Efficient screening method for genetic transformation of plant gene editing mutants

Abstract

A Cas9 gene editing vector containing a double-resistant gene is constructed based on a P2A self-cleavage peptide, a first resistant gene is connected to a C terminal of a Cas9 protein to realize synchronous expression of Cas9 and a selection marker protein, a first screening agent is correspondingly used to realize efficient enrichment of Cas9 expression transformation seedlings, and a second screening agent is used to avoid escape mutation caused by long-term single screening. The genetic transformation efficiency level is stable while the gene editing efficiency is remarkably improved, so that mutant plants for effective gene editing are generated and screened at high efficiency and low cost.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic transformation of plant gene editing organisms, in particular to a high-efficiency screening method for genetic transformation of plant gene editing mutants. BACKGROUND

[0002] The CRISPR / Cas9 system is a revolutionary gene editing technology, originally derived from the natural immune defense mechanism of bacteria and archaea, and has been widely used in the research of genomes of animals and plants in recent years. The efficient editing of genomes in different plants is limited by the efficiency of genetic transformation and gene editing. Legume plants such as soybean have low transformation efficiency, making it difficult to obtain enough transformed seedlings to screen for gene editing mutant plants. The efficiency of gene editing based on the CRISPR / Cas9 system is usually determined by the expression levels of two components, i.e., single-guide RNA (sgRNA) that recognizes and matches the target DNA and Cas9 endonuclease that cuts the target DNA. For example, it is difficult to achieve effective gene editing in Cucurbitaceae plants such as watermelon and melon, which is limited by the low expression of common editing vectors in these plants. In addition, in polyploid plants such as cultivated tobacco, rape, and cotton, simultaneous editing of multiple alleles is often required, which also requires more expression of sgRNA and Cas9. These factors increase the workload of genetic transformation screening and the cost of editing detection. Therefore, developing a high-efficiency and easy-to-transform gene editing method is very important for achieving gene editing in plants.

[0003] Currently, the pRGEB32 (Xie et al., 2015, Proc Natl Acad Sci U S A 112(11):3570-5) modified pRGEB32B0 to B11 (referred to as p32B0 to B11) series of vectors (Chen et al., 2022, Molecular plant 15(2): 243-257) and pRGEB32-GhU6.7 (referred to as p7N) (Zhu et al., 2023, Genome Biology 24(1): 194) are widely used in rice and cotton gene editing research, respectively. These two vectors contain hpt genes, nptll genes, and using the corresponding screening agents hygromycin and kanamycin for screening can achieve an editing efficiency of about 90% for the target genes in rice and cotton, but there are still a few genes that are difficult to achieve high-efficiency gene editing due to their location in relatively closed heterochromatin or other locations. Increasing the expression of Cas9 in cells may overcome the chromatin barrier by prolonging the window of its action.

[0004] pKSE401 (containing nptll gene) and pBSE401 (containing bar gene) vectors (Xing et al., 2014, BMC Plant Biology, 14: 1-12) have been used in many dicotyledonous plants, but the editing efficiency in different plants is high or low. For example, the editing efficiency in oilseed rape is an average of 65.3% (Yang et al., 2017, Scientific reports, 7(1), 7489), in tobacco is 43.8%-90.6% (Liu Quanqing et al., Gene editing system and its application in high-efficiency editing of plant genes: 202411707815.3 [P]. 2025-01-28), in tomato is 46.67% (Liu et al., 2021, Molecular Breeding, 41: 1-12), in watermelon is about 13% (Zhang et al., 2019, Plant Journal 101(2), 265-277), but in melon, no effective editing event has been detected (Wang et al., 2024, Cells 13(21): 1782). The reason may be that different transformation efficiencies result in this, among which melon has the lowest transformation efficiency and is the most difficult to obtain gene editing plants. Similarly, the transformation efficiency in soybean mediated by Agrobacterium has been very low, only 10%. Most soybean genetic transformation uses cotyledon nodes as explants for Agrobacterium-mediated transformation. Since it is an organogenesis pathway, there is also the problem of chimeras in soybean genetic transformation. These have limited the use of pBSE401 vectors to achieve efficient gene editing in soybean (Freitas-Alves et al., 2024, Journal of Advanced Research). Similarly, due to the lack of efficient gene editing vectors and efficient genetic transformation methods, it is also difficult to achieve efficient and stable genome editing in potato, alfalfa, eggplant, pepper, Lotus japonicus, and cauliflower plants.

[0005] It was recently reported (Li et al., 2019, Plant Biotechnology Journal 18(7): 1495) that the use of AcNPV (AcMNPV) derived from the virus of the clear-vein-leaf-roller moth (Clostera anuria) can be used to edit the genome of plants. However, the editing efficiency of this method is still very low, and the editing efficiency of the AcNPV method in soybean is only 0.5% (Li et al., 2019, Plant Biotechnology Journal 18(7): 1495). Thosea asignaThe T2A self-cleaving peptide of the virus forms a co-transcriptional unit ABE-HPT by fusing the hygromycin phosphotransferase (HPT) encoding gene with the ABE, which is composed of the adenine deaminase encoding gene TadA plus SpCas9. A similar strategy has also been used in the CBE system (Zhang et al., 2020, Molecular plant14(2): 191-194), specifically by using porcine cyclosporine virus (CZV). Porcine tescho The P2A self-cleaving peptide of the virus (PTV) fuses the hygromycin phosphotransferase (HPT) encoding gene, the lamprey cytidine deaminase encoding gene pmCDA1, and the SpCas9 variant protein encoding gene SpCas9n to form a CBE-HPT co-transcriptional unit. In the tissue culture process of rice genetic transformation, hygromycin can be used to screen for transformed cells that strongly express ABE or CBE, thereby improving the ABE or CBE base editing efficiency in plant cells. However, it is limited to the field of single base editing and does not mention whether the workload of genetic transformation is increased. Similarly, Xu et al. co-expressed P2A-HPT with the reverse transcriptase encoding gene M-MLV and SpCas9n to form the PE2 guided editing system (Xu et al., 2020, Molecular plant 13(5): 675-678), and then upgraded it to PE3 (Xu et al., 2022, Nature Plants 8(1): 45-52), which achieved an average increase of more than 3 times in guided editing efficiency in maize and rice. However, the efficiency of the guided editing system is still not very stable. Some target sites have high editing efficiency, while others have no editing detected at all. This unstable gene editing is almost unacceptable for some plant species that are difficult to genetically transform.

[0006] While the aforementioned strategies improve editing efficiency to some extent, they have limitations such as narrow application scope, unstable effects, and increased workload in tissue culture. For example, although these strategies can solve the problem of low efficiency in single-base editing and guided editing, they do not address the fact that the genetic transformation tissue culture screening stage may require a larger amount of callus tissue for screening to obtain the expected number of transformation materials.

[0007] Therefore, there is a need in this field for an efficient screening method for genetic transformation of gene-edited mutants applicable to a variety of plants, so as to generate and screen effective gene-edited mutant plants more efficiently and at low cost. Summary of the Invention

[0008] The purpose of this invention is to provide a highly efficient screening method for genetic transformation of plant gene-edited mutants, which solves the shortcomings of existing genetic transformation screening processes, such as low efficiency and unsatisfactory quantity of transformed materials.

[0009] In view of the above, the present application provides the following solutions: The present application provides a high-efficiency screening method for genetic transformation of plant gene editing mutants, comprising the following steps: The P2A self-cleavage peptide is used to construct a Cas9 gene editing vector containing a first resistance gene and a second resistance gene, wherein the first resistance gene is connected to the C-terminal of the Cas9 protein. The Cas9 gene editing vector is transformed into an Agrobacterium strain, which is used to infect plant callus and culture; The first and second resistance screening is performed on the cultured tissue by using a first screening agent and a second screening agent in sequence, and a gene editing positive plant is obtained. The first and second resistance genes are different resistance genes, and correspond to the first and second screening agents, respectively.

[0010] Further, the first resistance gene has a better screening specificity in plants than the second resistance gene.

[0011] Further, the construction method of the Cas9 gene editing vector is that the P2A self-cleavage peptide-first resistance gene fragment is fused to the C-terminal of the Cas9 in the original Cas9 gene editing vector, and the resistance gene in the original Cas9 gene editing vector is replaced or retained as the second resistance gene.

[0012] Further, the first and second screening agents are different screening agents, and each is independently selected from an antibiotic or a herbicide.

[0013] Preferably, the concentration of the first and / or second screening agent is 5-250 mg / L.

[0014] Further, the first and second resistance screening processes each use a basic medium, and a hormone and a corresponding screening agent are added to the basic medium, wherein the basic medium is a commonly used MS, N6, or B5 medium, and the hormone is a commonly used 2,4-D, NAA, IAA, GA, 6-BA, KT, or ZT.

[0015] Further, the second screening and the first screening each account for half of the total screening time.

[0016] Further, the plant is rice, tobacco, rapeseed, tomato, potato, soybean, cotton, alfalfa, eggplant, pepper, watermelon, melon, Lotus japonicus, or cauliflower.

[0017] Further, the plant is rice, and the Cas9 gene editing vector is a p32B0 vector hpt The individual expression frame of the gene is replaced by nptllThe P2A-HPT coding sequence is fused to the C-terminal of the Cas9 to obtain a gene expression frame, the first screening agent is hygromycin, and the second screening agent is G418. Alternatively, the plant is any one of tobacco, rape, tomato or potato, and the Cas9 gene editing vector is reserved by the pKSE401 vector nptll The P2A-HPT coding sequence is fused to the C-terminal of the Cas9 to obtain a gene expression frame, the first screening agent is hygromycin, and the second screening agent is kanamycin. Alternatively, the plant is soybean, and the Cas9 gene editing vector is reserved by the pBSE402 vector bar The P2A-CTP-EPSPS coding sequence is fused to the C-terminal of the Cas9 to obtain a gene expression frame, the first screening agent is glyphosate, and the second screening agent is glufosinate ammonium. Alternatively, the plant is cotton, and the Cas9 gene editing vector is reserved by the p7N vector nptll The P2A-CTP-EPSPS coding sequence is fused to the C-terminal of the Cas9 to obtain a gene expression frame, the first screening agent is glyphosate, and the second screening agent is kanamycin. Alternatively, the plant is any one of alfalfa, eggplant or pepper, and the Cas9 gene editing vector is reserved by the pBSE401 vector bar The P2A-NPTII is fused to the C-terminal of the Cas9 to obtain a gene expression frame, the first screening agent is kanamycin, and the second screening agent is glufosinate ammonium. Alternatively, the plant is any one of watermelon, melon, Lotus japonicus or cauliflower, and the Cas9 gene editing vector is reserved by the pKSE401 vector nptll The P2A-BAR is fused to the C-terminal of the Cas9 to obtain a gene expression frame, the first screening agent is glufosinate ammonium, and the second screening agent is kanamycin.

[0018] Another object of the present application is to provide a method for plant transgenesis, comprising constructing a plant receptor with target gene resistance, and performing genetic transformation screening on the plant receptor; wherein: The screening process comprises transferring the Cas9 gene editing vector into an Agrobacterium strain, infecting the callus of the plant receptor, and culturing, and screening using at least two screening agents; The construction method of the Cas9 gene editing vector is based on the P2A self-cleavage peptide to construct a Cas9 gene editing vector containing at least one resistance marker gene, wherein one resistance marker gene is connected to the C-terminal of the Cas9 protein. The resistance marker gene is different from the target gene with resistance to the plant receptor, the screening agent includes a screening agent corresponding to the target gene with resistance to the plant receptor, and a screening agent corresponding to the resistance marker gene.

[0019] Based on the double-resistance gene editing vector used in the aforementioned genetic transformation screening method of the application, when the plant transformation body receptor containing the target gene resistance is edited again, if the resistance gene does not conflict with the marker gene, the double-resistance gene editing vector can be used for genetic transformation screening; when the resistance gene conflicts with one of the resistance marker genes, the other resistance marker gene can be selected for screening.

[0020] Compared with the prior art, the application has the following beneficial effects: The application constructs a Cas9 gene editing vector containing double-resistance genes based on a P2A self-cleavage peptide, wherein the first resistance gene realizes the synchronous expression of Cas9 and the screening marker protein by being connected to the C-terminal of the Cas9 protein, the first screening agent is used to realize efficient enrichment of Cas9 expression transformation seedlings, and then the second screening agent is used to avoid escape mutations caused by long-term single screening, which significantly improves the gene editing efficiency while ensuring the stable level of genetic transformation efficiency, so as to realize efficient and low-cost generation and screening of mutant plants with effective gene editing.

[0021] In the application, the double-resistance gene editing vector contains two screening genes, so it can also realize gene editing on a plant transformation body receptor with a screening gene, and only needs to use a screening agent different from the screening resistance of the mutant receptor background for tissue culture screening to break through the limitation of the screening resistance of the transformation body background.

[0022] The screening method of the application is suitable for various plants, and can efficiently realize the screening of mutant plants with effective gene editing, has a wide application range, and has important significance for promoting plant genome research and variety breeding. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 Fig. 6 is a schematic diagram of the T-DNA structure of six gene editing transformation vectors prepared in the application.

[0024] Figure 2 Fig. 8 is a schematic diagram of the results of rice gene editing tissue culture materials screened by different antibiotics.

[0025] Figure 3 Fig. 9 is a schematic diagram of the results of tobacco gene editing tissue culture materials screened by different antibiotics. DETAILED DESCRIPTION

[0026] The technical solutions of the present application will be clearly and completely described below in combination with preferred embodiments. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0027] The expression level of Cas9 protein in a gene editing system is closely related to the editing efficiency on the genome. It is easier to obtain target gene editing materials in transformed materials with high expression of Cas9. In an embodiment, by using a P2A self-cleavage peptide sequence to concatenate the screening gene and the Cas9 coding sequence, the tissue culture materials screened during plant genetic transformation are usually high Cas9 expression. The present application is based on the following two principles to modify the commonly used gene editing vector: first, use P2A to ensure that Cas9 is expressed in equimolar with the screening marker, and at the same time, the newly added screening gene must be different from the original gene resistance mechanism. Therefore, the present application fuses the screening gene to the C-terminal of Cas9 in the commonly used editing vector through the P2A self-cleavage peptide to modify the vector, while retaining or replacing the original screening gene on the vector, to obtain a new editing vector containing double screening genes. After using these double-antigen modified vectors to electrotransform Agrobacterium, the plant gene editing is carried out, and the plant tissue culture cycle is matched to carry out a phased screening strategy. Specifically, the screening agent corresponding to the screening gene co-expressed with CAS9 is used in the first half of the screening culture stage of the explant genetic transformation, and then another screening agent corresponding to the screening gene expressed alone is used in the second half. By using the corresponding screening agents in stages, the burden of tissue culture of screening high Cas9 expression transformed materials is overcome, the transformation efficiency is ensured, and high-efficiency Cas9 expression transformed seedlings are obtained, which significantly improves the gene editing efficiency while ensuring the stable level of genetic transformation efficiency, to realize efficient and low-cost generation and screening of effective gene editing mutant plants.

[0028] In the above embodiments, compared with the prior art using a single screening gene to cooperate with a single screening agent for genetic transformation, it is difficult to efficiently obtain high Cas9 expression transformed materials. By using the new vector skeleton of double screening genes combined with the use of different screening agents in the plant tissue culture process, high expression Cas9 transformed plants are obtained more quickly, which significantly improves the gene editing efficiency while ensuring the stable level of genetic transformation efficiency, and also shortens the transformation cycle.

[0029] In the above embodiments, the screening method is suitable for a variety of plants, including but not limited to rice, tobacco, rapeseed, tomato, potato, soybean, cotton, alfalfa, eggplant, pepper, watermelon, melon, Lotus japonicus, or cauliflower.

[0030] In a preferred embodiment, the construction steps of the double-antibiotic new vector for screening of mutant plants of gene editing of rice are as follows: the p32B0 vector itself contains hpt a single expression frame of a gene, by replacing nptll the gene, and fusing the P2A-HPT coding sequence to the C-terminus of Cas9 to obtain a double-antibiotic new vector p32HG containing Hpt and G418 resistance genes, which is used for gene editing in rice. The screening process uses hygromycin first, and then uses G418 for further screening to obtain mutant plants with effective gene editing. Compared with single hygromycin screening, this screening method can keep a consistent high level of editing efficiency, and can further improve the transformation efficiency to obtain more edited seedlings.

[0031] In a preferred embodiment, the construction steps of the double-antibiotic new vector for screening of mutant plants of gene editing of tobacco, rape, tomato, potato, etc. are as follows: the pKSE401 vector itself contains nptll a gene, while retaining the expression frame of the gene and fusing P2A-HPT to the C-terminus of Cas9 to obtain a new vector p58HK with Hpt and Kan double-antibiotic resistance, which can be used for gene editing in tobacco, rape, tomato, potato, etc. First, hygromycin is used for screening, and then kanamycin is used for screening to obtain mutant plants with effective gene editing. On the one hand, compared with single kanamycin screening, the use of double antibiotics significantly improves the editing efficiency of positive seedlings in regenerated seedlings, and the number of edited seedlings is significantly increased; on the other hand, compared with single hygromycin screening, the screening culture time is reduced by 1-2 rounds, and the cost of screening medium and the corresponding labor input are reduced.

[0032] In a preferred embodiment, the construction steps of the double-antibiotic new vector for screening of mutant plants of gene editing of soybean, cotton, etc. are as follows: retaining the bar gene on the soybean gene editing vector pBSE402 (based on the pBSE401 vector, replacing the original AtU6-26 promoter with the soybean GmU6-10 promoter), and retaining the nptll gene on the cotton gene editing vector p7N, by fusing the P2A-CTP-EPSPS (CTP, a chloroplast transit peptide that guides EPSPs into chloroplasts to enhance glyphosate resistance) coding sequence to the C-terminus of Cas9, respectively obtaining a new soybean editing vector p402EB with EPSPS and Basta double-antibiotic resistance, and a new cotton editing vector p7EK with EPSPS and Kan double-antibiotic resistance. The screening process of soybean uses glyphosate and phosphinothricin in turn; the screening process of cotton uses glyphosate and kanamycin in turn to obtain mutant plants with effective gene editing. Compared with single screening agent screening, the double screening agent screening of soybean and cotton can not only improve the transformation efficiency, but also further improve the editing efficiency, and more edited seedlings can be obtained.

[0033] In a preferred embodiment, the construction steps of the double-antibiotic new vector for screening of dicotyledonous plant gene editing mutant plants such as watermelon, melon, Lotus japonicus, and cauliflower are as follows: the pKSE401 vector itself contains nptll the gene, the P2A-BAR is fused to the C-terminal of Cas9 while retaining the expression frame of the gene, to obtain a new vector p401BK with Bar and Kan double resistance, which can be used for gene editing in dicotyledonous plants such as watermelon, melon, Lotus japonicus, and cauliflower. The mutant plants with effective gene editing can be obtained by using glufosinate and kanamycin in sequence.

[0034] In a preferred embodiment, the construction steps of the double-antibiotic new vector for screening of dicotyledonous plant gene editing mutant plants such as alfalfa, eggplant, and pepper are as follows: the pBSE401 vector itself contains bar the gene, the P2A-NPTII is fused to the C-terminal of Cas9 while retaining the expression frame of the gene, to obtain a new vector p401KB with Kan and Bar double resistance, which can be used for gene editing in dicotyledonous plants such as alfalfa, eggplant, and pepper. The mutant plants with effective gene editing can be obtained by using kanamycin and glufosinate in sequence. Compared with single selection agent screening, the use of double selection agents in the screening process can not only improve the transformation efficiency, but also further improve the editing efficiency, and more edited seedlings can be obtained.

[0035] Example 1 p32HG in rice gene editing

[0036] The purpose of this embodiment is to fuse P2A-HPT to the C-terminal of Cas9 on the editing backbone p32B0, and replace the original nptll gene with the hpt gene to avoid duplication, to obtain a double-antibiotic modified vector p32HG containing Hpt and G418 resistance genes, which is used for gene editing in rice.

[0037] Os03g0149100 is selected as the target gene, and GCACTTCGCCGCCATCCACA and GGGCGACGCAGCCATAGATG on Exon1 are selected as double targets, which are constructed into p32HG to obtain the editing vector named 25KN131.

[0038] After the 25KN131 is electroporated into Agrobacterium strain EHA105, the transformed regeneration plants are obtained through Agrobacterium immersion of rice embryonic callus induction, screening culture of two kinds of screening agents, callus differentiation, and rooting. Effective editing plants are screened from the transformed regeneration plants through PCR positive detection and gene editing detection.

[0039] (a) Construction of intermediate support p32B0-NH

[0040] 1) Using PC2300 as a template, PCR was performed using the P35s-HindinF / NptII-XhoIR primer pair to obtain a 1954 bp target fragment containing the P35S and nptII genes.

[0041] 2) Take 2 μg of p32B0 plasmid and digest it with HindIII and PspXI at 37℃ for 2 h. Then, perform 1% agarose gel electrophoresis on the digestion product and extract the 15268 bp linearized vector band (i.e., the 2126 bp fragment containing P35S and hpt was removed). After purification with a gel extraction kit, it is ready for use.

[0042] 3) The target fragment from 1) was ligated to the linearized vector described above using homologous recombination. 1 μL of the ligation product was transformed into Escherichia coli DB3.1 competent cells using chemical transformation. The cells were then plated on Kan resistance plates and incubated overnight at 37°C.

[0043] 4) Pick single clones from the petri dish, inoculate them, and perform bacterial PCR. Use primer combination 35S-608R / Indel-R (expected product size 978 bp) to identify positive clones.

[0044] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and cultured, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it p32B0-NH.

[0045] (II) Construction of the final vector p32HG

[0046] 1) Using p32B0 as a template, PCR was performed with the XKBcas9-2218F / NLS-R primer pair to obtain a 1952 bp target fragment 1 containing the C-terminus of cas9. Using PV58k as a template, PCR was performed with the P2A-F / hpt-XbainR primer pair to obtain a 1110 bp target fragment 2 containing P2A and hpt.

[0047] 2) Take 2 μg of p32B0-NH plasmid and digest it with SacI at 37℃ for 2 h. Then, perform 1% agarose gel electrophoresis on the digestion product and extract the 15165 bp linearized vector band (that is, the C-terminal fragment of Cas9 containing the stop codon TAA has been removed). After purification with a gel extraction kit, it is ready for use.

[0048] 3) The two target fragments in 1) were ligated to the linearized vector using homologous recombination. 1 μL of the ligation product was transformed into Escherichia coli DB3.1 competent cells by chemical transformation, plated on Kan resistance plates, and incubated overnight at 37°C.

[0049] 4) Pick single clones from the petri dish, inoculate them, and perform bacterial PCR. Use the primer combination dCas9-3481F / hpt-279R (expected product size 1101 bp) to identify positive clones.

[0050] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and expanded, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it p32HG.

[0051] (III) Constructing rice gene editing vectors using p32HG

[0052] 1) Two CRISPR target sites were designed based on the rice Os03g0149100 genome sequence information.

[0053] 2) Adapter primers T1s and T2as containing 20bp target site sequences were synthesized by Tianyi Huayu Company. Using high-fidelity DNA polymerase, with PGTR plasmid as a template (containing sgRNA-tRNA backbone sequence), the target fragment containing T1 and T2 target sites was amplified using the above primers. The PCR system and procedure are as follows.

[0054] PCR system:

[0055] PCR program: 95℃ 3min; 95℃ 20s, 56℃ 20s, 72℃ 10s, 35 cycles; 72℃ 3min; 25℃ 1s.

[0056] 3) The PCR products and pR32B0-PH vector backbone plasmid were ligated using BsaI enzyme and T4 DNA ligase via Golden Gate. 1 μL of the ligation product was then transformed into E. coli DH5α or TOP10 competent cells by chemical transformation, plated on Kan resistance plates, and incubated overnight at 37°C.

[0057] 4) Pick single clones from the plate, inoculate them, and perform bacterial PCR to identify positive clones. Use primer combination OsU3-219F / 25KN131-Inf-T2as (expected product size 447 bp) to identify positive clones.

[0058] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and expanded, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it 25KN131.

[0059] 6) The above plasmids were transformed into Agrobacterium strain EHA105 by electroporation, and positive Agrobacterium clones were identified by PCR.

[0060]

[0061] (iv) Using a combination of screening agents to efficiently obtain effective gene-edited plants

[0062] 1. Dark induction of callus tissue: Take mature and plump seeds of the Nipponbare rice variety, remove the husk; disinfect with 75% alcohol for 1-2 minutes, then discard the alcohol; rinse twice with sterile distilled water; soak in 0.15% mercuric chloride (HgCl2) for 15-18 minutes, shaking several times during this period; discard the mercuric chloride, and rinse five times with sterile distilled water. Inoculate the sterilized seeds into the callus induction medium and incubate in the dark at 28℃ for 30 days.

[0063] 2. Subculture of callus: The induced callus tissue was transferred to a subculture medium for subculture, and then subcultured every 20 days.

[0064] 3. Agrobacterium streak activation: On the second day of pre-culture, Agrobacterium was streaked on LB medium containing kanamycin and incubated at 28°C.

[0065] 4. Suspension, infection, and co-culture of Agrobacterium: Activated Agrobacterium was scraped into a suspension culture medium and cultured on a shaker at 28°C for 30 min. OD was adjusted. 600 The value is 0.2~0.3. Place the callus tissue in Agrobacterium suspension and infect for 30 min, shaking several times during this period. Discard the bacterial suspension, blot the surface of the callus dry with sterile filter paper, and cover the callus surface with sterile filter paper to air dry in a laminar flow hood for 1-2 h. Then transfer the callus to co-culture medium and co-culture at 19℃ for 36-48 h (add 100 μL AS and 2 mL 50% glucose to every 100 mL suspension medium before use; add 250 μL AS and 5 mL 50% glucose to every 250 mL co-culture medium before use). 5. Water washing and sterilization: After co-culturing for 36-48 hours, sterilization is performed. The callus is continuously washed with sterile distilled water until the distilled water used to wash the callus is clear. Then, the callus is soaked in sterile distilled water containing 500 mg / L CN carbenicillin for 30 minutes, shaking constantly during soaking. The CN is discarded, and the surface moisture of the callus is absorbed as much as possible with sterile filter paper. The callus surface is then covered with another layer of sterile filter paper and dried in a laminar flow hood for 2-4 hours. 6. Screening Culture: Place the washed callus on screening medium and incubate in the dark at 28°C. The first round of screening uses 50 mg / L hygromycin. After 2 weeks, change the medium and use 50 mg / L G418 for the second round of screening. Add the appropriate volume of screening agent to every 250 mL of screening medium before use.

[0066] 7. Differentiation: Place well-grown resistant callus in differentiation medium and culture at 28-30℃ under light (14h light: 10h darkness). The differentiation cycle is 35-45 days.

[0067] 8. Rooting: When the resistant callus forms 3-4 cm long shoots on the differentiation medium, transfer the shoots to the rooting medium. Note that the shoots emerging from a single resistant callus are identical and can only be taken once. Culture at 28℃ under light until a complete plantlet is formed. Generally, 30 tubes are rooted, with 1 plantlet per tube, for a total of 30 plants. The remaining untaken differentiation tubes can be temporarily set aside for later replanting.

[0068] 9. Positive detection: After the transformed plants have developed roots (about 1 week), under aseptic conditions, cut leaves about 2 cm long and place them in a 2 mL centrifuge tube containing steel balls. Label the centrifuge tubes clearly and extract DNA using the CTAB method. Perform PCR positive detection using primer pair XKB-Cas9-F / R (expected product size 827 bp).

[0069] 10. Editing detection: Design F and R primers 100-200 bp upstream and downstream of the two target sites, respectively, and perform gene editing detection on Cas9 positive seedlings.

[0070] (V) Analysis of conversion efficiency and editing efficiency

[0071] Results of screening rice gene-edited tissue culture materials using different antibiotics are as follows: Figure 2 As shown. Rice embryogenic callus was infected with Agrobacterium using the editing vector 25KN131, co-cultured, and then transferred to a selection medium. After two rounds of selection (average 14 days per round), resistant callus was identified, differentiated, rooted, and regenerated plants were obtained for further testing. From... Figure 2 It can be seen that rice callus tissue selected using G418 alone (corresponding to the single expression on p32HG) nptll (Gene screening), the proportion of resistant callus was the highest in each dish (Figure 2 A); while those selected using hygromycin alone (corresponding to those co-expressed with Cas9 on p32HG). hpt (Selection of genes) The most severe browning of callus was observed, while the proportion of resistant callus was the lowest. Figure 2 B); however, the proportion of resistant callus obtained by using hygromycin and G418 in combination (hygromycin in the first round, G418 in the second round) was between that of the two methods. Figure 2 C).

[0072] As shown in the table below, although using G418 alone yielded the most regenerated seedlings, it also resulted in the lowest positive rate, transformation efficiency, and editing efficiency. Compared to using hygromycin alone, the combined use of hygromycin and G418 maintained a consistently high level of editing efficiency and improved transformation efficiency by approximately 10%, thus yielding the most edited seedlings. This is presumably because switching to G418 in the second round of screening alleviated the tissue culture pressure associated with the sustained high expression of HPT and Cas9 required in the first round. Therefore, in rice, combining different screening agents in a plant tissue culture process can more efficiently obtain transformed plants that have undergone genome editing.

[0073] Table 1: Gene editing in rice using different screening strategies

[0074] Note: a) Different screening agents are used in different screening strategies, but the concentration of the same screening agent is the same; b) Transformation efficiency = Positive rate × Number of regenerated seedlings / Number of explants; c) Number of edited seedlings = Positive rate × Number of regenerated seedlings × Editing efficiency

[0075] Example 2 p58HK in tobacco gene editing

[0076] (I) Construction of intermediate carrier PV58

[0077] 1) Using PC1300 plasmid and PV55-F0 fragment (primer synthesized and diluted 100-fold) as templates, and employing the PV55-BSF / PV58-R primer pair, fusion P2A and P2A were obtained via overlap extension PCR. hpt The 1129 bp target fragment. The 59 bp PV55-F0 sequence consists of P2A and... hpt Sequence composition.

[0078] 2) Take 2 μg of pKSE401 plasmid, digest it with SacI at 37℃ for 2 h, and then use the sodium acetate-ethanol precipitation method to obtain the purified linearized vector fragment.

[0079] 3) The target fragment from 1) was ligated to the linearized vector using homologous recombination. 1 μL of the ligation product was transformed into E. coli DH5α or TOP10 competent cells using chemical transformation. The cells were plated on Kan resistance plates and incubated overnight at 37°C.

[0080] 4) Pick single clones from the plate, inoculate them, and perform bacterial PCR. Use the primer combination PV53-4000F / PKSE401-SeqR (expected product size 1706 bp) to identify positive clones.

[0081] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and expanded, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it PV58.

[0082] (II) Construction of intermediate carrier PV58k

[0083] 1) Using pKSE401 as a template, PCR was performed with the U626-hindF / U626P-overlapR primer pair to obtain a 446 bp fragment containing the AtU6-26 promoter; using PGTR as a template, PCR was performed with the tRNA-overlapF / R primer pair to obtain a 122 bp fragment containing tRNA; using pKSE401 as a template, PCR was performed with the gRNA-overlapF / U626T-HindR primer pair to obtain a 294 bp fragment containing a KpnI restriction site, gRNA, and the U6-26 terminator. These three fragments were then mixed as a template, and PCR was performed with the U626-hindF / U626T-HindR primer pair via overlap extension to obtain the 817 bp target fragment.

[0084] 2) Take 2 μg of PV58 vector and digest it with HindIII at 37℃ for 2 h. Then, perform 1% agarose gel electrophoresis on the digestion product and extract the 15603 bp linearized vector band (i.e., the 1919 bp gRNA expression cassette containing SmR was removed). After purification with a gel extraction kit, it is ready for use.

[0085] 3) The target fragment from 1) was ligated to the linearized vector using homologous recombination. 1 μL of the ligation product was transformed into E. coli DH5α or TOP10 competent cells using chemical transformation. The cells were plated on Kan resistance plates and incubated overnight at 37°C.

[0086] 4) Pick single clones from the petri dish, inoculate them, and perform bacterial PCR. Use the primer combination U626-hindF / U626T-hindR (expected product size 817 bp) to identify positive clones.

[0087] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and expanded, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it PV58k.

[0088] (III) Construction of the final carrier p58HK

[0089] 1) Using p32B0 as a template, PCR was performed using the ccdB-bF / bR primer pair to obtain a 1482 bp target fragment containing the lethal gene ccdB.

[0090] 2) Take 2 μg of PV58k plasmid, digest it with KpnI at 37℃ for 2 h, and then use the sodium acetate-ethanol precipitation method to obtain the purified linearized vector fragment.

[0091] 3) The target fragment from 1) was ligated to the linearized vector described above using homologous recombination. 1 μL of the ligation product was transformed into E. coli DB3.1 competent cells using chemical transformation, plated on Kans resistant plates, and incubated overnight at 37°C.

[0092] 4) Pick a single clone from the plate, inoculate it, and perform bacterial PCR. Use primer combination U626-IDF / CAT-250R (expected product size 694 bp) to identify positive clones.

[0093] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and expanded, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use the self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it p58HK.

[0094] (iv) Constructing a tobacco gene editing vector using p58HK

[0095] 1) Two CRISPR target sites were designed based on the genome sequence information of tobacco Ntab-K326_AWOJ-SS19610.

[0096] 2) Adapter primers T1s and T2as containing 20 bp target site sequences were synthesized by Tianyi Huayu Company. Using high-fidelity DNA polymerase and PGTR plasmid as a template, the target fragment containing T1 and T2 target sites was amplified using the above primers. The PCR system and procedure are as follows.

[0097] PCR system:

[0098] PCR program: 95℃ 3min; 95℃ 20s, 56℃ 20s, 72℃ 10s, 35 cycles; 72℃ 3min; 25℃ 1s.

[0099] 3) The PCR product and the p58HK vector backbone plasmid were ligated using BsaI enzyme and T4 DNA ligase via Golden Gate ligation. 1 μL of the ligation product was transferred to 20 μL of E. coli DH5α or TOP10 competent cells, plated on Kan resistance plates, and incubated overnight at 37°C.

[0100] 4) Pick single clones from the petri dish, inoculate them, and perform bacterial PCR to identify positive clones. Use primer combination U626-IDF / 25KN130-Inf-T2as-BsaI (expected product size 547 bp) to identify positive clones.

[0101] 5) Aspirate 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and cultured, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it 25KN130.

[0102] 6) The above plasmids were transformed into Agrobacterium strain GV3101 by electroporation, and positive Agrobacterium clones were identified by PCR.

[0103]

[0104] (iv) Using a combination of screening agents to efficiently obtain effective gene-edited plants

[0105] 1. Germination of sterile tobacco seedlings

[0106] Dried tobacco cultivar K326 seeds were soaked in 2% sodium hypochlorite for 10 minutes, rinsed 5 times with sterile water, and then transferred to germination medium to germinate for about 30-45 days.

[0107] 2. Isolation of tobacco leaf explants

[0108] On a sterile operating table, use a blade and tweezers to cut the sterile seedling leaves into square explants of about 5-8 mm × 5-8 mm (avoiding the main vein as much as possible), and add a small amount of sterile water to keep them moist.

[0109] 3. Preparation of Agrobacterium-containing infusion solution

[0110] Take 300 μL of the preserved target Agrobacterium culture and inoculate it into approximately 15 mL of LB medium. Shake the culture overnight, centrifuge at 5000 rpm for 5 min, discard the supernatant, and resuspend the culture in co-culture broth supplemented with AS to a concentration adjusted to OD. 600 It is approximately 0.5-0.55.

[0111] 4. Agrobacterium infection and co-culture

[0112] The isolated leaf explants were fully immersed in the prepared Agrobacterium infection solution for 20 minutes. Then, the bacterial solution on the surface of the explants was simply absorbed with filter paper. The explants were then placed on a co-culture medium with the upper epidermis facing up and cultured under light for 2 days. The culture conditions were 24-26℃ and light:dark = 16h:8h.

[0113] 5. Induction and selection culture

[0114] Explants were transferred to induction and selection medium containing selection agents, and subcultured approximately every 15-25 days, for a total of about 4 times. The first two selections used 10 mg / L hygromycin, and the last two selections used 120 mg / L kanamycin (Kan). The culture conditions were 24-26℃, light:dark = 16h:8h.

[0115] 6. Rooting Culture

[0116] When the differentiated seedlings have grown to about 4-5 true leaves, they are cut off from the base with a blade and tweezers on a sterile operating table and transferred to a rooting medium to root. They are then cultured at 28°C under light until a complete plant is formed, which takes about 10-15 days.

[0117] 7. Sampling and testing

[0118] DNA was extracted from leaves of sterile rooted tissue culture seedlings using the CTAB method, and PCR was performed using primer pair 401-Cas9-F / R (expected product size 564 bp) to detect positive results.

[0119] 8. Editing detection: Design F and R primers 100-200 bp upstream and downstream of the two target sites, respectively, and perform gene editing detection on Cas9 positive seedlings.

[0120] (V) Analysis of conversion efficiency and editing efficiency

[0121] Tobacco leaf explants were infected with Agrobacterium tumefaciens using the editing vector 25KN130, co-cultured, and then transferred to selection medium. After 4-6 rounds of selection (average 20 days per round), shoots and roots were obtained, and regenerated plants were tested. Figure 3 It can be seen that kanamycin alone is used for tissue culture screening (corresponding to the single expression on p58HK). nptll (Gene selection), the leaf explants initially turn chlorotic and white, but sprout the fastest when entering the fourth round of selection ( Figure 3 A); while those selected using hygromycin alone (corresponding to those co-expressed with Cas9 on p58HK). hpt (Gene selection), germination rate was significantly slower by one round ( Figure 3 B). Explants obtained by using a combination of hygromycin and kanamycin (hygromycin for the first two rounds, kanamycin for the third and fourth rounds) were essentially identical to those selected using kanamycin alone. Figure 3 C).

[0122] Table 2 shows that compared to screening with kanamycin alone, the editing efficiency of positive seedlings obtained from regenerated seedlings using a combination of antibiotics significantly increased from 63% to 90%, and the number of edited seedlings obtained was also the highest. Most notably, the transformation cycle using a combination of antibiotics was similar to that using kanamycin alone. In contrast, screening with hygromycin alone required 1-2 more rounds of screening culture to guarantee the acquisition of regenerated seedlings, presumably due to the high tissue culture pressure caused by the co-expression of HPT and Cas9. In summary, while ensuring high editing efficiency, the screening strategy using a combination of antibiotics reduces the cost of one round of screening culture medium and the corresponding manpower input compared to screening with hygromycin alone. Therefore, in tobacco, combining different screening agents in the plant tissue culture process can more efficiently obtain transformed plants that have undergone genome editing.

[0123] Table 2: Gene editing in tobacco using different combinations of screening agents

[0124] Note: a) Different screening agents are used in different screening strategies, but the concentration of the same screening agent is the same; b) Transformation efficiency = Positive rate × Number of regenerated seedlings / Number of explants; c) Number of edited seedlings = Positive rate × Number of regenerated seedlings × Editing efficiency

[0125] Example 3 Soybean dual resistance gene editing vector

[0126] (a) Construction of pBSE402

[0127] The soybean WM82 genome sequencing data (NC_038255.2) yielded a 306 bp GmU6-10 promoter sequence, along with a 77 bp tRNA, a 6 bp SpeI restriction site, and a 68 bp polyT-containing cassette (TTTTTTTTGAAATTTCTCGTTTAGATAGATGTCTTTGCTTTTCCGCACTATGGTTCTGATTATTAGGG), totaling 533 bp. This cassette was sent to Nanjing GenScript for gene synthesis and inserted into the pBSE401 vector between the 5'-HindIII and 3'-HindIII sites, replacing the original 1919 bp AtU6-26 gRNA expression cassette containing SmR, thus obtaining the soybean gene editing vector pBSE402.

[0128] (II) Construction of pC6300

[0129] The 5'UTR (133 bp, used to enhance expression) from Tobacco etch virus (TEV) and the chloroplast-localizing peptide CTP (76 amino acids, optimized with soybean preferred codons, used to transport the fusion protein into the chloroplast to exert its function) from EPSPs (GenBank: CAA29828.1) from Arabidopsis thaliana were selected. The DNA sequence of the herbicide resistance gene CP4-EPSPs (1368 bp, refer to Standard reference vector pMCS, GenBank: KJ701603.1) from Agrobacterium tumefaciens was directly synthesized between the 5'-XhoI and 3'-XhoI sites of pCAMBIA1300, replacing the original hpt gene, thus obtaining the soybean herbicide resistance expression vector pC6300.

[0130] (III) Construction of p402EB

[0131] 1) Using pBSE402 as a template, PCR amplification with primers Cas9-MluF / 25EV260-R1 yielded a 1223 bp C-terminal target fragment containing Cas9. 2) Using long primers 25EV156-F1 / 25EV260-R2, direct PCR amplification yielded a 70 bp P2A target fragment. 3) Using pC6300 as a template, PCR amplification with primers CTP-inF / 6300-EPSPs-SacIR yielded a 1639 bp CTP-EPSPs target fragment.

[0132] 2) Take 2 μg of pBSE402 plasmid and digest it with MluI and SacI at 37℃ for 2 h, then use the sodium acetate-ethanol precipitation method to obtain the purified linearized vector fragment.

[0133] 3) The three target fragments in 1) were ligated with the linearized vector above using homologous recombination. 1 μL of the ligation product was transformed into E. coli DH5α or TOP10 competent cells by chemical transformation. The cells were plated on Kan resistance plates and incubated overnight at 37°C.

[0134] 4) Pick single clones from the petri dish, inoculate them, and perform bacterial PCR. Use the primer combination PESE403J-F2 / R2 (expected product size 517 bp) to identify positive clones.

[0135] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and cultured, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it p402EB.

[0136] Example 4 Cotton dual resistance gene editing vector

[0137] (a) Construction of p7N-k

[0138] 1) Using PGTR as a template, PCR was performed using the tRNA-F / tRNA-kpniR primer pair to obtain an 83 bp fragment containing the tRNA promoter and KpnI restriction site.

[0139] 2) Take 2 μg of p7N plasmid, digest it with BsaI at 37℃ for 2 h, and then use the sodium acetate-ethanol precipitation method to obtain the purified linearized vector fragment.

[0140] 3) The four target fragments in 1) were ligated with the linearized vector above using homologous recombination. 1 μL of the ligation product was transformed into E. coli DH5α or TOP10 competent cells by chemical transformation. The cells were plated on Kan resistance plates and incubated overnight at 37°C.

[0141] 4) Pick single clones from the plate, inoculate them, and perform bacterial PCR. Use primer combination U6-7S / tRNA-R (expected product size 216 bp) to identify positive clones.

[0142] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and expanded, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it p7N-k.

[0143] (II) Construction of p7EK

[0144] 1) Using the 25EV157-F1 / R1 long primer pair, direct PCR amplification yielded an 88 bp target fragment of P2A.1 Using p402EB as a template, PCR amplification with the CTP-inF / EPSPS_mkpni-R primer pair yielded a 762 bp target fragment.2 Using p402EB as a template, PCR amplification with the EPSPS_mkpni-F / 6300-EPSPs-XbaiR primer pair yielded an 892 bp target fragment.3 Using p7N as a template, PCR amplification with the 25EV157-F2X / M13F primer pair yielded a 358 bp target fragment.4

[0145] 2) Take 2 μg of P7N-K plasmid, digest it with EcoRI at 37℃ for 2 h, and then use the sodium acetate-ethanol precipitation method to obtain the purified linearized vector fragment.

[0146] 3) The four target fragments in 1) were ligated with the linearized vector above using homologous recombination. 1 μL of the ligation product was transformed into E. coli DH5α or TOP10 competent cells by chemical transformation. The cells were plated on Kan resistance plates and incubated overnight at 37°C.

[0147] 4) Pick a single clone from the plate, inoculate it, and perform bacterial PCR. Use the primer combination PESE403J-F1 / NosR-seq (expected product size 509 bp) to identify positive clones.

[0148] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and expanded, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it p7EK.

[0149] Example 5 Dual resistance gene editing vector p401KB

[0150] 1) PCR amplification was performed directly using the 25EV298-F1 / R1 long primer pair to obtain the 100 bp target fragment 1 of P2A. Using pCAMBIA2300 as a template, PCR amplification was performed using the 25EV298-F2 / R2 primer pair to obtain... nptll The 825 bp target fragment 2.

[0151] 2) Take 2 μg of pBSE401 plasmid, digest it with SacI at 37℃ for 2 h, and then use the sodium acetate-ethanol precipitation method to obtain the purified linearized vector fragment.

[0152] 3) The two target fragments in 1) were ligated to the linearized vector using homologous recombination. 1 μL of the ligation product was transformed into E. coli DH5α or TOP10 competent cells by chemical transformation. The cells were plated on Kan resistance plates and incubated overnight at 37°C.

[0153] 4) Pick a single clone from the plate, inoculate it, and perform bacterial PCR. Use primer combination 25EV298J-F / 546R (expected product size 546 bp) to identify positive clones.

[0154] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and cultured, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use a self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it p401KB.

[0155] Example 6: Gene editing vector p401BK for bispecific antibodies

[0156] 1) The 100 bp target fragment 1 of P2A was obtained by direct PCR amplification using the 25EV324-F1 / R1 long primer pair. Using pCambia3300 as a template, the target fragment 2 containing the complete bar gene was obtained by amplification using the 25EV324-F2 / R2 primer pair.

[0157] 2) Take 2 μg of pKSE401-k plasmid, digest it with SacI at 37℃ for 2 h, and then use the sodium acetate-ethanol precipitation method to obtain the purified linearized vector fragment.

[0158] 3) The two target fragments in 1) were ligated to the linearized vector using homologous recombination. 1 μL of the ligation product was transformed into Escherichia coli DB3.1 competent cells by chemical transformation, plated on Kan resistance plates, and incubated overnight at 37°C.

[0159] 4) Pick a single clone from the plate, inoculate it and perform bacterial PCR. Use primer combination 25EV298J-F / 25EV324-R2 (expected product size 793 bp) to identify positive clones.

[0160] 5) Take 200 μL of the shaken bacterial culture of the positive clone and send it for first-generation sequencing. After the correctly sequenced clone is inoculated and cultured, take 500 μL of fresh bacterial culture and add an equal volume of sterile 50% glycerol, and store E. coli glycerol bacteria at -80℃; use the self-made plasmid extraction reagent to extract a small amount of plasmid from the remaining bacterial culture, store it at -20℃, and name it p401BK.

[0161] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A highly efficient screening method for genetic transformation of plant gene-editing mutants, characterized by the following steps: include: A Cas9 gene editing vector containing a first resistance gene and a second resistance gene was constructed based on the P2A self-cleaving peptide, with the first resistance gene linked to the C-terminus of the Cas9 protein; The Cas9 gene editing vector was transferred into Agrobacterium strain, which then infected plant callus tissue and cultured it. The cultured tissues were subjected to first and second resistance screenings using the first and second screening agents respectively, resulting in gene-edited positive plants. The first resistance gene and the second resistance gene are different resistance genes, corresponding to the resistance genes of the first selection agent and the second selection agent, respectively.

2. The method for efficient screening of plant gene-edited mutants through genetic transformation according to claim 1, characterized in that, The first resistance gene has better screening specificity in plants than the second resistance gene.

3. The efficient screening method for genetic transformation of plant gene-edited mutants according to claim 1, wherein the method for constructing the Cas9 gene-editing vector is to fuse the P2A self-cleaving peptide-first resistance gene fragment into the C-terminus of the Cas9 in the original Cas9 gene-editing vector, and replace or retain the resistance gene in the original Cas9 gene-editing vector as the second resistance gene.

4. The method for efficient screening of plant gene-edited mutants through genetic transformation according to claim 1, characterized in that, The first screening agent and the second screening agent are different screening agents, each independently selected from antibiotics or herbicides.

5. The method for efficient screening of plant gene-edited mutants through genetic transformation according to claim 4, characterized in that, The concentration of the first screening agent and / or the second screening agent is 5-250 mg / L.

6. The method for efficient screening of plant gene-edited mutants through genetic transformation according to claim 1, characterized in that, The first and second resistance screening processes were performed using basal culture media.

7. The method for efficient screening of plant gene-edited mutants through genetic transformation according to claim 1, characterized in that, The second screening and the first screening each account for half of the total screening time.

8. The method for efficient screening of plant gene-edited mutants through genetic transformation according to claim 1, characterized in that, The plants mentioned are rice, tobacco, rapeseed, tomato, potato, soybean, cotton, alfalfa, eggplant, pepper, watermelon, cantaloupe, bird's eye root, or cauliflower.

9. The method for efficient screening of plant gene-editing mutants through genetic transformation according to claim 1, characterized in that, The plant is rice, and the Cas9 gene editing vector is a p32B0 vector. hpt The individual expression frames of genes were replaced with nptII The gene was then fused with the P2A-HPT coding sequence into the C-terminus of Cas9. The first screening agent was hygromycin, and the second screening agent was G418. Alternatively, the plant may be any one of tobacco, rapeseed, tomato, or potato, and the Cas9 gene editing vector may be retained by the pKSE401 vector. nptII The gene expression cassette was obtained by fusing P2A-HPT to the C-terminus of Cas9. The first selection agent was hygromycin, and the second selection agent was kanamycin. Alternatively, the plant may be soybean, and the Cas9 gene editing vector may be preserved by the pBSE402 vector. bar The P2A-CTP-EPSPS coding sequence was fused into the C-terminus of Cas9 while the gene expression cassette was being used. The first screening agent was glyphosate, and the second screening agent was glufosinate. Alternatively, the plant may be cotton, and the Cas9 gene-editing vector may be preserved by a p7N vector. nptII The P2A-CTP-EPSPS coding sequence was fused into the C-terminus of Cas9 while the gene expression cassette was being used. The first screening agent was glyphosate, and the second screening agent was kanamycin. Alternatively, the plant may be any one of alfalfa, eggplant, or pepper, and the Cas9 gene editing vector may be retained by the pBSE401 vector. bar The gene expression cassette was obtained by fusing P2A-NPTII into the C-terminus of Cas9. The first screening agent was kanamycin, and the second screening agent was glufosinate. Alternatively, the plant can be any one of watermelon, cantaloupe, birdsfoot, or cauliflower, and the Cas9 gene editing vector can be retained by the pKSE401 vector. nptII The gene expression cassette was obtained by fusing P2A-BAR into the C-terminus of Cas9. The first screening agent was glufosinate, and the second screening agent was kanamycin.

10. A method for transgenic plants, characterized in that, This includes constructing plant receptors with resistance to the target gene and screening these plant receptors through genetic transformation; wherein: The genetic transformation screening process includes transferring the Cas9 gene editing vector into an Agrobacterium strain and infecting the callus tissue of a plant recipient and culturing it, and then screening using at least two screening agents. The method for constructing the Cas9 gene editing vector is as follows: a Cas9 gene editing vector containing at least one resistance marker gene is constructed based on the P2A self-cleaving peptide, wherein a resistance marker gene is linked to the C-terminus of the Cas9 protein; The resistance marker gene is different from the target gene that the plant receptor is resistant to. The screening agent includes a screening agent corresponding to the target gene that the plant receptor is resistant to, and a screening agent corresponding to the resistance marker gene.

Images