Aptamer-based staphylococcus aureus biosensor and preparation method thereof

By combining fluorine-modified nucleic acid aptamers with graphene, the problem of insufficient sensitivity and specificity of existing biosensors in detecting Staphylococcus aureus is solved, achieving efficient and stable detection results, and making it suitable for rapid detection of food and environmental samples.

CN121805583AActive Publication Date: 2026-04-07FOOD INSPECTION CENT OF CIQ SHENZHEN

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-04
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Existing nucleic acid aptamer-based biosensors have insufficient sensitivity and specificity when detecting Staphylococcus aureus, especially in complex sample matrices, where they are prone to false positives.

Method used

The fluorine-modified nucleic acid aptamer 2'F3- (5'3' mDNA) is bound to graphene and adsorbed onto the graphene surface through π-π stacking and hydrophobic interactions, increasing the binding force and restoring fluorescence after the target molecule binds, thus reducing false positives.

Benefits of technology

It improves the sensitivity and specificity of detection, reduces false positives, and enhances the stability and reproducibility of the sensor, making it suitable for rapid and efficient detection of food, body fluids, and environmental samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121805583A_ABST
    Figure CN121805583A_ABST
Patent Text Reader

Abstract

The invention discloses a staphylococcus aureus biosensor based on a nucleic acid aptamer and a preparation method of the staphylococcus aureus biosensor. Three fluorine atoms (F) are introduced into the 5'end, the 3 'end and the middle position of an aptamer 2' F3-(5 '3'm DNA) sequence (SEQ ID NO: 1) for modification, so that the binding force of the aptamer and graphene is remarkably enhanced, the signal stability and the anti-interference capability of the biosensor are remarkably improved, non-specific fluorescence leakage can be effectively blocked, and reliable guarantee is provided for complex sample detection. According to the present invention, with the cooperation of the graphene oxide quenching substrate, the high-sensitivity detection of the staphylococcus aureus is achieved, the detection limit of the sensor within 5 min can achieve 5 cells / mL, the sensitivity is high, the specificity on the complex sample is more than 95.4%, and the sensor is suitable for the food safety rapid screening and the clinical diagnosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biosensor technology, specifically to a Staphylococcus aureus biosensor based on nucleic acid aptamers and its preparation method. Background Technology

[0002] Staphylococcus aureus is a common foodborne pathogen, widely found in the natural environment and in the human body. Its enterotoxins are highly heat-resistant and easily cause acute food poisoning. Traditional detection methods, such as culture methods and PCR technology, are time-consuming, complex, and costly. In recent years, nucleic acid aptamer-based biosensors have become a research hotspot due to their high specificity, rapid response, and low cost. However, the sensitivity and selectivity of existing nucleic acid aptamer sensors still need improvement, especially in complex sample matrices where their performance is unsatisfactory.

[0003] Nucleic acid aptamers are essentially oligonucleotide sequences that, through their specific three-dimensional structures, can bind to targets with high specificity and high affinity, showing promising application prospects in the detection of foodborne pathogens. Currently, aptamer-based detection is playing an increasingly important role in this field. Some studies have reported the use of thiolized aptamers bound to the surface of noble metal nanoparticles for target detection; this method boasts high sensitivity and specificity, but its preparation cost and procedures are complex. Other studies have reported the use of graphene as a carrier to adsorb fluorescently labeled nucleic acids, which then bind to and detach from the target analyte, achieving fluorescent detection. This method is simple to prepare, highly sensitive, and has been rapidly applied and developed. In addition, various "competitive" methods for the early detection of targets have been reported, such as Au nanoflares, DNA nanostructures, and two-dimensional carbon materials. Among the reported detection methods, graphene (GO) carbon materials have become a good platform for constructing "competitive" biosensors due to their simple preparation and convenient operation. Specifically, fluorescently labeled DNA strands are bound to graphene to form a DNA / GO nanoplatform. Graphene is a quencher that can quench the fluorescence of DNA. When it comes into contact with complementary sequences, specifically binding proteins, or bacteria, the adsorbed target hybridizes with the complementary sequence, inducing the fluorescently labeled nucleic acid to detach from the graphene, restoring fluorescence, and enabling the detection of the target mRNA. Therefore, a well-designed "competitive" detection method based on graphene detection can achieve rapid and efficient detection of foodborne pathogens.

[0004] However, with the research and exploration of the preparation and detection process of the DNA / GO nanoplatform, researchers have discovered that the difference in binding affinity between GO and DNA can cause false positives in the detection process. Specifically, the binding affinity between nucleic acids and GO gradually increases with the increase of the recognition site. For some fluorescently labeled nucleic acids, the binding affinity to GO is weak, causing detachment during desorption and detection, resulting in false positives. Therefore, how to reduce false positives in the detection process of the DNA / GO nanoplatform and further improve its specificity has become a key focus of DNA / GO nanoplatform research.

[0005] During the research process, the applicant discovered that the introduction of F atoms into nucleic acid sequences generates repulsive interactions between F and P atoms; simultaneously, it induces the formation of a hydration layer around the nucleic acid. These two forces further disrupt the original equilibrium state of the stacked and entangled nucleic acids, exposing more binding sites and increasing their binding force with target molecules. We hypothesize that F-modified nucleic acid aptamers, as target molecules, can firmly adsorb and bind to graphene due to their strong binding force. When they bind to the target bacteria, fluorescence is restored, enabling specific detection of the target bacteria. Throughout the detection process, this significantly reduces detection interference and false positives, making it possible to establish a detection platform that was previously difficult to implement. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a biosensor for Staphylococcus aureus based on nucleic acid aptamers and its preparation method. The biosensor has a stronger hybridization ability with pathogenic bacteria. After the two are combined, they can be effectively detached from the GO surface, recover fluorescence, improve the sensitivity and specificity of detection, and also have better stability, which can improve the reproducibility of the sensor.

[0007] This invention is implemented as follows: A biosensor for Staphylococcus aureus based on nucleic acid aptamers, comprising: Fluorine-modified nucleic acid aptamer 2'F3- (5'3' mDNA): t / i2fa / gctcactcattaggcactcgagagggtactcggggc / i2fg / tgcgatgattttgccttcatgcatagttaagccagc / i2fc / , the specific sequence is shown in SEQ ID NO:1. The 3' and 5' ends of the nucleic acid aptamer, as well as the middle of the nucleic acid, are modified with 3 F atoms; the 5' end also contains a fluorescent group; The sequence of SEQ ID NO:1 is: tagctcactcattaggcactcgagagggtactcggggcgtgcgatgattttgccttcatgcatagttaagccagcc, where the three fluorine atom modification sites are specifically: the 2'-five-membered ring position of the 5' end 2nd base (adenine, A), the middle 39th base (guanine, G), and the 3' end 76th base (cytosine, C); Graphene, used as a fluorescence quenching substrate, has a lateral size of 100-300 nm. The nucleic acid aptamer 2'F3-(5'3'mDNA) is adsorbed onto the graphene surface through π-π stacking and hydrophobic interactions.

[0008] Furthermore, the fluorine atom modification is located at the 2' position of the five-membered ring of the nucleic acid sequence bases.

[0009] Furthermore, the fluorescent group is FITC.

[0010] Furthermore, the graphene is graphene oxide, and the dispersion concentration is 0.05-0.2 mg / mL.

[0011] Furthermore, a method for preparing the biosensor includes the following steps: S1: Synthesize fluorescently labeled nucleic acid aptamers modified with fluorine atoms; S2: Preparation of graphene oxide dispersion; S3: Mix the aptamer and graphene in a 250-350 mM NaCl solution at a molar ratio of 1:30-1:70 and incubate for 30 min.

[0012] Furthermore, the incubation conditions are room temperature (20-25°C) and protection from light.

[0013] Furthermore, a method for detecting Staphylococcus aureus, employing the aforementioned biosensor, includes: Add the sample to be tested into the sensor system and react at 37℃ for 5-20 min; The fluorescence intensity change was measured at excitation wavelengths of 490-500 nm and emission wavelengths of 515-520 nm.

[0014] Furthermore, the samples are food, bodily fluids, or environmental samples, and require pretreatment by centrifugation or filtration.

[0015] The present invention has the following advantages: This invention utilizes the fluorine-modified nucleic acid aptamer 2'F3-(5'3'mDNA), which has more binding sites, significantly increasing its binding affinity to graphene (GO) and preventing non-specific detachment, thus effectively reducing false positives during detection. Simultaneously, the 2'F3-(5'3'mDNA) sequence exhibits stronger hybridization ability with pathogenic bacteria; after binding, it can effectively detach from the GO surface, restoring fluorescence and improving detection sensitivity and specificity. 2'F3-(5'3'mDNA) also demonstrates better stability, improving sensor reproducibility. Therefore, this method offers significant advantages in terms of ease of preparation and high sensitivity, whether for laboratory construction and analysis or further commercial application. Attached Figure Description

[0016] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0017] Figure 1 This is a schematic diagram illustrating the preparation of a Staphylococcus aureus biosensor 2'F3-(5'3'mDNA) / GO based on nucleic acid aptamers according to the present invention.

[0018] Figure 2 The diagram shows the morphology, particle size, and potential of GO under different treatment conditions in the embodiments of the present invention, wherein (a) transmission electron microscopy of GO; (b) scanning electron microscopy of GO; (c) atomic force microscopy of 2'F3-(5'3'mDNA) / GO; (d) particle size of GO; and (e) changes in surface charge of GO treated with different concentrations of NaCl.

[0019] Figure 3 The fluorescence values ​​of the supernatant after graphene and fluorine-modified DNA (reDNA, 2'F1-(5'DNA), 2'F2-(5'3'DNA), 2'F3-(5'3'mDNA)) were treated with different concentrations of NaCl in this embodiment of the invention.

[0020] Figure 4 The fluorescence values ​​of the supernatant after the same concentration of GO binds to different concentrations of fluorine-modified DNA (reDNA, 2'F1-(5'DNA), 2'F2-(5'3'DNA), 2'F3-(5'3'mDNA)) in the embodiments of the present invention are shown in the fluorescence diagram.

[0021] Figure 5 The fluorescence recovery changes of reDNA / GO, 2'F1-(5'DNA) / GO, 2'F2-(5'3'DNA) / GO, and 2'F3-(5'3'mDNA) / GO prepared in the embodiments of the present invention, when redispersed in HEPES.

[0022] Figure 6This is a schematic diagram of the interaction forces between fluorine-modified DNA (reDNA, 2'F1-(5'DNA), 2'F2-(5'3'DNA), 2'F3-(5'3'mDNA)) and GO in the embodiment of the present invention, wherein (a) is a graph showing the change in the number of hydrogen bonds over time; and (b) is a graph showing the change in the number of π-π stackings over time.

[0023] Figure 7 This is 2'F in the embodiment of the present invention. 3- Working curve and specificity test diagram of the (5'3'mDNA) / GO biosensor for Staphylococcus aureus; where (a) is the working curve of the biosensor (concentration-fluorescence change); and (b) is the specificity test diagram. Detailed Implementation

[0024] The following will be combined with the appendix Figure 1-7 The technical solution of the present invention will be clearly and completely described in detail with specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0025] Example 1 1. Instruments and reagents: Cary Eclipse fluorescence spectrometer (Agilent Technologies, Cary 3500); graphene (Nanjing Pioneer); fluorine-modified DNA (Shanghai Sangon Biotech); AmberTools20 software; Salmonella paratyphi A, Staphylococcus aureus, Bacillus thuringiensis, enterotoxigenic Escherichia coli K88, Salmonella choleraesuis (Fangjue Biotechnology); 4-hydroxyethylpiperazine ethanesulfonic acid (HEPES, pH=7.6, 2 M), broad-spectrum non-restrictive nuclease, fetal bovine serum (FBS) (Beyotime Technology); Zeta potential and nanoparticle size analyzer (McMed Instruments, Inc.); ultra-high resolution field emission scanning electron microscope, transmission electron microscope, ion sputtering instrument; atomic force microscope (Bruker, Inc.).

[0026] This embodiment uses *Staphylococcus aureus* as the research model and dispersed graphene nanosheets (GO) and the *Staphylococcus aureus* nucleic acid aptamer 2'F3-(5'3'mDNA), which can be synthesized using conventional solid-phase phosphoramide synthesis methods in the art, as the original construction materials. A biosensor platform for detecting foodborne pathogens based on functional nucleic acids is constructed step-by-step through the following four steps: A small amount of graphite is dispersed in a solvent using a solvent exfoliation method to form a low-concentration dispersion. Ultrasonic waves are used to disrupt the van der Waals forces between the graphite layers, allowing for layer-by-layer exfoliation to prepare graphene. Its morphology and physical properties are characterized by TEM, and products with uniform nanosheet particle size distribution and a size below 100-150 nm are selected. Then, a 100 μg / mL GO dispersion is prepared and incubated with 2'F3-(5'3'mDNA) in NaCl solution to obtain the 2'F3-(5'3'mDNA) / GO biosensor detection platform, further enabling rapid and specific monitoring of *Staphylococcus aureus*.

[0027] Specifically, such as Figure 1 As shown, the DNA sequence 2'F3-(5'3'mDNA) modified with three Fs, the nucleic acid aptamer of Staphylococcus aureus, is combined with graphene (GO) to obtain a 2'F3-(5'3'mDNA) / GO biosensor for the detection of Staphylococcus aureus.

[0028] Comparison sequences: The following comparative sequence was used to optimize experimental conditions and explore and determine the optimal method for preparing biosensors: tagctcactcattaggcactcgagagggtactcggggcgtgcgatgattttgccttcatgcatagttaagccagcc, Nucleic acid aptamer unmodified; 5' fluorescent group; The above sequence is simplified as (reDNA).

[0029] t / i2fa / gctcactcattaggcactcgagagggtactcggggcgtgcgatgattttgccttcatgcatagttaagccagcc, 5' end of the nucleic acid aptamer is modified with one F atom; 5' fluorescent group; the above sequence is simplified as (2'F1-(5'DNA)).

[0030] t / i2fa / gctcactcattaggcactcgagagggtactcggggcgtgcgatgattttgccttcatgcatagttaagccagc / i2fc / , 3' and 5' ends of the nucleic acid aptamer are modified with two F atoms; 5' fluorescent group; the above sequence is simplified as (2'F2-(3'5'DNA)).

[0031] 2. Morphology, particle size, and potential testing Experimental methods: (1) Potential testing process: ① DNA sequences of different sequences (reDNA, 2'F1-(5'DNA), 2'F2-(5'3'DNA), 2'F3-(5'3'mDNA)) were dissolved in sterile water to form a DNA solution of 400 nM; ② Graphene was dispersed in HEPES (pH=7.6) solution to prepare a GO dispersion of 100 μg / mL; different concentrations of NaCl (0, 50, 100, 150, 200, 250, 300 mM) were mixed with the GO dispersion of 100 μg / mL and reacted in the dark for 2 h to obtain a sample solution; ③ 1 mL of DNA with different sequences and GO samples treated with NaCl were placed in the sample cell and their potential changes were measured respectively.

[0032] (2) Particle size test process: Graphene was dispersed in HEPES (pH=7.6) solution to prepare a GO dispersion of 100 μg / mL, which was recorded as the sample solution; 1 mL of sample was placed in the sample cell and the particle size change of the graphene dispersion was measured.

[0033] (3) Transmission electron microscopy test procedure: After ultrasonic dispersion of graphene, 20 μL of sample was dropped onto a carbon film copper grid, left for 3-5 min, excess moisture was absorbed with filter paper, and dried at room temperature. Observation was performed under a transmission electron microscope, and images were collected for analysis.

[0034] (4) Atomic force microscopy test process: After the graphene and DNA mixed sample is ultrasonically dispersed, 20 μL of the sample is dropped onto the mica substrate, placed for 3-5 min, and dried; observed under an atomic force microscope, and images are collected for analysis.

[0035] (5) Place the graphene sample tightly onto the conductive carbon film double-sided adhesive and put it on the sample stage of the ion sputtering instrument for about 30 seconds to sputter gold. Observe under a scanning electron microscope and collect images for analysis.

[0036] For details, please refer to [link / reference]. Figure 2 ,from Figure 2From the above, it can be seen that: (a) transmission electron microscopy and (b) scanning electron microscopy can observe monodisperse GO nanomaterials; (c) is 2'F3-(5'3'mDNA) / GO atomic force microscopy, which can observe that nucleic acid aptamers have been successfully adsorbed and uniformly dispersed on the GO surface; particle size distribution ( Figure 2 (d) indicates that the particle size of GO is mainly concentrated in the 100-200 nm range, exhibiting a narrow single-peak distribution, indicating that GO has good particle size uniformity, which can effectively avoid performance fluctuations in the composite system caused by particle size inhomogeneity; Zeta potential test ( Figure 2 As shown in (e), GO has a strong negative charge of about -30 mV in the pure water system. As the NaCl concentration increases, the absolute value of the Zeta potential gradually decreases, but always remains negative, indicating that the system can still maintain stability in a high-salt environment. It also reveals that the binding of nucleic acid aptamers to GO mainly depends on non-electrostatic interactions such as π-π stacking and hydrophobic interactions.

[0037] 3. Optimization of experimental conditions for the fabrication of the 2'F3-(5'3'mDNA) / GO biosensor (1) Optimization process of GO adsorption capacity on DNA under different NaCl concentrations Experimental Methods: FITC fluorescence at 400 nM and fluorine-modified DNA (reDNA, 2'F1-(5'DNA), 2'F2-(5'3'DNA), 2'F3-(5'3'mDNA)) were dispersed in 5 mM HEPES at 100 μg / mL. The mixture was thoroughly mixed. NaCl was added to the above solution to adjust the concentration to 0, 50, 100, 150, 200, 250, and 300 mM. The reaction was carried out under light-protected conditions for 2 h. The precipitate was removed at 15000 rpm to obtain the supernatant sample. 1 mL of the supernatant sample was taken, and the fluorescence change was measured using a fluorescence spectrometer. For details, please refer to [link to relevant documentation]. Figure 3 .

[0038] from Figure 3 It can be seen that GO treated with 300 mM NaCl can effectively shield the negative charge on the graphene surface, which is more conducive to the binding of DNA and GO.

[0039] (2) Optimization process of graphene adsorption capacity for DNA Experimental Methods: GO was dispersed in a mixed solution of 50 mM HEPES and 300 mM NaCl to prepare a 100 μg / mL GO dispersion. Different concentrations of fluorine-modified DNA (reDNA, 2'F1-(5'DNA), 2'F2-(5'3'DNA), 2'F3-(5'3'mDNA)) (0, 50, 100, 150, 200, 250, 300, 400, 500 nM) were added to the above mixture, and the reaction was carried out in the dark for 2 h. The solution was centrifuged at 15000 rpm to collect the precipitate, and the supernatant was recorded as the sample solution. 1 mL of the supernatant sample was taken, and the fluorescence change was measured using a fluorescence spectrometer. For details, please refer to [link to relevant documentation]. Figure 4 .

[0040] from Figure 4 It can be seen that the maximum nucleic acid concentration adsorbed on the surface of a 100 μg / mL GO dispersion is 400 nM.

[0041] (3) Optimization process for testing the release performance of fluorine-modified DNA Experimental Methods: 100 μg / mL GO and 400 nM DNA (reDNA, 2'F1-(5'DNA), 2'F2-(5'3'DNA), 2'F3-(5'3'mDNA)) were dispersed in 5 mM HEPES. NaCl was mixed with the above solution to adjust the NaCl concentration to 300 mM, and the reaction was carried out in the dark for 2 h. The mixture was centrifuged at 15000 rpm for 10 min to obtain the precipitate. The precipitate was redispersed in 5 mM HEPES without adding NaCl, and this was used as the sample to be tested. 1 mL of the sample was taken, and the fluorescence in the solution was measured over time using a fluorescence spectrometer. For details, please refer to [link to relevant documentation]. Figure 5 .

[0042] from Figure 5 As can be seen from the above, the prepared fluorine-modified DNA / GO (reDNA / GO, 2'F1-(5'DNA) / GO, 2'F2-(5'3'DNA) / GO, 2'F3-(5'3'mDNA) / GO) were redispersed in HEPES. The fluorescence gradually increased over time, indicating that the nucleic acids adsorbed on the GO surface were gradually released. At the same time, it can be observed that as the number of F atoms increases, the binding force between nucleic acids and GO becomes stronger, effectively reducing the self-release performance.

[0043] (4) Optimization process of studying the interaction mechanism between fluorine-modified DNA and GO Experimental Procedure: Hydrogen bonding and π-π interactions were simulated and verified using AmberTools20. See details in the attached document. Figure 6 , Figure 6It is a molecular dynamics simulation of the interaction forces between fluorine-modified DNA (reDNA, 2'F1-(5'DNA), 2'F2-(5'3'DNA), 2'F3-(5'3'mDNA)) and GO.

[0044] from Figure 6 It can be seen that fluorine-modified DNA (reDNA, 2'F1-(5'DNA), 2'F2-(5'3'DNA), 2'F3-(5'3'mDNA)) binds to GO; the binding force between nucleic acid and GO increases with the number of F atoms. Therefore, 2'F3-(5'3'mDNA) and GO are chosen for preparing sensors for practical applications.

[0045] (5) Operating curve of 2'F3-(5'3'mDNA) / GO biosensor Experimental Procedure: ① Preparation of the 2'F3-(5'3'mDNA) / GO sensor: 100 μg / mL GO and 400 nM 2'F3-(5'3'mDNA) were dispersed in 5 mM HEPES and 300 nM NaCl, and reacted in the dark for 2 h. Then, the supernatant was removed by centrifugation at 15000 rpm for 10 min. The precipitate was dispersed in a solution of 1 mg / mL bovine serum albumin (BSA) containing 300 mM NaCl and 5 mM HEPES, and reacted overnight. The reaction system was then centrifuged at 10000 rpm for 10 min to obtain the 2'F3-(5'3'mDNA) / GO biosensor. ② Calibration of the working curve of the 2'F3-5'3'mDNA / GO sensor: The prepared 2'F3-(5'3'mDNA) / GO biosensor (Staphylococcus aureus) was subjected to different concentrations of bacteria (10... 3 cells / mL-10 9 (cells / mL), and measure the change in fluorescence. Obtain the concentration-fluorescence change curve, i.e., the working curve. ③ Specificity study of the 2'F3-(5'3'mDNA) / GO sensor: The prepared 2'F3-(5'3'mDNA) / GO biosensor was supplemented with the following bacteria: Salmonella paratyphi A, Staphylococcus aureus, Bacillus thuringiensis, enterotoxigenic Escherichia coli K88, and Salmonella choleraesuis (concentration 10). 7 (cells / mL); then the two mixtures were reacted thoroughly for 30 min, centrifuged at 15000 rpm for 10 min, and the precipitate was removed. Subsequently, the recovery of fluorescence in the supernatant was measured. See details... Figure 7 .

[0046] from Figure 7As can be seen from the data, 2'F3-(5'3'mDNA) / GO yields a working curve that meets the actual detection requirements, and the detection limit of 5 cells / mL is obtained based on the working curve; it exhibits good specificity in actual sample monitoring.

[0047] In summary, this invention significantly enhances the binding force with graphene and improves the stability of the biosensor by introducing three fluorine atoms at the 5', 3', and middle positions of the aptamer 2'F3-(5'3'mDNA) sequence (SEQ ID NO:1). This effectively blocks non-specific fluorescence leakage, providing reliable assurance for the detection of complex samples. Combined with a graphene oxide-quenched substrate, this invention achieves highly sensitive detection of Staphylococcus aureus. The sensor achieves a detection limit of 5 cells / mL within 5 minutes, exhibiting high sensitivity and a specificity >95.4% for complex samples. It is suitable for rapid screening of food, clinical, and environmental samples.

[0048] While specific embodiments of the present invention have been described above, those skilled in the art should understand that the specific embodiments described are merely illustrative and not intended to limit the scope of the present invention. Equivalent modifications and variations made by those skilled in the art in accordance with the spirit of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. A biosensor for Staphylococcus aureus based on nucleic acid aptamers, characterized in that: include: Fluorine-modified aptamer 2'F3- (5'3' mDNA): t / i2fa / gctcactcattaggcactcgagagggtactcggggc / i2fg / tgcgatgattttgccttcatgcatagttaagccagc / i2fc / The specific sequence is shown in SEQ ID NO:

1. The 3' and 5' ends of the nucleic acid aptamer, as well as the middle of the nucleic acid, are modified with three F atoms; the 5' end also contains a fluorescent group. Graphene, used as a fluorescence quenching substrate, has a lateral size of 100-300 nm. The nucleic acid aptamer 2'F3-(5'3'mDNA) is adsorbed onto the graphene surface through π-π stacking and hydrophobic interactions.

2. The biosensor as described in claim 1, characterized in that: The fluorine atom modification is located at the 2' position of the five-membered ring of the nucleic acid sequence bases.

3. The biosensor as described in claim 1, characterized in that: The fluorescent group is FITC.

4. The biosensor as described in claim 1, characterized in that: The graphene is graphene oxide, and the dispersion concentration is 0.05-0.2 mg / mL.

5. A method for preparing a biosensor according to any one of claims 1-4, characterized in that: Including the following steps: S1: Synthesize fluorescently labeled nucleic acid aptamers modified with fluorine atoms; S2: Preparation of graphene oxide dispersion; S3: Mix the aptamer and graphene in NaCl solution at a molar ratio of 1:30-1:70 and incubate for 30 min.

6. The method as described in claim 5, characterized in that: The incubation conditions are room temperature and protection from light.

7. A method for detecting Staphylococcus aureus, characterized in that: The biosensor according to any one of claims 1-4 comprises: Add the sample to be tested into the sensor system and react at 37℃ for 5-20 min; The fluorescence intensity change was measured at excitation wavelengths of 490-500 nm and emission wavelengths of 515-520 nm.

8. The method as described in claim 7, characterized in that: The samples are food, body fluids, or environmental samples, and require pretreatment by centrifugation or filtration.

Citation Information

Patent Citations

  • Staphylococcus aureus aptamer and method for preparing detection probe by using staphylococcus aureus aptamer

    CN119307502A

  • Aptamer having specific binding ability for vaspin and Biosensor Using therof

    KR1020150117779A

  • Novel reduced graphene oxide-based aptasensor for detecting kanamycin and use thereof

    KR1020180024055A

Cited By

  • Nucleic acid aptamer-based salmonella paratyphi A biosensor and preparation method thereof

    CN121762836A

  • A biosensor for salmonella typhi based on aptamer and a preparation method thereof

    CN121762836B