Gene for controlling germination rate and starch content of corn seeds and application thereof

Abstract

The invention discloses an application of corn genes in controlling the germination rate of seeds, by editing corn ZmEIL1 and ZmEIL3 genes, the regulation effect of the ZmEIL1 and ZmEIL3 genes on the germination rate of the corn seeds and the starch content is determined, the ZmEIL1 gene can regulate the germination rate of the corn seeds, and the ZmEIL3 gene can regulate the germination rate of the corn seeds and the starch content of the corn seeds. The method can be used for improving corn seed germination rate and starch content related characters and cultivating new corn varieties with different germination rates and starch contents.

Description

Technical Field

[0001] This invention relates to genes that control the germination rate and starch content of maize seeds and their applications, belonging to the field of molecular genetics. Background Technology

[0002] Among the inputs in corn production, seeds are the most basic, effective, and unique production material, directly impacting the economic interests of producers, operators, and users. Of the many indicators for measuring seed quality, germination rate is the most direct and effective evaluation standard, crucial for seed acquisition, storage, and transportation, and also serving as the basis for determining planting quantities in the field. In my country's agricultural production, there are almost annual cases of reduced corn yields due to low seed germination rates. In recent years, large multinational seed companies such as Pioneer and Syngenta have entered the Chinese market. Besides their brand advantages, their corn seeds also possess high germination rates and the ability to be sown individually, a major reason for their rapid market dominance. Therefore, improving seed germination rates and cultivating new corn varieties suitable for single-seed sowing are urgent issues that need to be addressed to enhance my country's corn seed industry's competitiveness in both international and domestic markets, and are of great significance to ensuring my country's food security.

[0003] Although seed germination rate is the result of both environmental and genetic factors, its inherent genetic characteristics are the main reason for differences in germination rates among different varieties. The strength of seed germination ability is the key factor determining germination rate. Therefore, elucidating the relationship between maize seed germination-related genes and germination rate, and discovering superior genes that influence maize germination characteristics, are effective ways to breed new maize varieties with high germination rates and ensure seed quality. Thus, utilizing existing germplasm resources to discover superior genes related to maize germination rate is of great significance for regulating maize seed germination traits and breeding new maize varieties. Summary of the Invention

[0004] In response to at least one defect or improvement need in the prior art, the inventors of this invention have identified genes in maize that affect the germination rate and starch content traits of maize seeds, which can be used to breed new maize varieties.

[0005] To achieve the above objectives, according to one aspect of the present invention, an application of a maize gene in controlling seed germination rate is provided, the gene nucleotide sequence of which is as follows:

[0006] (I) As shown in SEQ ID NO.1 or SEQ ID NO.2; or

[0007] (II) and (I) have the same nucleotide sequence encoding the same protein, but the nucleotide sequence is different from that of (I) due to the degeneracy of genetic coding.

[0008] According to a second aspect of the present invention, an application of a maize gene in controlling seed starch content is provided, the gene nucleotide sequence of which is as follows:

[0009] (Ⅰ) As shown in SEQ ID NO.2; or

[0010] (II) and (I) have the same nucleotide sequence encoding the same protein, but the nucleotide sequence is different from that of (I) due to the degeneracy of genetic coding.

[0011] According to a third aspect of the present invention, a biological material is provided, comprising the nucleotide sequence as described in claim 1 or 2, wherein the biological material is one or more of a recombinant expression vector, plasmid, expression cassette, or recombinant bacteria.

[0012] According to a fourth aspect of the present invention, a gene knockout vector is provided, the vector having a pCXB053 plasmid as a backbone and containing target sequences as shown in SEQ ID NO.3 to SEQ ID NO.4, or SEQ ID NO.6 to SEQ ID NO.7.

[0013] According to a fifth aspect of the invention, a host is provided, the host cell containing the above-described vector, the host comprising any one of Escherichia coli, Agrobacterium tumefaciens, or a non-renewable plant part.

[0014] According to a sixth aspect of the present invention, a kit for regulating the germination rate of maize seeds is provided, comprising Cas9 protein and any of the following RNA molecules:

[0015] (1) RNA molecules capable of recognizing target sequences of SEQ ID NO.3–SEQ ID NO.4 or SEQ ID NO.6–SEQ ID NO.7.

[0016] (2) The DNA molecule encoding the RNA described in (1);

[0017] (3) Vectors that express the RNA described in (1).

[0018] According to a seventh aspect of the present invention, a kit for regulating starch content in maize seeds is provided, comprising Cas9 protein and any of the following RNA molecules:

[0019] (1) An RNA molecule capable of recognizing the gene sequence of SEQ ID NO.2; optionally, the sequence of the RNA molecule is shown in SEQ ID NO.6 to SEQ ID NO.7;

[0020] (2) The DNA molecule encoding the RNA described in (1);

[0021] (3) Vectors that express the RNA described in (1).

[0022] According to an eighth aspect of the present invention, a method for regulating the germination rate or starch content of maize seeds is provided, comprising modifying the nucleotide sequence as described in claim 1 or 2 using gene editing technology; or expressing the nucleotide sequence as described in claim 1 or 2 in wild-type maize, wherein the target sequence used in the gene editing technology is shown in SEQ ID NO. 3 to SEQ ID NO. 4 or SEQ ID NO. 6 to SEQ ID NO. 7.

[0023] Preferably, the method includes the step of introducing the nucleotide sequence of claim 1 or 2 into a plant cell, plant seed, plant tissue, plant part or plant, wherein the plant is maize.

[0024] In summary, compared with the prior art, the above-described technical solutions conceived by this invention can achieve the following beneficial effects:

[0025] The ZmEIL1 and ZmEIL3 genes provided by this invention affect the germination rate and starch content of maize seeds. By constructing expression vectors with ZmEIL1 and ZmEIL3 gene knockouts and measuring seed germination rate and starch content, it was found that knockout of ZmEIL1 and ZmEIL3 genes significantly reduced the germination rate of maize. In addition, knockout of ZmEIL3 gene also reduced the starch content of maize seeds. This indicates that the ZmEIL1 gene can regulate the germination rate of maize seeds, while the ZmEIL3 gene can regulate both the germination rate and starch content of maize seeds. These genes can be used to improve the correlation between germination rate and starch content in maize seeds and to cultivate new maize varieties with different germination rates and starch contents. Attached Figure Description

[0026] Figure 1 This is a graph showing the germination rate results of ZmEIL1 and ZmEIL3 knockout lines and corresponding wild-type maize seeds provided in this embodiment of the invention.

[0027] Figure 2 This is a graph showing the starch content results of ZmEIL1 and ZmEIL3 knockout lines and corresponding wild-type maize seeds provided in the embodiments of the present invention; Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Furthermore, the technical features involved in the various embodiments of this invention described below can be combined with each other as long as they do not conflict with each other.

[0029] It should be noted that any aspects of this invention not described in detail are well known to those skilled in the art. Experimental methods not specifically described in the following examples are generally performed under conventional conditions or as recommended by the manufacturer. Experimental steps not described in detail are based on references to *Molecular Cloning: A Laboratory Manual* (edited by Michael R. Green and Joseph Sambrook, 4th edition), pathophysiological experiments, online databases, etc.

[0030] The maize inbred line KN5585 is an inbred line bred by Weimi Biotechnology (Jiangsu) Co., Ltd.

[0031] This method mainly includes the following steps:

[0032] 1. Construct a ZmEIL1 gene knockout target vector;

[0033] 2. The above carrier was transferred into corn KN5585;

[0034] 3. Positive seedlings obtained through genetic transformation are planted in the field and carefully managed for harvesting;

[0035] 4. Detect gene editing type in T1 generation seedling DNA. Screen for homozygous gene-edited mutants that meet the expected criteria.

[0036] The steps above will be explained in detail below.

[0037] Example 1: Construction of gene knockout vectors for ZmEIL1 and ZmEIL3

[0038] (1) Design of ZmEIL1 and ZmEIL3 target sequences

[0039] The gene sequences of ZmEIL1 and ZmEIL3 (gene numbers Zm00001d047563 and Zm00001d028974) from the KN5585 receptor inbred line were compared and downloaded from the website https: / / db.cngb.org / zeamap / tools / blast. Target sites were designed based on the ZmEIL1 and ZmEIL3 genes respectively. The target sequence was obtained using the online target sequence design tool CRISPR-P v2.0 (hzau.edu.cn). BsaI restriction sites were added to both ends of the sequence while synthesizing the DNA double strand.

[0040] The target sequences of ZmEIL1 are shown in SEQ ID NO.3 and SEQ ID NO.4; the target sequences of ZmEIL3 are shown in SEQ ID NO.6 and SEQ ID NO.7.

[0041] ZmEIL1 and ZmEIL3 gene knockout vectors were constructed using conventional CRISPR / Cas9 plasmid construction methods.

[0042] (3) Transform the knockout vector into maize KN5585

[0043] 1. Plasmid vector transformation of Agrobacterium

[0044] The gene knockout vector was transferred into Agrobacterium EHA105 by electroporation. Single clones were selected, cultured in bacterial culture, identified by PCR, and stored at -20°C for later use.

[0045] 2. Activation of microbial strains

[0046] Remove Agrobacterium from the refrigerator and streak it onto YEP solid medium.

[0047] 3. Prepare Agrobacterium infection solution

[0048] Fresh spores were scraped from the newly activated bacterial plate and resuspended in the infection solution.

[0049] 4. Take corn embryos

[0050] Peel off the immature embryos of maize inbred line KN5585, which are about 1 mm thick. Take about 150 peeled immature maize embryos and put them into 2 mL plastic centrifuge tubes containing 1.8 mL of suspension (infection medium containing AS, but without Agrobacterium) and process for 30 min.

[0051] 5. Infection

[0052] Remove the suspension from (4), leaving the corn embryo in the tube. Then add 1.0 mL of Agrobacterium infection solution, gently invert 10-15 times, and let stand for 5-10 minutes. Take a clean petri dish, place 3 sheets of sterile filter paper on it, and after infection, invert it a few times to quickly pour the bacterial solution onto the filter paper. Hold the petri dish and change its direction to ensure that the bacterial solution carrying the embryo is evenly distributed on the filter paper.

[0053] 6. Co-cultivation

[0054] When the bacterial culture is no longer visible on the top layer of filter paper, use tweezers to pick up the top layer of filter paper and place the side with the embryo on the co-culture medium. Use tweezers to remove the air bubbles between the filter paper and the culture medium, then use tweezers to hold a corner of the filter paper and quickly peel it off. Transfer the embryo left on the filter paper to the culture medium with the embryo shield side facing up, and incubate in the dark at 23°C for 3 days.

[0055] 7. Restore culture

[0056] After co-culturing for 3 days, the embryos were transferred to resting medium and cultured in the dark at 28°C for 6 days. Then, they were placed on selection medium containing 5 mg / L Bialaphos for 2 weeks of selection culture, and then transferred to selection medium containing 8 mg / L Bialaphos for 2 weeks of selection culture.

[0057] 8. Differentiation culture

[0058] The resistant callus was transferred to differentiation medium 1 and cultured at 25°C, 5000 lx, under light for 1 week. The callus was then transferred to differentiation medium 2 and cultured under light for 2 weeks. The differentiated seedlings were transferred to rooting medium and cultured at 25°C, 5000 lx, under light until rooting occurred. The seedlings were then transferred to small pots for further growth. After a certain growth stage, they were transplanted into a greenhouse, and the offspring seeds were harvested after 3-4 months.

[0059] (4) After screening and transforming positive seedlings, plant them in the field for harvesting.

[0060] Genotyping of the knockout lines was performed using PCR and sequencing to identify mutant plants. The PCR primers are shown in Table 1. Knockout lines with homozygous mutations were selected for maize seed germination rate analysis and field trials.

[0061] Table 1 Primers for PCR identification of positive seedlings

[0062] EIL1-F GAACTCGGCATTCCCAAGGA EIL1-R CGTCCATCTGGATCCTCTGC EIL3-F GACAGCGATGACGACGTT EIL3-R CTTGTCACTTAGGATAGCC

[0063] Example 2: Effects of ZmEIL1 and ZmEIL3 on the germination rate of maize seeds

[0064] Seeds from the ZmEIL1 and ZmEIL3 knockout lines, as well as the corresponding wild-type maize, were germinated on moist paper in 13cm × 13cm petri dishes for seed germination rate determination. Seeds were grown in a plant growth chamber at 26°C and 70% relative humidity, with a photoperiod of 16 hours light (10,000 lux) / 8 hours dark. Germination was considered complete when root length was >2 mm. The number of germinated seeds was counted 88 hours after sowing. Each genotype contained 24 seeds per bioreplica, and three replicates were performed.

[0065] Figure 1 The graph shows the germination rates of ZmEIL1 and ZmEIL3 knockout lines and their corresponding wild-type maize seeds, as shown below. Figure 1 As shown, compared with wild-type maize seeds, knockout of both ZmEIL1 and ZmEIL3 significantly reduced the germination rate of maize seeds, indicating that both ZmEIL1 and ZmEIL3 genes can regulate the germination rate of maize seeds.

[0066] Example 3: Effects of ZmEIL1 and ZmEIL3 on starch content in maize seeds

[0067] ZmEIL1 and ZmEIL3 knockout lines and their corresponding wild-type maize seeds were thoroughly dried and ground into powder. Approximately 0.02 g was weighed into a test tube and the weight recorded. Then, 1 mL of anhydrous diethyl ether was added, the mixture was shaken thoroughly, and centrifuged at 8000 g for 10 minutes at room temperature, discarding the supernatant. Next, 1 mL of 80% ethanol was added to the precipitate and shaken well. The mixture was incubated in a water bath at 80°C for 30 minutes, then centrifuged at 8000 g for 10 minutes at room temperature, and the supernatant was discarded. Then, 0.5 mL of ultrapure water was added to the precipitate, and the mixture was boiled in a water bath for 15 minutes to allow complete gelation. After cooling, 0.5 mL of 6 mol / L hydrochloric acid was added, and the mixture was heated at 95°C for 30 minutes, then centrifuged at 8000 g for 10 minutes at room temperature, and the supernatant was collected for measurement. After dilution with ultrapure water, 50 μL of the supernatant was placed in a 1.5 mL test tube. 250 μL of anthrone reagent was added and mixed thoroughly, then incubated in a 95°C water bath for 10 minutes. After cooling to room temperature, absorption at 620 nm was detected. The starch content of the grains was determined by Wuhan Punes Biotechnology Co., Ltd.

[0068] Figure 2 The graph shows the starch content results of ZmEIL1 and ZmEIL3 knockout lines and their corresponding wild-type maize seeds, as shown below. Figure 2 As shown, compared with wild-type maize seeds, the starch content of maize seeds did not change significantly after ZmEIL1 knockout, while the starch content of maize seeds decreased significantly after ZmEIL3 knockout, indicating that the ZmEIL3 gene has a regulatory effect on the starch content of maize seeds.

[0069] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

[0070] Those skilled in the art will readily understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0071] SEQ ID NO.1

[0072]

[0073] SEQ ID NO.2

[0074]

[0075] SEQ ID NO.3

[0076] UGGACUGGCGAACCAGGCGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu

[0077] SEQ ID NO.4

[0078] CCGUAGCUGUAGUCACUGCGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu

[0079] SEQ ID NO.5

[0080]

[0081] SEQ ID NO.6

[0082] GAGCUGCAGGACACCACACUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu

[0083] SEQ ID NO.7

[0084] UCAUGGGGCUUCUUGUAGGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu

[0085] SEQ ID NO.8

[0086]

Claims

1. The application of maize genes in controlling seed germination rate, characterized in that, The gene nucleotide sequence is as follows: (I) As shown in SEQ ID NO.1 or SEQ ID NO.2; or (II) and (I) have the same nucleotide sequence encoding the same protein, but the nucleotide sequence is different from that of (I) due to the degeneracy of genetic coding.

2. The application of maize genes in controlling seed starch content, characterized in that, The gene nucleotide sequence is as follows: (Ⅰ) As shown in SEQ ID NO.2; or (II) and (I) have the same nucleotide sequence encoding the same protein, but the nucleotide sequence is different from that of (I) due to the degeneracy of genetic coding.

3. A biomaterial, characterized in that, Includes the nucleotide sequence as described in claim 1 or 2, wherein the biological material is one or more of a recombinant expression vector, plasmid, expression cassette, or recombinant bacteria.

4. A gene knockout vector, characterized in that, The vector uses pCXB053 plasmid as a backbone and contains target sequences as shown in SEQ ID NO.3 to SEQ ID NO.4, or SEQ ID NO.6 to SEQ ID NO.

7.

5. A host, wherein the host cell contains the vector of claim 3, wherein the host comprises any one of Escherichia coli, Agrobacterium tumefaciens, or a non-renewable plant part.

6. A kit for regulating the germination rate of maize seeds, characterized in that: Including the Cas9 protein and any of the following RNA molecules: (1) RNA molecules capable of recognizing the target sequences shown in SEQ ID NO.3~SEQ ID NO.4, or SEQ ID NO.6~SEQ ID NO.7; (2) The DNA molecule encoding the RNA described in (1); (3) Vectors that express the RNA described in (1).

7. A reagent kit for regulating starch content in corn seeds, characterized in that: Including the Cas9 protein and any of the following RNA molecules: (1) It can recognize RNA molecules of SEQ ID NO.6 to SEQ ID NO.7; (2) The DNA molecule encoding the RNA described in (1); (3) Vectors that express the RNA described in (1).

8. A method for regulating the germination rate or starch content of corn seeds, characterized in that, This includes modifying the nucleotide sequence as described in claim 1 or 2 using gene editing technology; or expressing the nucleotide sequence as described in claim 1 or 2 in wild-type maize, wherein the target sequence used in the gene editing technology is shown in SEQ ID NO. 3 to SEQ ID NO.

8.

9. The method as described in any one of claims 7 or 8, characterized in that, The method includes the step of introducing the nucleotide sequence of claim 1 or 2 into a plant cell, plant seed, plant tissue, plant part or plant, wherein the plant is maize.

10. A mutant gene, characterized in that: The nucleic acid sequence of the mutated gene is shown in either SEQ ID NO.5 or SEQ ID NO.8.

Images