5-2.0 cm in the center of the material surface for inoculation. After bagging, the height of the material in the bag should be about 20 cm. Put on the collar and the cap. Each bag of culture medium has a dry weight of 0.5 kg and a wet weight of 1.1-1.2 kg.

[0074] (3) Sterilization: When using atmospheric pressure steam sterilization, vent the cold air in advance during the heating process. When the temperature reaches 110℃, start timing and maintain this temperature for 8-10 hours. Then stop heating and allow it to cool down naturally. When the internal temperature of the sterilizer drops below 60℃, the bags can be transferred to the cooling chamber for natural cooling. When using high pressure steam sterilization, first open the exhaust valve to allow the cold air inside the pot to escape freely. When the temperature inside the pot reaches 100℃, close the exhaust valve. When the pressure is increased to 0.05MPa, slowly lift the exhaust valve and slowly vent the air. When the pressure gauge drops to the starting point, close the exhaust valve and pressurize again. Repeat this operation 2-3 times to exhaust all the cold air inside the pot. Different sterilizers and different sterilization quantities per batch vary greatly. The exhaust endpoint is determined by the temperature indicated by the pressure gauge and the temperature gauge being equal. After complete exhaust, increase the pressure to 0.14MPa-0.16MPa and maintain it for about 2 hours.

[0075] (4) Inoculation: Place the cultivation bags and cultured spawn in the inoculation room and sterilize them with a UV lamp for half an hour before inoculation. Strict aseptic procedures must be followed during the operation. Thoroughly disinfect hands, cultivation bags, and tools with 75% alcohol swabs. Heat and cool the scalpel and forceps over an alcohol lamp, then transfer the spawn at a 1:20 propagation ratio using the scalpel, and seal with a sterilized sponge. After inoculation, transfer the cultivation bags to the incubation room and incubate in the dark at 18℃-22℃. During the incubation process, promptly discard any cultivation bags contaminated with other microorganisms.

[0076] 3. Artificial Cultivation Methods of Morel Mushrooms (1) Formula selection The mother culture medium consists of the following ingredients by weight: 200 parts potato, 20 parts glucose, 18 parts agar, 2 parts yeast powder, 0.2 parts magnesium sulfate, and 1000 parts distilled water. The original culture medium in the original culture bottle includes the following raw materials by weight: 75 parts wheat, 10 parts humus, 8 parts wheat bran, 5 parts biomass raw material, 1 part lime, and 1 part gypsum; the biomass raw material is sawdust or rice husk. The culture medium in the cultivation bag includes the following raw materials by weight: 65 parts wheat, 15 parts biomass raw material, 8 parts wheat bran, 10 parts humus, 1 part lime, and 1 part gypsum; the biomass raw material is cottonseed hulls, sawdust, rice hulls, or corn cobs.

[0077] (2) Production process of mother seed, original seed and cultivar Mother culture preparation: Morel strain ZY-1 was inoculated onto modified potato dextrose agar (PDA) medium and cultured at 24°C for 8-10 days to obtain the mother culture; Preparation of primary strain: Inoculate the mother strain onto the primary strain substrate and culture at 21℃ for 13-15 days to obtain the primary strain; Preparation of spawn: Inoculate the original spawn onto the spawn substrate and incubate at 21℃ for 20-25 days to obtain the spawn; The optimal culture temperature for ZY-1 mycelium is 24℃, so the mother culture is cultured at 24℃. However, for the original culture and the cultivated culture, the culture environment temperature is generally set at 21-22℃ because the spawn bag will generate heat. The temperature inside the spawn bag will be 2-3℃ higher than the ambient temperature.

[0078] (3) Land preparation Spread 150 kg / mu of quicklime evenly on the soil surface, then plow to a depth of 30 cm. Then, prepare the land into raised beds 1.2 m wide and 0.2 cm apart. Finely chop the soil on the raised beds until the soil particles are less than 2 cm. Before sowing, adjust the soil moisture to 22-25% and the maximum temperature to 15-16℃.

[0079] (4) Erect a sunshade Based on the weather conditions at the demonstration site, a shade canopy was constructed using 4-6 needle shade netting with a shading rate of 85%-95%.

[0080] (5) Sowing and mulching The spawn is calculated at a dosage of 320 bags per acre. After crushing the spawn, it is sown by broadcasting. The spawn is planted in ridges and covered with 1-3 cm of fine soil. The amount of soil covering should be such that the spawn is not exposed. Then, cover with a light black mulch film with a thickness of 0.6 mil to provide a stable environment for the spawn to keep warm and moist, and promote rapid mycelial growth.

[0081] (6) Feeding and bacterial culture Ten days after sowing, place exogenous nutrient bags (existing products can be used) at a rate of 1800-2000 bags / acre (0.3-0.4 kg / bag). After making a slit on the side of the nutrient bag, place it evenly and flat on the mycelium on the bed surface. The mycelium will then grow into the outer bag along the slit and absorb and transform nutrients. Then, enter the mycelium cultivation stage, with a cultivation period preferably greater than 45 days.

[0082] (7) Staged management of mushroom growth and primordia Remove the mulch film 1-2 months after sowing when a small number of primordia are visible. Water to promote mushroom growth (the amount of water should be such that the soil within 15cm is saturated). During the primordia formation period, control the greenhouse temperature at 15-20℃ and the soil temperature at 7-12℃. During the primordia differentiation stage, the temperature should be controlled at 10-22℃ and the humidity at 90-95%. From the later stages of primordia development to the formation of small mushrooms, the temperature should be controlled at 10-22℃ and the humidity at 85-90%, avoiding dry air and sudden temperature fluctuations. During the mature mushroom stage, the temperature inside the greenhouse should be controlled at 8-24℃ (if the temperature exceeds 25℃, cooling methods such as watering the roof should be used to lower the temperature), and the humidity at 80-85%, reducing the soil moisture content to 18%-25% to accelerate the growth and development of the ascocarps. During the fruiting period, 500-1000 lux of diffused light and 2-3 hours of ventilation per day are required.

[0083] (8) Maturity management and harvesting During the ascocarp ripening stage, reduce air humidity to 70%-85%, reduce soil moisture content, and increase air circulation speed.

[0084] When the ascocarps of morel mushrooms stop growing, the cap ridges and pits are clearly defined, the flesh is thick and elastic, and it has a rich aroma, it has entered the ripening stage. Mature morel mushrooms need to be harvested in time to avoid overripeness affecting quality. When harvesting, hold a knife in your right hand and use a sharp knife to make a 45° downward cut on both sides at the junction of the stem and the ground, forming a "V" shape. Shake the mushroom from side to side to pick it off, and use the knife to remove the soil attached to the base of the stem; or you can directly cut the stem flat near the base of the soil with a knife.

[0085] 4. Solid culture characteristics After preparing and mixing the potato dextrose agar (PDA) medium, sterilize it at 121°C and 0.103 MPa for 30 min, and pour it into 90 mm petri dishes to make plates. Activate the preserved morel strain ZY-1 and transfer it to potato dextrose agar (PDA) medium. After the mycelium has fully colonized the petri dishes, it is ready for use.

[0086] The formula for potato dextrose agar (PDA) medium is: 200g potato, 20g glucose, 18g agar, 2g peptone (or yeast powder), and 1000mL distilled water.

[0087] Morel mushroom mycelial blocks were inoculated into the center of each culture medium under various conditions using a 0.7 cm diameter punch. Except for the temperature gradient experiment, all other single-factor conditions were incubated in a 26℃ constant temperature incubator, with each treatment replicated five times. The colony diameter was measured every three days using the streak method. Mycelial morphology and growth potential were observed and recorded. The final data were statistically analyzed using Excel 2021 and SPSS 20.0.

[0088] Growth rate s = colony radius (cm) / number of days (d) 4.1 Single-factor screening experiment for carbon sources Culture medium II: 20g glucose, 2g peptone, 0.2g potassium dihydrogen phosphate, 16g agar, 1000mL distilled water.

[0089] Using culture medium II without added glucose as a blank control, six carbon sources were set up as treatment groups: glucose, sucrose, fructose, starch, lactose, and galactose, all at a concentration of 20 g / L.

[0090] The effects of different carbon sources on mycelial growth rate are shown in the following results. Figure 5 .

[0091] Depend on Figure 5 It can be seen that the mycelia are whitest and densest when soluble starch is used as a carbon source, and the growth rate is the fastest at (3.44±0.16) cm·d. -1 Furthermore, the mycelial growth was whiter and denser than under other carbon source conditions, showing a significant difference compared to other carbon source conditions. The mycelial growth rate was slowest without a carbon source, at (2.27±0.03) cm·d. -1 .

[0092] 4.2 Single-factor screening experiment for nitrogen sources Using culture medium II without tryptone as a blank control, six nitrogen sources were set up as treatment groups: tryptone, urea, yeast extract, ammonium chloride, potassium nitrate, and ammonium bicarbonate, all with a concentration of 2 g / L.

[0093] The effects of different nitrogen sources on mycelial growth rate are shown in the following results. Figure 6 .

[0094] Depend on Figure 6 It can be seen that the mycelial growth rate is fastest when yeast powder is used as a nitrogen source, with the fastest growth rate being (2.65±0.07) cm·d. -1 When yeast powder was used as a nitrogen source, the mycelial growth was the whitest and densest, showing a significant difference compared to other nitrogen source conditions; there was no significant difference between the potassium nitrate group and the control group. When urea was used as a nitrogen source, the mycelial growth rate was the slowest, at (0.22±0.23) cm·d. -1 .

[0095] 4.3 Inorganic Salt Single-Factor Screening Experiment Inorganic salt experiment: Using culture medium II as a blank control, six inorganic salts were added to the PDA basal culture medium: potassium dihydrogen phosphate, magnesium sulfate, sodium chloride, calcium carbonate, copper sulfate, and ferrous sulfate as treatment groups, with a concentration of 0.2 g / L for each group.

[0096] The effects of different inorganic salts on mycelial growth rate are shown in the results. Figure 7 .

[0097] Depend on Figure 7 It can be seen that when magnesium sulfate is used as an inorganic salt, the mycelium is relatively white and dense, and the fastest growth rate is (3.16±0.08) cm·d. -1 When copper sulfate is an inorganic salt, the mycelial growth rate is the slowest, at (1.47±0.13) cm·d. -1 It differs significantly from other inorganic salts.

[0098] 4.4 Temperature Single-Factor Screening Experiment After inoculation with culture medium, the petri dishes were placed in constant temperature incubators at 15℃, 18℃, 21℃, 24℃, 27℃, and 30℃ for incubation.

[0099] The effects of different temperatures on mycelial growth rate are shown in the following results. Figure 8 .

[0100] Depend on Figure 8 It can be seen that the mycelium is whitest and densest at a temperature of 24℃, and its growth rate is the fastest at (3.04±0.12) cm·d. -1 The mycelial growth rate differed significantly from other temperatures. The slowest growth rate was observed at 15℃, at (1.53±0.09) cm·d. -1 There were no significant differences among the three at temperatures of 18℃, 30℃, and 27℃.

[0101] 4.5 pH Single-Factor Screening Test The initial pH of the culture medium I was adjusted with 1.0 mol / L hydrochloric acid and 1.0 mol / L sodium hydroxide solution, and six initial pH gradients were set: 5.0, 6.0, 7.0, 8.0 and 9.0.

[0102] The effects of different pH conditions on mycelial growth rate are shown in the figure. Figure 9 .

[0103] Depend on Figure 9 It can be seen that the mycelial growth rate is fastest at pH 8.0, which is (2.78±0.06) cm·d. -1 There was no significant difference among the three at pH 7.0 and pH 8.0; the mycelial growth rate was slowest at pH 5.0, at (2.52±0.14) cm·d. -1 It differs significantly from other pH values.

[0104] Ultimately, the inventors determined the optimal formula and conditions as follows: the carbon source is glucose, the nitrogen source is yeast powder, the inorganic salt is magnesium sulfate, the temperature is 24℃, and the pH is 6.5-7.5.

[0105] VI. Preliminary Screening (Small-scale Test) 1. Number of strains tested Morel mushrooms are a bed-cultivated variety. Following the requirements of GB / T21125-2007 Edible Fungus Variety Selection Standard, the small-scale preliminary screening experiment design required a cultivation area of ​​≥5m² per group. 2 According to the field cultivation calculation standard, 320 bags of seed are used per mu (approximately 0.067 hectares), with bag dimensions of (14-15) cm × (28-30) cm × 0.05 cm. 0.5 bags of seed are sown per square meter. Each bed group is 5m². 2 Two 7.5 bags of morel strain ZY-1 were used, with three replicates.

[0106] 2. Results and Analysis The initial screening of morel strain ZY-1 in a small-scale trial and the results of its fruiting characteristics and yield are shown in the figure. Figure 10 And Table 4.

[0107] Table 4. Statistics on fruiting yield and traits of Morel strain ZY-1 in the initial screening of small-scale trials. Note: Yield measurement was conducted at 5 points (each sampling point was 1m). 2 The sampling method was used to sample and measure the yield of each group; for the characteristics of the fruiting bodies, 30 fruiting bodies were randomly selected from each group for measurement and the average value was calculated.

[0108] From Table 4 and Figure 10It can be seen that the fruiting condition of the morel strain ZY-1 in the initial screening test group was good, with uniform fruiting. The mature ascocarps were pagoda-shaped, with large caps, averaging 6.76 cm in length and 4.07 cm in maximum width. The flesh was thick, brownish-brown, with obvious and deep pits, thin and forked longitudinal ridges, and sloping transverse ridges that intersect with the longitudinal ridges. The stipe was cylindrical, short, and slightly swollen at the base, exhibiting good commercial characteristics. The average fresh weight of a single ascocarp was 22.99 g, the average dry weight was 2.56 g, and the dry weight conversion rate was 11.13%. The yield results showed that the yield per mu (667 square meters) was 235.26 kg in group 1, 262.48 kg in group 2, and 249.92 kg in group 3, with an average yield of 249.22 kg per mu for the three groups.

[0109] VII. Small-scale secondary screening 1. Number of trials Morel mushrooms are a bed-cultivated variety, and their cultivation should be carried out in accordance with the requirements of GB / T 21125-2007, the standard for the selection and breeding of edible fungi. Small-scale preliminary screening experiment design: each group has a cultivation area ≥6m² 2 According to the field cultivation calculation standard, 320 bags of seed are used per mu (approximately 0.067 hectares), with bag dimensions of (14-15) cm × (28-30) cm × 0.05 cm. 0.5 bags of seed are sown per square meter. Each bed group is 6m². 2 Three bags of culture were used, with three replicates, for a total of approximately nine bags of morel strain ZY-1 culture.

[0110] 2. Results and Analysis The fruiting characteristics and yield of morel strain ZY-1 obtained from small-scale secondary screening are shown in the figure. Figure 11 See Table 5.

[0111] Table 5. Statistics on fruiting yield and traits of Morel strain ZY-1 in small-scale secondary screening. Note: Yield measurement was conducted at 5 points (each sampling point was 1m). 2 The sampling method was used to sample and measure the yield of each group; for the characteristics of the fruiting bodies, 30 fruiting bodies were randomly selected from each group for measurement and the average value was calculated.

[0112] From Table 5 and Figure 11It can be seen that the morel strain ZY-1 exhibited good fruiting characteristics in the small-scale re-screening test group, with more uniform fruiting. Mature morels were pagoda-shaped with large caps, averaging 7.19 cm in length and 4.37 cm in maximum width. The flesh was thick, brownish-red, with distinct and deep pits, thin and forked longitudinal ridges, and sloping transverse ridges intersecting with the longitudinal ridges. The stipe was cylindrical, short, and slightly swollen at the base, exhibiting good commercial characteristics. The average fresh weight of a single ascocarp was 25.56 g, the average dry weight was 2.98 g, and the average dry weight percentage was 11.67%. Yield measurements showed that the yield per mu (667 square meters) was 272.39 kg in group 1, 268.42 kg in group 2, and 305.23 kg in group 3, with an average yield of 282.01 kg per mu across the three groups.

[0113] VIII. Intermediate Trial 1. Number of trials Morel mushrooms are a bed-cultivated variety. Following the requirements of GB / T 21125-2007 Edible Fungus Variety Selection Standard, the intermediate trial design had a cultivation area of ​​≥100m² per group. 2 According to the field cultivation calculation standard, 320 bags of seed are used per mu (approximately 0.067 hectares), with bag dimensions of (14-15) cm × (28-30) cm × 0.05 cm. 0.5 bags of seed are sown per square meter. Each bed group is 100 m². 2 50 bags of culture were used, with 3 replicates, for a total of approximately 150 bags of morel strain ZY-1 culture.

[0114] 2. Results and Analysis Intermediate test results for fruiting characteristics and yield of morel strain ZY-1 are shown in [link to relevant documentation]. Figure 12 See Table 6.

[0115] Table 6. Statistics on fruiting yield and traits of Morel strain ZY-1 in intermediate trials. Note: Yield measurement was conducted at 5 points (each sampling point was 2m). 2 The sampling method was used to sample and measure the yield of each group; for the characteristics of the fruiting bodies, 30 fruiting bodies were randomly selected from each group for measurement and the average value was calculated.

[0116] From Table 6 and Figure 12It can be seen that the fruiting state of the morel strain ZY-1 in the intermediate experimental group was good, and the fruiting was more uniform. The mature morel mushrooms were pagoda-shaped, with large caps, averaging 7.46 cm in length and 4.68 cm in maximum width. The flesh was thick, brownish-brown, with obvious and deep pits, thin and forked longitudinal ridges, and sloping transverse ridges that intersect with the longitudinal ridges. The stipe was cylindrical, short, and slightly swollen at the base, exhibiting good commercial characteristics. The average fresh weight of a single ascocarp was 28.69 g, the average dry weight was 3.12 g, and the dry weight conversion rate was 10.68%. The yield results showed that the yield per mu (667 square meters) was 265.37 kg in group 1, 302.18 kg in group 2, and 311.26 kg in group 3, with an average yield of 292.94 kg per mu across the three groups.

[0117] After initial screening, secondary screening, and intermediate trials, the physiological characteristics and cultivation management techniques of Morel strain ZY-1 have become increasingly mature, resulting in improved fruiting uniformity and yield. Results show that Morel strain ZY-1 exhibits good vigor, uniform fruiting, low dry weight loss, high yield, and good consistency and stability. Based on a market purchase price of 80 yuan / kg for fresh Morel mushrooms, the income per mu (approximately 0.16 acres) is approximately 23,000 yuan, demonstrating considerable economic benefits. Field observations from the intermediate trials indicate that Morel strain ZY-1 exhibits strong resistance and adaptability, enabling cultivation in multiple locations, and it is also suitable for factory-scale indoor cultivation.

[0118] IX. Demonstration Cultivation (Investigation and Analysis of Uniformity and Stability) 1. Demonstration Experiment Design Morel strain ZY-1 is a bed-cultivation variety. In accordance with the requirements of GB / T21125-2007 "Specifications for the Breeding of Edible Fungi Varieties", the demonstration trial design requires each group to have a cultivation area ≥1000m². 2 (Repeated cultivation for 3 years), according to the field cultivation calculation standard, 320 bags of seed are used per mu (approximately 0.067 hectares), with bag dimensions of (14-15) cm × (28-30) cm × 0.05 cm, and 0.5 bags of seed are sown per square meter. Each experimental group is 1000 m². 2 Five hundred bags of spawn were used in three demonstration bases, with repeated cultivation for three years. Four thousand bags of morel strain ZY-1 spawn were also used. Seven Sister K was used as a control in the experiment. The same culture medium and substrate were used for the spawn and exogenous nutrient bags in each experimental group to ensure the same amount of inoculum and consistent cultivation management techniques.

[0119] 2. Demonstration Site Selection Fengming Village, Yongbei Town, Yongsheng County, Lijiang City; Shuhe Village, Shitou Township, Yulong County, Lijiang City; and Haba Village, Sanba Township, Shangri-La City.

[0120] 3. Selection of cultivation site The land for the research base is characterized by loose, well-drained soil, flat terrain, proximity to a clean water source, and good drainage. It also allows for large-scale mechanized operations (land tilling and ditching), and there are no large-scale livestock farms or other sources of pollution discharge nearby.

[0121] 4. Observation and Measurement Items Different groups at the demonstration site conducted separate surveys and data collection. The main observations focused on the key characteristics of the tested strains, and yield was recorded. Yields were also tallied after harvest. Simultaneously, a qualified testing company was commissioned to determine the content of major nutrients.

[0122] 5. Results and Analysis The fruiting results of the demonstration cultivation are shown in the figure. Figure 13 , 14 See Tables 7, 8, 9, and 10.

[0123] Table 7. Demonstration yield and main agronomic traits of Morel strain ZY-1 Note: Yield measurement was conducted at 5 points (each sampling point was 2m). 2 The sampling method was used to sample and measure the yield of each group; for the characteristics of the fruiting bodies, 30 fruiting bodies were randomly selected from each group for measurement and the average value was calculated.

[0124] Table 8. Yield and cultivation cycle of Morchella strain ZY-1 after multiple cultivations Table 9. Yield and main agronomic traits of the CK demonstration class. Note: Yield measurement was conducted at 5 points (each sampling point was 2m). 2 The sampling method was used to sample and measure the yield of each group; for the characteristics of the fruiting bodies, 30 fruiting bodies were randomly selected from each group for measurement and the average value was calculated.

[0125] Table 10 Yield and Cycle of Multiple Cultivation in CK Demonstration results from 2022 to 2024 across multiple locations showed that, compared to the control variety CK, the morel strain ZY-1 produced larger ascocarps with thicker caps and significantly higher yields. The ascocarps were pagoda-shaped, with an average cap length of 7.48 cm and an average maximum width of 4.02 cm; the control variety had conical ascocarps, with an average cap length of 6.56 cm and an average maximum width of 3.28 cm. At the cultivation base in Fengming Village, Yongbei Town, Yongsheng County, Lijiang City, the average fresh yield of morel strain ZY-1 was 316.49 kg / mu, while the control variety yielded 255.23 kg / mu. At the cultivation base in Shuhe Village, Shitou Township, Yulong County, Lijiang City, the average fresh yield was 311.53 kg / mu, while the control variety yielded 256.41 kg / mu. At the cultivation base in Haba Village, Sanba Township, Shangri-La City, the average fresh yield was 317.61 kg / mu, while the control variety yielded 314.91 kg / mu. The average cultivation period for morel strain ZY-1 was 110 days, while the average cultivation period for the control strain "Qimei K" was 115 days.

[0126] The results showed that, compared with the control strain CK, the morel strain ZY-1 had denser colonies, a lighter color, more uniform growth rate, larger sclerotia, and better mycelial viability and longer lifespan. The ascocarps were large, with a longer cap-to-stem ratio, a brownish color, and good commercial quality. Yield was significantly increased. Cultivation results were good in three demonstration bases in Yunnan Province, and it performed excellently in large-scale cultivation, with an average yield of 315.21 kg of fresh mushrooms per mu (approximately 0.067 hectares), and a maximum yield of 324.18 kg per mu. In the cultivation demonstration, morel strain ZY-1 exhibited uniform fruiting, high yield, good consistency and stability, and has high application value and a promising market prospect.

[0127] Specificity: Morel strain ZY-1 has larger fruiting bodies than the control. The cap is large, conical to oval, with an average length of 6.78 cm and an average width of 4.02 cm. The surface has honeycomb-like depressions, and is dark brown or yellowish-brown, with the edge connected to the stipe. The stipe is stout, cylindrical, white to light gray, smooth or longitudinally striationed, hollow, with an average length of 3.57 cm and an average width of 3.18 cm. The flesh is white and crisp. The hymenium is borne in the depressions of the cap. The spores are elliptical, colorless, and the spore print is white. The entire fruiting body is hollow and has a pleasant aroma. It grows singly or in groups in humus-rich woodlands in spring, and the honeycomb-like cap is its typical characteristic. Compared with the control strain CK, morel strain ZY-1 has denser colonies, a lighter color, more uniform colony growth rate, larger sclerotia, and better mycelial viability and longer lifespan. The *Ascomycota* mushroom is large, with a long cap-to-stem ratio, and a brownish-red color. After harvesting, the cap is not easily broken (does not shed debris), resulting in good commercial quality. Yield increases are significant; cultivation results were good in three demonstration bases in Yunnan Province, and it performs excellently in large-scale cultivation, with an average yield of 315.21 kg of fresh mushrooms per mu (approximately 0.067 hectares), and a maximum yield of 324.18 kg per mu. In cultivation demonstrations, the *Morchella* strain ZY-1 exhibited uniform fruiting, high yield, good consistency and stability, and has high application value and a promising market prospect. Using four pairs of SSR primers (Zhongyuan 1 SSR-01, Zhongyuan 1 SSR-02, Zhongyuan 1 SSR-03, and Zhongyuan 1 SSR-04), *Morchella* strain ZY-1 can be distinguished from the control "Qimei K".

[0128] Consistency: Through years of multi-location cultivation demonstration observations, the morel strain ZY-1 exhibits consistency.

[0129] Stability: Morel strain ZY-1 exhibits uniformity and is, in principle, stable.

[0130] 10. High-temperature and low-temperature resistance identification and Aspergillus oryzae resistance identification Determination of mycelial growth rate at high and low temperatures: Morel strain ZY-1 and control "Qimei K" grown on PDA culture dishes were perforated with a 0.5 cm punch and placed on new PDA culture dishes for a temperature gradient growth experiment. Eight culture temperatures were set: 5℃, 10℃, 15℃, 20℃, 25℃, 30℃, and 35℃, with three replicates for each temperature. The growth rate was measured after a certain period of cultivation.

[0131] Method for detecting Aspergillus oryzae resistance: First, morel strain ZY-1, control "Seven Sisters K", and Cladosporium, grown on PDA culture dishes, were perforated using a 0.5 cm diameter punch. Then, they were placed on new PDA culture dishes, with the morel strain on one side and the mold inoculated on the other. Each resistance experiment was performed in triplicate, and growth was observed after a set time.

[0132] Table 11. Mycelial growth rate of Morel strains ZY-1 and "Seven Sisters K" (unit: cm / d) Results of low temperature resistance test: As shown in Table 11, after culturing for 3 days at temperatures of 5℃, 10℃, 15℃ and 20℃, the mycelial growth rate of morel strain ZY-1 was slightly faster than that of the control "Qimei K", and the mycelium was denser overall. The results indicate that morel strain ZY-1 and "Qimei K" have the same growth pattern under low temperature conditions, with little difference in growth rate, and morel strain ZY-1 is more likely to germinate at low temperatures.

[0133] Table 12. Mycelial growth rate of Morel strains ZY-1 and "Seven Sisters K" (unit: cm / d) Results of high temperature resistance test: As shown in Table 12, after culturing for 3 days at temperatures of 25℃, 30℃, and 35℃, the mycelial growth rate of morel strain ZY-1 was generally faster than that of the control "Qimei K". As the temperature increased, the mycelial growth slowed down significantly and even stopped. At temperatures of 25℃ and 35℃, morel strain ZY-1 had a faster mycelial growth rate than "Qimei K". As the temperature increased, the growth rate of both strains slowed down significantly, and the growth trends were consistent. At 35℃, morel strains ZY-1 and "Qimei K" began to show abnormal growth, and the mycelial growth slowed down.

[0134] Based on the results of the low-temperature resistance test, it can be found that the optimal temperature for mycelial culture of morel strain ZY-1 and the control strain "Qimei K" is between 20℃ and 25℃. Therefore, both morel strain ZY-1 and "Qimei K" are medium- and low-temperature fungi, and the results of the low-temperature resistance test are consistent. Morel strain ZY-1 has a wider temperature range than "Qimei K" and is suitable for wider promotion and cultivation under more temperature conditions.

[0135] Table 13. Inhibition rates of Morel strains ZY-1 and "Qimei K" against Aspergillus oryzae. Results: Table 13 shows that in the morel mushroom antibacterial test against Aspergillus oryzae, the inhibition rate of morel mushroom strain ZY-1 was higher than that of the control strain "Qimei K", indicating that morel mushroom strain ZY-1 has stronger resistance to contamination. It exhibits low contamination rate in seed production, rapid feeding speed, and is less susceptible to contamination by other microorganisms, demonstrating strong resistance to contamination. Furthermore, in multiple batches of cultivation trials, it showed low rates of contamination and pest / disease occurrence. Therefore, the experiment concludes that morel mushroom strain ZY-1 has strong disease resistance.

[0136] Morel mushroom strain ZY-1 exhibits strong mycelial growth, rapid germination, and a fast growth rate. It shows a higher inhibition rate against Aspergillus oryzae than the control strain "Qimei K," demonstrating strong resistance to adverse conditions. The mycelium can grow normally between 5-35℃. When cultured for 3 days at temperatures of 5-25℃ and 35℃, the mycelial growth rate of morel mushroom strain ZY-1 is faster and the mycelium is denser than that of the control strain "Qimei K."

[0137] XI. Morphological Observation of Fruiting Entities Morphological observation of the fruiting body, such as Figure 15 As shown.

[0138] XII. Quality Analysis Report of Morel Strain ZY-1 Statistical analysis of nutrients and functional components of morel strain ZY-1 and control "Seven Sisters K": Table 14. Statistical table of components of morel strain ZY-1 and control "Seven Sisters K". Note: *Essential amino acids Morel mushroom strains ZY-1 and "Qimei K" fruiting bodies, cultivated and matured in 2024, were dried and sent to the Guangdong Provincial Center for Microbiology Analysis and Testing for analysis. Table 14 shows that the calcium content of morel mushroom strain ZY-1 was 2.61 × 10⁻⁶. 3 The iron content of morel strain ZY-1 was 133 mg / kg, which was higher than that of "Qimei K" (747 mg / kg). The zinc content of morel strain ZY-1 was 100 mg / kg, which was higher than that of "Qimei K" (58.1 mg / kg). The differences in amino acid content, protein, fat, ash content, and crude fiber content were not significant.

[0139] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A morel strain ZY-1, characterized in that, It was deposited at the Guangdong Provincial Center for Microbial Culture Collection, China on April 11, 2023, with accession number GDMCC No: 63340.

2. The method for artificially cultivating morel strain ZY-1 according to claim 1, characterized in that, Includes the following steps: Step (1), strain preparation: The mother strain obtained from the morel tissue isolation is revitalized with the mother strain culture medium and then inoculated into the original strain culture bottle for expansion culture. After the mycelium has filled the culture bottle, the original strain is transferred to the cultivation container for culture. After the mycelium has filled the cultivation container, the cultivation is finally transferred into the cultivation bag and cultured until the mycelium has filled the bag. Step (2), cultivation management: transport the cultivation bags obtained in step (1) to the cultivation site and carry out ridge planting; Step (3), harvesting fruiting bodies: Harvest when the fruiting bodies have grown to maturity and the cap ridges and pits are clearly defined; The mother culture medium comprises the following raw materials by weight: 199-201 parts potato, 19-21 parts glucose, 17-19 parts agar, 1.9-2.1 parts yeast powder, 0.19-0.21 parts magnesium sulfate, 990-1010 parts distilled water, and a pH of 6.5-7.

5. The original culture medium in the original culture bottle includes the following raw materials by weight: 74-76 parts wheat, 9.8-10.2 parts humus, 7.8-8.2 parts wheat bran, 4.9-5.1 parts biomass raw material, 0.9-1.1 parts lime, and 0.9-1.1 parts gypsum; the biomass raw material is sawdust or rice husk. The culture medium in the cultivation bag includes the following raw materials by weight: 64-66 parts wheat, 14-16 parts biomass raw material, 7.7-8.3 parts wheat bran, 9.5-10.5 parts humus, 0.9-1.1 parts lime, and 0.9-1.1 parts gypsum; the biomass raw material is cottonseed hulls, sawdust, rice hulls, or corn cobs.

3. The method for artificially cultivating morel strain ZY-1 according to claim 2, characterized in that, The mother culture medium comprises the following raw materials by weight: 200 parts potato, 20 parts glucose, 18 parts agar, 2 parts yeast powder, 0.2 parts magnesium sulfate, and 1000 parts distilled water; The original culture medium in the original culture bottle includes the following raw materials by weight: 75 parts wheat, 10 parts humus, 8 parts wheat bran, 5 parts biomass raw material, 1 part lime, and 1 part gypsum; the biomass raw material is sawdust or rice husk. The culture medium in the cultivation bag includes the following raw materials by weight: 65 parts wheat, 15 parts biomass raw material, 8 parts wheat bran, 10 parts humus, 1 part lime, and 1 part gypsum; the biomass raw material is cottonseed hulls, sawdust, rice hulls, or corn cobs.

4. The method for artificially cultivating morel strain ZY-1 according to claim 2, characterized in that, When the mother culture is rejuvenated using the mother culture medium, the culture temperature is 24℃; The culture temperature for scaling up the original culture in the culture flask was 21℃; When the original seed is transferred to the cultivar container for cultivation, and when the cultivar is transferred to the cultivation bag for cultivation, the cultivation temperature is 21℃.

5. The method for artificial cultivation of morel strain ZY-1 according to claim 2, characterized in that, In step (2), cultivation is selected from March to May or September to November. The cultivation site is selected from low-altitude plains to 3500 meters above sea level with sandy loam soil rich in humus. A shade shed is built using 4-6 needle shade nets with a shade rate of 85%-95%. Before sowing, the soil moisture is adjusted to 22-25% and the maximum temperature is 15-16℃.

6. The method for artificially cultivating morel strain ZY-1 according to claim 2, characterized in that, Temperature and humidity should be controlled in stages during the fruiting period: During the primordia formation period, the greenhouse temperature should be controlled at 15-20℃ and the soil temperature at 7-12℃. During the primordium differentiation period, the controlled temperature is 10-22℃ and the humidity is 90-95%. During the young mushroom stage, the temperature should be controlled at 10-22℃ and the humidity at 85-90%. During the mushroom maturation stage, the temperature should be controlled at 8-24℃ and the humidity at 80-85%. During the fruiting period, the mushrooms need 500-1000 lux of diffused light and 2-3 hours of ventilation per day.

7. The method for artificially cultivating morel strain ZY-1 according to claim 2, characterized in that, Harvest the fruiting bodies when they are mature, and then clean up any remaining mushrooms and replenish the water to promote the next flush of fruiting.

8. A primer set for identifying the morel strain ZY-1 according to claim 1, characterized in that: The primer set includes SSR-01 primer pair, SSR-02 primer pair, SSR-03 primer pair and SSR-04 primer pair; The sequences of the SSR-01 primer pair are as follows: SSR-01-F:ggactgtgcagtggttggta; SSR-01-R:cttgactccacacttctccca; The sequences of the SSR-02 primer pair are as follows: SSR-02-F:gagtacacgggcctctcaag; SSR-02-R: acatacatacaggcaggcgg; The sequences of the SSR-03 primer pair are as follows: SSR-03-F:tgccgggtggaggagataat; SSR-03-R:gatggagctgcgagaggatg; The sequences of the SSR-04 primer pair are as follows: SSR-04-F:tcctccaagaaccgcttacg; SSR-04-R: gcgaggagatggagaggac.

9. A kit containing the primer set for identifying Morel strain ZY-1 as described in claim 8.

10. The use of the primer set for identifying Morel strain ZY-1 as described in claim 8 or the kit as described in claim 9 in identifying Morel strain ZY-1.

Images