Primer probe for detecting ACCase gene mutation of eleusine indica and application of primer probe

Abstract

The invention discloses a primer probe for detecting ACCase gene mutation of eleusine indica and application of the primer probe, the primer probe for detecting ACCase gene mutation of eleusine indica is shown in a specification table 15, the invention further discloses a kit containing the primer probe, reaction components of the kit are shown in a specification table 16, and a reaction system and reaction procedures are shown in specification tables 17-18. The invention also discloses an application of the primer probe or the kit in detection of the drug-resistant gene ACCase mutation of the goosegrass herb or in preparation of drugs for detecting the drug-resistant gene ACCase mutation of the goosegrass herb. On the basis of a multicolor fluorescent probe PCR melting curve method, the dependence on professional technicians and equipment can be reduced, the detection range can be expanded, the detection efficiency can be improved, the time of the steps can be remarkably shortened, the detection result is quicker, and the method has important significance for taking prevention and treatment measures in time and preventing diffusion of drug-resistant eleusine indica.

Description

Technical Field

[0001] This invention belongs to the field of multiplex qPCR technology, specifically relating to a primer probe for detecting ACCase gene mutations in *Eleusine indica* and its application, particularly a multicolor fluorescent probe PCR melting curve primer probe for detecting ACCase gene mutations in *Eleusine indica* and its application. Background Technology

[0002] Eleusine indica is a weed belonging to the genus Eleusine in the family Poaceae. It has a well-developed root system, is drought-tolerant, heat-tolerant, and has a high reproductive capacity. However, it readily develops resistance to herbicides, making it a globally prevalent and noxious weed. Eleusine indica is distributed throughout both northern and southern my country, but its occurrence and damage are particularly severe in the south. It primarily infests grain crops such as corn, soybeans, peanuts, and cotton, as well as orchards, becoming one of the most difficult weeds to control in agricultural fields.

[0003] ACCase inhibitor herbicides are the main herbicides for controlling goosegrass in crop fields. Based on their chemical structure, they are classified into three main categories: aryloxyphenoxypropionates (APP), cyclohexenones (CHD), and phenylpyrazolines (DEN). Commonly used ACCase inhibitor herbicides, such as quizalofop-ethyl, fenoxaprop-P-ethyl, cyhalofop-butyl, clethodim, sethoxydim, and pinoxaden, have good control efficacy against goosegrass in soybean, cotton, rapeseed, and rice fields. However, in recent years, with the long-term use of single herbicides, goosegrass in different crop fields has developed resistance to ACCase inhibitor herbicides. For example, goosegrass resistant to cyhalofop-butyl has appeared in rice fields. Herbicide resistance mainly develops through two mechanisms: target site resistance (TSR) and non-target site resistance (NTSR). Resistant weed populations of ACCase inhibitor herbicides based on target resistance have become widespread, with at least 50 weed species recorded to be resistant to these herbicides. Zagnitko et al. first reported a mutation (I1781L) at amino acid 1781 of the ACCase gene-encoded protein in Lolium rigidum and found that this mutation could induce resistance to haloxyfop-R-methyl and sethoxydim. Subsequently, other ACCase gene mutation types (such as I1781V / T, W1999L / C / S, W2027S / L / C, I2041V / N, D2078E / G, C2088R, and G2096S / A) were also successively discovered in species such as Alopecurus aequalis, Lolium perenne, and Echinochloa crus-galli. It has been reported that the ACCase gene in goosegrass was mainly found at sites such as W1999L / C / S, W2027S / L / C, and D2078E / G. Then, in 2023, the mutation of isoleucine at position 2041 of the ACCase gene to alanine (I2041A) was first identified in resistant goosegrass, leading to varying degrees of resistance in resistant goosegrass populations to quizalofop-p-ethyl, cyhalofop-butyl, and oxadiazon.

[0004] The lag in detection technology is a key factor leading to irrational pesticide application in the field, which in turn drives the evolution of weed resistance. Currently, the main molecular detection techniques for herbicide resistance sites in *Eleusine indica* are PCR and Sanger sequencing, which suffer from drawbacks such as cumbersome operation, long detection cycles, high requirements for professional technical background, limited number of detection targets, low detection sensitivity, and complicated data interpretation. Furthermore, conventional molecular detection techniques such as qPCR and dCAPs can only detect one molecular mechanism of resistance at a time, failing to meet the rapid detection needs of multiple molecular mechanisms in multi-resistant weeds.

[0005] This invention aims to develop a detection technique based on multicolor fluorescent probe PCR melting curve method, thereby achieving rapid, simple, accurate, and multi-target detection of the ACCase mutation site of the herbicide-resistant gene in *Eleusine indica*. This approach reduces reliance on specialized technicians and equipment, enabling more grassroots personnel and institutions to perform the tests, thus expanding the detection scope and improving efficiency. Furthermore, the rapid detection technology significantly shortens the time required for these steps, resulting in faster test results. This is of great significance for timely implementation of control measures and preventing the spread of herbicide-resistant *Eleusine indica*. Summary of the Invention

[0006] The purpose of this invention is to provide a primer probe and kit for detecting mutations in the ACCase gene of *Eleusine indica*.

[0007] The present invention also aims to provide the application of the above-mentioned primers, probes or kits in the detection of ACCase mutations in the herbaceous goosegrass resistance gene or in the preparation of drugs for detecting ACCase mutations in the herbaceous goosegrass resistance gene.

[0008] The first objective of this invention can be achieved through the following technical solution: a primer probe for detecting mutations in the ACCase gene of *Eleusine indica*, wherein the primer probe is shown below:

[0009]

[0010] The gene ACCase is identified in GenBank as KF700368.1, where amino acid positions 1781, 1999, 2027, 2041, 2078, and 2096 are where the amino acid mutation occurs.

[0011] The present invention also provides a kit for detecting mutations in the ACCase gene of *Eleusine indica*, comprising nucleic acid amplification reagents, wherein the nucleic acid amplification reagents include the aforementioned primers and probes.

[0012] Preferably, the concentrations and amounts of each component in the nucleic acid amplification reagent are as follows:

[0013]

[0014] Preferably, the reaction system is prepared using the aforementioned nucleic acid amplification reagent, and the amounts of each component are as follows:

[0015]

[0016] Preferably, when using the aforementioned nucleic acid amplification reagent for qPCR amplification, the amplification program employed is as follows:

[0017]

[0018] The second objective of the present invention can be achieved by the following technical solution: the application of the primer probe or the kit in the detection of ACCase mutation of the herbaceous goosegrass resistance gene or in the preparation of drugs for detecting ACCase mutation of the herbaceous goosegrass resistance gene.

[0019] Compared with the prior art, the present invention has the following advantages:

[0020] (1) High throughput: In the detection of herbicide resistance in weeds, existing molecular detection technologies such as PCR, quantitative real-time PCR (qPCR), and dCAPs can only detect one type of mutation in a single gene at a time. However, this technology is suitable for detecting multiple mutations in a single gene at the same time, and is suitable for large-scale screening of ACCase inhibitor-resistant goosegrass populations.

[0021] (2) Simple operation: Existing molecular detection technologies require multiple reaction tubes to detect multiple resistance mechanisms. This technology can amplify multiple targets simultaneously in two reactions, reducing the consumption of samples and reagents and making the operation simpler.

[0022] (3) Intuitive results: Existing molecular detection technologies require relatively cumbersome analysis processes such as sequencing alignment, gel electrophoresis, or data statistics; after the reaction is completed, the detection results can be seen intuitively through different melting peaks and the Tm value output by the software, which is clear at a glance.

[0023] (4) More time-saving: Traditional indoor bioassay techniques for identifying weed resistance take about 3 months; existing molecular detection techniques also take 3-7 days. This technology can obtain multiple intuitive target detection results within one day. Attached Figure Description

[0024] Figure 1 This is a schematic diagram of the high-resolution melting curve (HRM) multiple detection scheme in Example 1;

[0025] Figure 2 This is the amplification result of HRM reaction system 1 in Example 1. In the figure, Amplification Plot: amplification curve, Cycle: cycle;

[0026] Figure 3 This is the melting curve of HRM reaction system 1 in Example 1. In the figure, Derivative Reporter (-Rn): Derivative Reporting Value (-Rn), Melt Curve Plot: Melting Curve Plot, Temperature: Temperature;

[0027] Figure 4 This is the amplification result of HRM reaction system 2 in Example 1. Amplification Plot: amplification curve; Cycle: cycle.

[0028] Figure 5 This is the melting curve of HRM reaction system 2 in Example 1. In the figure, Derivative Reporter (-Rn): Derivative Reporting Value (-Rn), Melt Curve Plot: Melting Curve Plot, Temperature: Temperature;

[0029] Figure 6 This is the typing result of HRM reaction system 1 in Example 1. In the figure, Aligned Melt Curve Plot: Aligned Melt Curve Plot; Aligned Fluorescences: Aligned Fluorescence Values; Temperature: Temperature; variant: Mutant;

[0030] Figure 7 This is the HRM reaction system 2 typing result in Example 1. In the figure, Aligned Melt Curve Plot: Aligned Melt Curve Plot; Aligned Fluorescences: Aligned Fluorescence Values; Temperature: Temperature; variant: Mutant;

[0031] Figure 8 This is a schematic diagram of the MMCA multiplex detection scheme in Example 2;

[0032] Figure 9 This is the single-tube single-electrode melting curve in Example 2. In the figure, Derivative Reporter: Derivative report value; Melt Curve Plot (Derivative): Melt curve plot (derivative form); Temperature: Temperature;

[0033] Figure 10 This is the single-tube quadruple melting curve in Example 2. In the figure, Derivative Reporter: Derivative report value; Melt Curve Plot (Derivative): Melt curve plot (derivative form); Temperature: Temperature;

[0034] Figure 11 This is the melting curve of the FAM channel in Example 2. In the figure, Derivative Reporter: Derivative report value; Melt Curve Plot (Derivative): Melt curve plot (derivative form); Temperature: Temperature;

[0035] Figure 12 This is the melting curve of channel CY5 in Example 2. In the figure, Derivative Reporter: Derivative report value; Melt Curve Plot (Derivative): Melt curve plot (derivative form); Temperature: Temperature;

[0036] Figure 13 This is the melting curve of component 1 in the dual-tube seven-fold reaction in Example 2. In the figure, Derivative Reporter: Derivative report value; Melt Curve Plot (Derivative): Melt curve plot (derivative form); Temperature: Temperature; Target: Target.

[0037] Figure 14 This is the melting curve of component 2 in the dual-tube seven-fold reaction in Example 2. In the figure, Derivative Reporter: Derivative report value; Melt Curve Plot (Derivative): Melt curve plot (derivative form); Temperature: Temperature; Target: Target.

[0038] Figure 15 These are the sequencing results of the WT1 Asp2078 site in the wild-type sample from Example 2;

[0039] Figure 16 This is the sequencing result of the WT2 Asp2078 site in the wild-type sample from Example 2. Detailed Implementation

[0040] The specific implementation methods of the present invention will be further illustrated below with examples.

[0041] In the following embodiments:

[0042] The nucleic acid template of the herbaceous goosegrass resistance gene ACCase used in this invention has the following mutation sites, as shown in Table 1.

[0043] Table 1. Mutation sites present in the nucleic acid template of the herbicide resistance gene ACCase in Eleusine indica.

[0044]

[0045] ATAGCGGATGAGGTGAAATCTTGCTTCCGTGTTGGTTGGTCCGATGAAAGCAGCCCTGAACGTGGGTTTCAGTACATTTATCTGACTGACGAAGACTATTCTCGTATTGCCTCTTCTGTTATAGCACATAAGCTGCAGTTAGATAGTGGTGAGGTTAGGTGGATTATTGACTCTGTTGTGGGCAAGGAGGATGGACTTGGTGTGGAGAAT ATA CATGGAAGTGCTGCTATCGCCAGTGCTTATTCTAGGGCATATGAGGAGACATTTACACTTACATTCGTGTCTGGACGCACTGTTGGAATAGGAGCTTATCTTGCTCGACTTGGTATACGATGCATACAGCGTCTCGACCAGCCTATTATTTTGACAGGGTATTCTGCCTTGAACAAGCTTCTCGGGCGGGAAGTGTACAGCTCCCATATGCAGTTGGGTGGTCCCAAGATCATGGCGACTAATGGTGTTGTCCACCTGACTGTTTCAGATGACCTTGAAGGCATTTCTAGCATATTGAAGTGGCTCAGTTATGTTCCTGCAAACATAGGCGGAGCTCTTCCTATTACTAATCCTTTGGACCCACCGAACAGACCTGTTGCATATATCCCTGAGAACACATGTGATCCTCGTGCAGCAATCCGCGGTGTTGATGACGGTCAAGGGCAATGGTTGGGTGGTATGTTTGACAAAGACAGCTTTGTGGAGACATTTGAAGGATGGGCTAAAACGGTTGTTACTGGCAGGGCAAAGCTTGGAGGGATACCAGTTGGTGTGATTGCTGTGGAGACACAGACCATGATGCAGCTCGTCCCTGCTGATCCAGGCCAGCTTGATTCTCATGAGAGATCTGTTCCTCGGGCTGGACAAGTG TGG TTCCCAGATTCAGCAACCAAGACAGCTCAGGCATTGTTGGACTTCAACCGTGAAGGATTACCTTTGTTCATCCTTGCTAAC TGGAGAGGCTTCTCTGGTGGACAAAGAGATTTGTTTGAAGGA ATT CTTCAGGCTGGGTCAACAATTGTCGAGAACCTTAGGACATATAATCAGCCAGCATTTGTCTATATTCCCATGGCTGGAGAGCTACGTGGAGGAGCTTGGGTCGTAGTT GAT AGCAAAATAAATCCGGACCGCATTGAG T GT TATGCTGAGAGGACAGCAAAA GGC AATGTTCTTGAACCTCAAGGGTTAATTGAAATCAAGTTCAGGTCGGAGGAACTCCAAGACTGTATGGGTAGGCTTGACCCAGAGTTGATAAATTTGAAAGCAAAACTCCAAGGTGCAAAGCTTGGAAATGGAAATTC (SEQ ID NO: 17).

[0046] The underlined gray background indicates the mutation site.

[0047] Wild-type standard plasmid S and standard plasmids R1-R4 containing each mutation site were synthesized by Geneplus.

[0048] Example 1

[0049] High-resolution melting (HRM) is a novel gene analysis technique based on the different melting curves formed by single nucleotides at different melting temperatures. It boasts extremely high sensitivity, capable of detecting differences in individual bases, and is characterized by low cost, high throughput, speed, accuracy, and independence from detection site limitations. It plays a crucial role in mutation scanning, single nucleotide polymorphism analysis, methylation studies, genotyping, and sequence matching. Its specific principle is as follows:

[0050] Fluorescent signal labeling: Saturated fluorescent dyes are used. These dyes only bind to double-stranded DNA (dsDNA) and emit strong fluorescence. When they bind to single-stranded DNA (ssDNA), the fluorescence signal is significantly weakened.

[0051] Precise temperature gradient control: The DNA sample after PCR amplification is heated at an extremely slow rate (0.025-0.5℃ / s) to cover the temperature range of DNA denaturation (usually 50-95℃).

[0052] High-resolution signal acquisition: The instrument continuously monitors changes in fluorescence intensity. Due to the different double-strand stability of DNA sequences (such as differences in base composition, mutations, methylation, etc.), the Tm value and fluorescence decline curve morphology during unwinding will differ. Finally, sequence analysis is achieved by comparing the curve morphology.

[0053] This embodiment presents a high-resolution melting curve (HRM) multiplex detection scheme designed to address various resistance mechanisms of the ACCase gene in *Eleusine indica*. Figure 1 As shown, this scheme can achieve efficient amplification of the ACCase gene in a two-tube reaction.

[0054] (1) Based on the above scheme, the ACCase gene of Eleusine indica was analyzed by bioinformatics, and based on this, the following HRM primer pairs were designed, as shown in Table 2 below.

[0055] Table 2 shows the designed HRM primer pairs.

[0056]

[0057] (2) Synthesize the above primers and configure the detection system.

[0058] (2.1) The configuration system of 10X Assay is shown in Table 3 below:

[0059] Table 3 10X Assay Configuration System

[0060]

[0061] (2.2) The reaction system is shown in Table 4 below:

[0062] Table 4 Reaction System

[0063]

[0064] *The genomic DNA (nucleic acid sample) of *Eleusine indica* used in this experiment was extracted using a high-efficiency plant genomic DNA extraction kit (TIANGEN, DP350-02);

[0065] (2.3) The reaction procedure is shown in Table 5 below:

[0066] Table 5 Reaction Procedure

[0067]

[0068] Five artificially synthesized standard plasmids (S, R1, R2, R3, and R4, synthesized by a gene company, where S represents the wild-type plasmid, and R1, R2, R3, and R4 represent mutant plasmids containing different mutation sites) were used. The amplification results are as follows: Figures 2-5 As shown, the genotyping results are as follows:Figures 6-7 As shown in the figure; the results are output as shown in Table 6 below:

[0069] Table 6 HRM Test Results

[0070]

[0071] Note: Underline indicates mutation, "#" means it can be correctly classified, and "*" means it cannot be correctly classified; Variant: mutant type.

[0072] As shown in Table 6, reaction system 1 can identify R2, R3, and R4 mutations, but cannot distinguish R1 mutations; reaction system 2 can identify R1, R2, R3, and R4 mutations; considering that R1, R2, R3, and R4 are artificially synthesized plasmids containing multiple mutation sites, whether reaction system 2 can distinguish single point mutations needs further verification.

[0073] Example 2

[0074] Multicolor Melting Curve Analysis (MMCA) is a nucleic acid detection method based on multicolor fluorescent probes. It involves designing specific probes with different melting temperatures (Tm values), detecting the product after PCR amplification by heating the product, and monitoring the changes in fluorescence signal during probe dissociation from the target sequence in real time. This allows for the simultaneous differentiation of multiple targets in a single-tube reaction. The specific principle is as follows:

[0075] Specific probe design: For multiple different target sequences, corresponding specific probes are designed. The probes usually have fluorescent groups of different wavelengths (such as FAM, VIC, etc.), and the Tm values ​​of each probe after binding to the target sequence are significantly different (generally differing by more than 3-5℃).

[0076] Single-stranded templates were generated using asymmetric PCR.

[0077] Probe-target sequence binding: After PCR amplification, the probe in the system specifically binds to the corresponding target DNA single-strand template. At this time, the fluorescent group is in a stable state and emits a fluorescent signal of a specific wavelength.

[0078] Gradient heating and signal monitoring: The temperature is increased at a slow rate. When the temperature reaches the Tm value of a certain probe, the probe dissociates from the target DNA, and the corresponding fluorescence signal rapidly decreases. Different probes, due to their different Tm values, will show a decrease in fluorescence signal in different temperature ranges, forming a characteristic melting peak.

[0079] Multi-signal synchronous analysis: The instrument simultaneously acquires fluorescence signals of different wavelengths, plots the melting curve (or melting peak) corresponding to each probe, and determines the presence and type of the corresponding target sequence by the position (Tm value) and presence or absence of the peak.

[0080] This embodiment presents a multiplex detection scheme designed using the melting curve multiplex probe technique (MMCA) to address various resistance mechanisms of the ACCase resistance gene in *Eleusine indica*. This solves the problems of not being able to distinguish the Ile1781 site and determine the mutation site in Embodiment 1. The scheme design is as follows: Figure 8 This design uses a pair of primers and seven probes to detect seven sites.

[0081] (1) Based on the above design scheme, the following primer and probe sets were designed, as shown in Table 7 below:

[0082] Table 7 Designed MMCA primer and probe set

[0083]

[0084] (2) Synthesize the above primers and probes;

[0085] (2.1) Single tube single verification results

[0086] First, a single-site detection of the Ile1781 site was performed. The reaction system and reaction procedure are shown in Table 8-10 below. The primers ACC-MMCA-1F / 1R (component one) could not amplify normally, so the primers ACC-MMCA-2F / 2R (component two) were redesigned and tested again.

[0087] a. The reaction components of the 10x Assay are shown in Table 8 below:

[0088] Table 8 10x Assay Reaction Components

[0089] b.

[0090] c. The reaction system is shown in Table 9:

[0091] Table 9 Reaction System

[0092] d.

[0093] e. The reaction procedure is shown in Table 10:

[0094] Table 10 Reaction Procedure

[0095]

[0096] The results are as follows Figure 9As shown, the melting curve is single with no extraneous peaks, and the mutation can be accurately detected. Table 11 shows that the Tm values ​​of plasmids Ile1781-R1 / Ile1781-R2 / Ile1781-R3 / Ile1781-R4 are all lower than the Tm value of standard plasmid S, and are around 0.8℃. Therefore, the single-tube detection system for the Ile1781 site is effective, and ACC-MMCA-2F / 2R will be used as primers for subsequent tests.

[0097] Table 11 Unit Point Verification of Ile1781

[0098]

[0099] Note: Underlined text indicates a mutation.

[0100] Therefore, the following criteria for judging test results were established:

[0101] Each experiment requires at least one wild-type control, one positive control, and one template-free control. The wild-type control can use a synthetically produced standard plasmid without the ACCase gene mutation (e.g., S, synthesized by [company name], sequence as shown in SEQ ID NO: 17). The positive control can use a synthetically produced standard plasmid containing the ACCase gene mutation or genomic nucleic acid from *Eleusine indica* plants (e.g., R1, R2, R3, R4, synthesized by [company name]). The template-free control can use enzyme-free water.

[0102] Criteria for determining mutation:

[0103] Compared with the Tm value of the wild-type control (standard plasmid S), if the absolute value of the difference between the Tm value of the target corresponding to the positive control and the Tm value of the wild-type control (standard plasmid S) is greater than 0.8, it is judged as a mutation; if it is less than 0.8, it is judged as no mutation.

[0104] (2.2) Single-tube quadruple validation results

[0105] The system covers four mutation sites: Trp1999, Trp2027, Ile2041, and Cys2088. The reaction components are shown in Table 12 below. The reaction system and reaction procedure are the same as those in Tables 9-10 above. The system was validated on five standard plasmid samples (S, R1, R2, R3, R4) and two tested *Eleusine indica* genomic DNA (gDNA) samples (WT1 / WT2, which were identified and preserved in the laboratory).

[0106] Table 12 10x Assay Reaction Components

[0107]

[0108] The results show that ( Figure 10The melting curve is single and free of impurity peaks, allowing for accurate detection of mutations. Therefore, the single-tube quadruple detection system for the four mutation sites Trp1999, Trp2027, Ile2041, and Cys2088 is effective. Further research could focus on increasing the number of sites detectable in a single tube.

[0109] (2.3) Single-tube sevenfold verification results

[0110] This system covers seven mutation sites of the ACCase gene and was validated on five standard plasmid samples (S / R1 / R2 / R3 / R4). The reaction components are shown in Table 13 below, and the reaction system and procedure are the same as those in Tables 9 and 10 above. The results are shown in the figure. Figures 11-12 The melting peaks of sites with low Tm values ​​in the FAM and CY5 channels were not obvious, making it impossible to effectively detect Asp2078 and Gly2096 sites in a single tube system. Therefore, the detection effect of the single tube seven-fold system was not good, and further attempts were made to try the amplification conditions of the dual tube system.

[0111] Table 13 10x Assay Reaction Components

[0112]

[0113] (2.4) Results of dual-tube sevenfold verification

[0114] To address the issue of indistinct melting peaks at sites with low Tm values ​​in the FAM and CY5 channels in a single-tube seven-reaction system, drug resistance mutation sites in the ACCase gene were screened in two tubes. Primers and probes are shown in Table 15. Reaction component 1 (see Table 16 below) detected five mutation sites: Ile1781, Trp1999, Trp2027, Ile2041, and Cys2088. Reaction component 2 (see Table 16 below) detected two mutation sites: Asp2078 and Gly2096. The results were validated again using five standard plasmid samples (S / R1 / R2 / R3 / R4) and two test samples (WT1 / WT2) (reaction system and procedure are shown in Tables 17-18 below). The results showed ( Figures 13-14 The detection channels corresponding to reaction tube 1 and reaction tube 2 showed obvious melting curve peaks, indicating good amplification and good probe binding. Five standard plasmids (S / R1 / R2 / R3 / R4) and two test samples (WT1 / WT2) were genotyped. The Tm value of standard plasmid S was used as the standard. If the absolute value of the difference between the corresponding target Tm value and the standard plasmid S was greater than 0.8, it was judged as a mutation. If it was less than 0.8, it was judged as no mutation.

[0115] As shown in Table 14, based on the Tm value of standard plasmid S, all target sites could be correctly genotyped; however, among the test sites in the tested samples, the Asp2078 site was identified as a mutation. Further sequencing of the Accase gene in the tested samples (WT1 / WT2) was performed to verify this, and the sequencing results ( Figures 15-16 The results showed that there was a mutation at the Asp2078 site in the test samples (WT1 / WT2), with the base changing from GAT to GGT. The mutated base and Tm value corresponded to the base and Tm value at the Asp2078 site of the standard plasmid R1. Therefore, the detection system constructed was accurate.

[0116] Table 14 Results of Dual-Tube Seven-Stage Testing

[0117]

[0118] From the above, the optimal conditions for MMCA technology to detect the seven drug resistance sites of the ACCase gene in *Eleusine indica* are:

[0119] Table 15 Primers and Probes

[0120]

[0121] The concentrations and amounts of each component in the nucleic acid amplification reagent are as follows:

[0122] Table 16 Concentrations and Doses of Each Component in the Primer-Probe Premix Solution

[0123]

[0124] The reaction system was prepared using the aforementioned nucleic acid amplification reagent, and the amounts of each component are as follows:

[0125] Table 17 Reaction Tube Configuration System

[0126]

[0127] When performing qPCR amplification using the aforementioned nucleic acid amplification reagent, the amplification program used is as follows:

[0128] Table 18 MMCA Amplification Procedure

[0129]

[0130] The above description is only a non-limiting embodiment of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the inventive concept of the present invention and without creative effort, and these all fall within the protection scope of the present invention.

Claims

1. A primer probe for detecting mutations in the ACCase gene of *Eleusine indica*, characterized in that, The primers and probes are shown below: 。 2. A kit for detecting ACCase gene mutations in *Eleusine indica*, characterized in that, It includes nucleic acid amplification reagents, wherein the nucleic acid amplification reagents include the primers and probes as described in claim 1.

3. The reagent kit according to claim 2, characterized in that, The concentrations and amounts of each component in the nucleic acid amplification reagent are as follows: 。 4. The reagent kit according to claim 3, characterized in that, The reaction system was prepared using the aforementioned nucleic acid amplification reagent, and the amounts of each component are as follows: 。 5. The reagent kit according to claim 2, characterized in that, When performing qPCR amplification using the aforementioned nucleic acid amplification reagent, the amplification program used is as follows: 。 6. The use of the primers and probes of claim 1 or the kit of any one of claims 2-5 in the detection of ACCase mutations in the herb *Eleusine indica* resistance gene or in the preparation of drugs for detecting ACCase mutations in the herb *Eleusine indica* resistance gene.

Images