Reinforcing steel bar corrosion-resistant admixture as well as preparation method and application thereof

By encapsulating NAB-Complex with zeolite imidazole ester skeleton material in reinforced concrete structures to form a dense polymer film, the durability and safety issues caused by steel corrosion are solved, achieving efficient self-healing and strength enhancement.

CN121824013APending Publication Date: 2026-04-10HOHAI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-21
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Existing reinforced concrete structures suffer from reduced durability and load-bearing capacity due to steel corrosion during service, posing safety hazards. Furthermore, common single corrosion inhibitors are insufficient to meet actual needs.

Method used

Using zeolite imidazole ester framework material as a carrier, NAB-Complex is encapsulated. Taking advantage of its high specific surface area and nano-size effect, combined with the components of benzotriazole BTA and onion extract, a dense polymer film is formed, providing a physical barrier and self-healing ability to prevent chloride ion and oxygen erosion.

Benefits of technology

It significantly improves the corrosion resistance of steel bars and the durability of concrete structures, achieves self-healing capabilities, refines the concrete pore structure, and enhances structural strength and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121824013A_ABST
    Figure CN121824013A_ABST
Patent Text Reader

Abstract

The invention discloses a steel bar corrosion-resistant admixture as well as a preparation method and a use method thereof, a zeolite imidazate framework material is used as a carrier, and NAB-Complex is packaged in a nano-scale pore channel of the zeolite imidazate framework material through a coprecipitation method. The NAB-Complex is prepared from the following materials in percentage by weight: 40 to 60 percent of nucleic acid solution, 15 to 25 percent of benzotriazole BTA, 5 to 25 percent of onion extracting solution and 5 to 10 percent of 3-dimethylamino-1-propanol. During preparation, a nucleic acid solution and an onion extracting solution are firstly activated, then benzotriazole BTA and 3-dimethylamino-1-propanol are sequentially compounded in situ, and the NAB-Complex material is constructed. Compared with an existing corrosion inhibitor, the corrosion inhibitor has the advantages that the corrosion inhibition effect is remarkably improved, meanwhile, the problem that the chemical structure of effective components is unstable is solved, and the corrosion inhibition and self-repairing capacity is achieved based on response to the pH of the environment. Meanwhile, the pore structure of the concrete can be refined, the strength is improved, and the erosion risk of harmful media is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of concrete admixtures in building materials, and particularly to a steel reinforcement rust inhibitor admixture, its preparation method, and its application. Background Technology

[0002] Reinforced concrete is one of the most widely used building materials. In actual service environments, the durability and service life of reinforced concrete are reduced due to various environmental factors, the most common of which is steel corrosion. Steel corrosion not only reduces the effective cross-sectional area of ​​the steel bars and decreases the bond strength between the steel bars and concrete, thus reducing the load-bearing capacity of the concrete structure; moreover, the volume of rust, the corrosion product of the steel bars, can be 2-10 times the original steel bar volume. This volume expansion generates huge tensile stress inside the concrete, causing longitudinal cracking and even spalling, which seriously affects the safety and durability of reinforced concrete structures, resulting in huge economic losses and safety hazards.

[0003] Common protective measures include cathodic protection, electrochemical desalination, coating, and the addition of corrosion inhibitors. Corrosion inhibitors are widely used in practical engineering due to their ease of use, high corrosion inhibition efficiency, and cost-effectiveness. However, with the rapid development of the concrete industry, single-effect corrosion inhibitors are no longer sufficient to meet practical needs. Therefore, there is an urgent need to develop efficient and environmentally friendly composite corrosion inhibitors to improve the corrosion resistance of reinforcing steel, thereby improving the durability of reinforced concrete structures. Summary of the Invention

[0004] Objectives of the invention: The first objective of this invention is to provide a steel reinforcement rust-inhibiting admixture with rust-inhibiting and self-healing capabilities that significantly improves concrete durability; the second objective of this invention is to provide a method for preparing the steel reinforcement rust-inhibiting admixture; and the third objective of this invention is to provide a method for using the steel reinforcement rust-inhibiting admixture.

[0005] To achieve the aforementioned primary objective, the technical solution for the steel reinforcement rust-inhibiting admixture provided by this invention is as follows:

[0006] This invention provides a steel reinforcement rust inhibitor, which uses zeolite imidazole ester skeleton material as a carrier. The carrier's channels are encapsulated with NAB-Complex. By mass percentage, the NAB-Complex comprises the following components: 40-60% nucleic acid solution, 15%-25% benzotriazole, 5%-25% onion extract, and 5%-10% 3-dimethylamino-1-propanol.

[0007] As a further preferred embodiment of the present invention, the concentration of the nucleic acid solution is 55 mg / L-213 mg / L. The onion extract is obtained by extraction at an onion-to-water mass ratio of 3-6:10.

[0008] As a further preferred embodiment of the present invention, the nucleic acid solution is made from deoxyribonucleic acid (DNA) powder, which is DNA containing 20-80 bases.

[0009] As a further preferred embodiment of the present invention, the role of deoxyribonucleic acid in the nucleic acid solution is mainly due to the negatively charged nature of its backbone and its paired base pair structure. Therefore, the purpose of the present invention can be achieved regardless of the base sequence.

[0010] To achieve the second objective mentioned above, the technical solution for the preparation method of the steel reinforcement rust inhibitor provided by the present invention is as follows:

[0011] The present invention provides a method for preparing the above-mentioned steel reinforcement rust inhibitor, comprising: (1) adding 2-methylimidazole solution to NAB-Complex solution, and after it is fully dissolved, adding zinc nitrate hexahydrate solution dropwise, stirring to activate and react, and obtaining the reacted solution;

[0012] (2) Centrifuge the solution after the reaction and collect the precipitate to obtain the steel reinforcement rust inhibitor.

[0013] As a further preferred embodiment of the present invention, the NAB-Complex solution is prepared by adding benzotriazole BTA and 3-dimethylamino-1-propanol to a nucleic acid solution and an onion extract, and reacting in the dark to obtain the NAB-Complex solution.

[0014] As a further preferred embodiment of the present invention, the nucleic acid solution is prepared by dissolving deoxyribonucleic acid dry powder in a buffer solution containing tris(hydroxymethyl)aminomethane hydrochloride and ethylenediaminetetraacetic acid to form a nucleic acid solution.

[0015] As a further preferred embodiment of the present invention, the onion extract is prepared by: peeling and cleaning the onion, crushing it into small particles, heating it and using water as a solvent for extraction, and concentrating the resulting solution to obtain the onion extract.

[0016] As a further preferred embodiment of the present invention, in step (1), the concentration of the 2-methylimidazole solution is 2-4 times that of the zinc nitrate hexahydrate solution.

[0017] As a further preferred embodiment of the present invention, in step (2), after collecting the precipitate, the precipitate is washed with water 2-3 times and then dried to obtain the steel reinforcement rust inhibitor.

[0018] To achieve the aforementioned third objective, the technical solution for the application method of the steel reinforcement rust-inhibiting admixture provided by this invention is as follows:

[0019] This invention provides a method for using the above-mentioned steel reinforcement rust inhibitor. In the process of use, the steel reinforcement rust inhibitor is directly coated on the surface of the steel reinforcement or mixed with cement and added to the concrete. The dosage of the steel reinforcement rust inhibitor in the concrete is 2%-6% of the mass of the mixing water.

[0020] The basic principle of this invention: Zeolite imidazole ester framework materials possess a zeolite-like topological structure, offering advantages such as high specific surface area and adjustable pore size. Therefore, they can be used for efficient encapsulation of NAB-Complexes. On one hand, their high specific surface area allows for strong adsorption onto the steel reinforcement surface through physical action, optimizing the oxide layer structure and providing a physical barrier for the steel reinforcement. On the other hand, it avoids the loss of the internal NAB-Complex in the pore fluid of concrete. Furthermore, by responding to changes in the pH value of the steel reinforcement surface, it releases the internal NAB-Complex molecules under specific corrosive environments, thereby achieving a self-healing process for the steel reinforcement embedded within the concrete. The aromatic heterocyclic structure of benzotriazole (BTA) primarily relies on π-π stacking forces to embed between two base pairs of DNA. In addition, the negatively charged DNA backbone can electrostatically interact with the lone pair electrons on the benzotriazole (BTA) molecule, further increasing the stability of the NAB-Complex structure. The antioxidant molecules in onion extract can slow down the aging and degradation of the protective layer itself. Furthermore, the polyphenols within it can adsorb onto the surface of the protective layer, preventing the intrusion of chloride ions and oxygen, thus providing further protection. NAB-Complex molecules can bind with Fe and Fe2+ on the metal surface. 2+ A strong coordination reaction occurs, forming a dense polymer film on the surface of the reinforcing steel, which can effectively isolate Cl. - SO4 2- The contact between components such as oxygen and oxygen (O2) and the surface of the reinforcing steel improves its corrosion resistance. Furthermore, the nano-size effect of this invention effectively refines the pore structure of concrete, increases strength, and extends the service life of reinforced concrete structures.

[0021] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: Compared with existing rust inhibitors, it significantly improves the rust-inhibiting effect while avoiding the problem of unstable chemical structure of the effective components, and achieves self-healing ability based on the response to environmental pH. Simultaneously, the nanostructure can refine the pore structure of concrete, improve strength, and reduce the risk of corrosion from harmful media. This invention has good compatibility with cement concrete and broad application prospects. Attached Figure Description

[0022] Figure 1 These are Nyquist electrochemical impedance spectroscopy spectra of the steel reinforcement electrodes in Examples 1-7 and Comparative Examples 1-6 of this invention after being immersed in 0.6 mol / L sodium chloride solution for 48 h. Detailed Implementation

[0023] The present invention will now be further described with reference to the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solutions of the present invention and should not be construed as limiting the scope of protection of the present invention.

[0024] Unless otherwise specified, the preparation methods of the nucleic acid solution and onion extract used in the following examples are as follows:

[0025] Deoxyribonucleic acid (DNA) powder was dissolved in an IL buffer containing 10 mM tris(hydroxymethyl)aminomethane hydrochloride and 1 mM ethylenediaminetetraacetic acid (EDTA) and ultrasonically dispersed for 5-10 min to form a nucleic acid solution with a concentration of 213 mg / L. The DNA sequence in the DNA powder was: TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTC, and was synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0026] After peeling and cleaning the onions, crush them into small particles. Heat the powder at 40℃ for 5-10 minutes. Mix the powder with a deionized water solution at a material-to-liquid ratio of 1:10, sonicate for 20-30 minutes, and concentrate to 1 / 3 of the original volume. In other words, the concentrated onion extract is obtained by extracting onions at a water mass ratio of 3:10. The concentration of the onion extract can be adjusted according to the amount of onion extract used.

[0027] Example 1

[0028] This embodiment presents an admixture for improving concrete durability with rust-inhibiting and self-healing capabilities. Using zeolite imidazole ester framework material as a carrier, NAB-Complex is encapsulated within its nanoscale channels via a co-precipitation method. The preparation process includes the following steps:

[0029] (1) Take a certain volume of 20 ml of NAB-Complex solution and add it to 40 ml of 0.5 mol / L 2-methylimidazole solution under magnetic stirring. After it is fully dissolved, slowly add 20 ml of 0.25 mol / L zinc nitrate hexahydrate solution dropwise and continue stirring for 10 min to activate it. Stir at room temperature for 6 h to form a solution.

[0030] (2) Centrifuge the solution after reaction in a high-speed centrifuge, collect the white precipitate, wash the precipitate three times with deionized water, and dry it in a vacuum drying oven at 40°C until the weight no longer changes, and set aside for use.

[0031] (3) Add the white precipitate after vacuum drying to ultrapure water without hydrolytic enzyme and disperse it evenly to obtain the product.

[0032] The concentration of the 2-methylimidazole solution was twice that of the zinc nitrate hexahydrate solution. NAB-Complex contained, by mass percentage, 40% nucleic acid solution, 25% benzotriazole, 25% onion extract, and 10% 3-dimethylamino-1-propanol. The preparation method was as follows: benzotriazole (BTA) and 3-dimethylamino-1-propanol were added to the nucleic acid solution and onion extract, and the mixture was placed in a 35°C water bath shaker in the dark for 60 min to ensure binding equilibrium was reached; then it was cooled to room temperature to obtain the NAB-Complex solution.

[0033] Electrochemical impedance spectroscopy (EIS) testing: Following the above technical scheme, a 10mm thick, 5mm long plain round steel bar was selected and progressively polished using metallographic sandpaper of grades 360#, 800#, 1200#, and 2000#. One end of the plain round steel bar was used as the working surface, and the other end was connected to the wire. The remaining portion, excluding the working surface, was then coated with epoxy resin. The working surface was polished again and cleaned with acetone and anhydrous ethanol to obtain the working electrode required for the test. Before testing, the working electrode was pre-passivated in a simulated concrete pore solution for 4 days, followed by passivation for 3 days with a 2% (by mass) admixture. The Nyquist plot of the working electrode after immersion in a 0.6 mol / L sodium chloride solution for 48 hours was then measured.

[0034] Compressive strength test: Mix the above-mentioned admixture at a mass ratio of 2% with 500g cement, 250g water and 1350g standard sand, and mold and cure according to GB / T 17671-2021. After 28 days, perform compressive strength test according to GB / T 17671-1999.

[0035] Example 2

[0036] This embodiment of an admixture for improving concrete durability with rust-inhibiting and self-healing capabilities uses zeolite imidazole ester skeleton material as a carrier, and encapsulates NAB-Complex within its nanoscale channels through a co-precipitation method. The difference between this embodiment and Example 1 is that in the admixture preparation step (1), after activation, the mixture is stirred at room temperature for 12 hours, while the remaining steps are the same as in Example 1.

[0037] Electrochemical impedance spectroscopy and compressive strength tests were performed using the same method as in Example 1.

[0038] Example 3

[0039] This embodiment presents an admixture with rust-inhibiting and self-healing capabilities to enhance concrete durability. It uses a zeolite imidazole ester framework material as a carrier, and encapsulates the NAB-Complex within its nanoscale channels via a co-precipitation method. The difference between this embodiment and Example 2 is that the concentration of the 2-methylimidazole solution in this embodiment is four times that of the zinc nitrate hexahydrate solution; the remaining preparation steps are the same as in Example 2.

[0040] Electrochemical impedance spectroscopy and compressive strength tests were performed using the same method as in Example 1.

[0041] Example 4

[0042] This embodiment presents an admixture for improving concrete durability with rust-inhibiting and self-healing capabilities. It uses a zeolite imidazole ester framework material as a carrier, and encapsulates NAB-Complex within its nanoscale channels via a co-precipitation method. The difference between this embodiment and Example 3 is that the formulation of the NAB-Complex solution differs from that in Example 3, while the remaining preparation steps are the same as in Example 3.

[0043] By mass percentage, the NAB-Complex in this embodiment contains 50% nucleic acid solution, 25% benzotriazole, 15% onion extract, and 10% 3-dimethylamino-1-propanol. The preparation method is as follows: benzotriazole BTA and 3-dimethylamino-1-propanol are added to the nucleic acid solution and onion extract, and the mixture is placed in a 35°C water bath shaker in the dark for 60 min to ensure that the binding reaches equilibrium; then it is cooled to room temperature to obtain the NAB-Complex solution.

[0044] Electrochemical impedance spectroscopy and compressive strength tests were performed using the same method as in Example 1.

[0045] Example 5

[0046] This embodiment presents an admixture for improving concrete durability with rust-inhibiting and self-healing capabilities. It uses a zeolite imidazole ester framework material as a carrier, and encapsulates NAB-Complex within its nanoscale channels via a co-precipitation method. The difference between this embodiment and Example 3 is that the formulation of the NAB-Complex solution differs from that in Example 3, while the remaining preparation steps are the same as in Example 3.

[0047] By mass percentage, the NAB-Complex of this embodiment contains 60% nucleic acid solution, 25% benzotriazole, 5% onion extract, and 10% 3-dimethylamino-1-propanol. The preparation method is as follows: benzotriazole BTA and 3-dimethylamino-1-propanol are added to the nucleic acid solution and onion extract, and the mixture is placed in a 35°C water bath shaker in the dark for 60 minutes to ensure that the binding reaches equilibrium; then it is cooled to room temperature to obtain the NAB-Complex solution.

[0048] Electrochemical impedance spectroscopy and compressive strength tests were performed using the same method as in Example 1.

[0049] Example 6

[0050] This embodiment of an admixture for improving concrete durability with rust-inhibiting and self-healing capabilities uses zeolite imidazole ester framework material as a carrier, and encapsulates NAB-Complex within its nanoscale channels via a co-precipitation method. The composition and preparation method of the admixture in this embodiment are the same as in Example 4.

[0051] Electrochemical impedance spectroscopy was performed using the same method as in Example 1.

[0052] Compressive strength test: Mix 4% admixture with 500g cement, 250g water and 1350g standard sand, and cure according to GB / T 17671-2021. After 28 days, perform compressive strength test according to GB / T 17671-1999.

[0053] Example 7

[0054] This embodiment of an admixture for improving concrete durability with rust-inhibiting and self-healing capabilities uses zeolite imidazole ester framework material as a carrier, and encapsulates NAB-Complex within its nanoscale channels via a co-precipitation method. The composition and preparation method of the admixture in this embodiment are the same as in Example 4.

[0055] Electrochemical impedance spectroscopy was performed using the same method as in Example 1.

[0056] Compressive strength test: In addition, 6% by mass of admixture, 500g cement, 250g water and 1350g standard sand were mixed and molded and cured in accordance with GB / T 17671-2021. After 28 days, the compressive strength was tested in accordance with GB / T 17671-1999.

[0057] Example 8

[0058] This embodiment presents an admixture for improving concrete durability with rust-inhibiting and self-healing capabilities. It uses a zeolite imidazole ester framework material as a carrier, and encapsulates the NAB-Complex within its nanoscale channels via a co-precipitation method. The difference between this embodiment and Example 4 is that the nucleic acid solution concentration is 55 mg / L, and the concentrated onion extract is obtained at an onion-to-water mass ratio of 6:10.

[0059] By mass percentage, the NAB-Complex in this embodiment contains 60% nucleic acid solution, 20% benzotriazole, 10% onion extract, and 10% 3-dimethylamino-1-propanol. The preparation method is as follows: benzotriazole BTA and 3-dimethylamino-1-propanol are added to the nucleic acid solution and onion extract, and the mixture is placed in a 35°C water bath shaker in the dark for 60 min to ensure that the binding reaches equilibrium; then it is cooled to room temperature to obtain the NAB-Complex solution.

[0060] Electrochemical impedance spectroscopy and compressive strength tests were performed using the same methods as in Example 1. The final results were similar to those in Example 1.

[0061] Comparative Example 1

[0062] In this comparative example, electrochemical impedance spectroscopy and compressive strength tests were conducted on round steel bars and concrete without admixtures, respectively, using the same testing methods as in Example 1.

[0063] Comparative Example 2

[0064] The difference between this comparative example and Example 1 is that no nucleic acid component was added to the NAB-Complex solution; the remaining steps were the same as in Example 1. Electrochemical impedance spectroscopy and compressive strength testing were performed using the same methods as in Example 1.

[0065] Comparative Example 3

[0066] The difference between this comparative example and Example 1 is that benzotriazole (BTA) was not added to the NAB-Complex solution; the remaining steps were the same as in Example 1. Electrochemical impedance spectroscopy and compressive strength tests were performed using the same methods as in Example 1.

[0067] Comparative Example 4

[0068] The difference between this comparative example and Example 1 is that onion extract was not added to the NAB-Complex solution; the remaining steps were the same as in Example 1. Electrochemical impedance spectroscopy and compressive strength testing were performed using the same methods as in Example 1.

[0069] Comparative Example 5

[0070] The difference between this comparative example and Example 1 is that no zeolite imidazole ester framework material was added during the preparation of the additive; the remaining steps were the same as in Example 1. Electrochemical impedance spectroscopy and compressive strength tests were performed using the same methods as in Example 1.

[0071] Comparative Example 6

[0072] The difference between this comparative example and Example 1 is that the NAB-Complex solution comprises 30% nucleic acid solution, 25% benzotriazole, 35% onion extract, and 10% 3-dimethylamino-1-propanol; the remaining steps are the same as in Example 1. Electrochemical impedance spectroscopy and compressive strength tests were performed using the same methods as in Example 1.

[0073] Table 1. Compressive strength of different embodiments and comparative examples of the present invention

[0074] serial number Compressive strength (MPa) serial number Compressive strength (MPa) Example 1 44.29 Comparative Example 1 40.23 Example 2 44.31 Comparative Example 2 43.25 Example 3 44.53 Comparative Example 3 43.03 Example 4 45.38 Comparative Example 4 43.84 Example 5 45.03 Comparative Example 5 42.12 Example 6 47.18 Comparative Example 6 44.05 Example 7 47.24

[0075] Experimental data show that the additive of the present invention has a significant corrosion inhibition effect. Compared with the comparative example, the capacitive arc radius of the electrochemical impedance spectroscopy of the steel electrode after soaking in 0.6 mol / L sodium chloride solution for 48 h is significantly increased. Furthermore, as shown in Examples 1-3, with the increase of stirring time and the increase of the concentration ratio of 2-methylimidazole solution to zinc nitrate hexahydrate during the preparation process, the corrosion inhibition efficiency of the additive also increases. In addition, the corrosion inhibition efficiency also varies with the change of the NAB-Complex component ratio. Among them, when the additive dosage is 2%, Example 4 has a larger capacitive arc radius, indicating that its steel electrode has a lower corrosion rate and better corrosion resistance. This indicates that the additive has a relatively high corrosion inhibition efficiency when the ratio of nucleic acid solution to onion extract is 10:3. Furthermore, the corrosion inhibition efficiency of the additive first increases and then decreases with increasing dosage; Example 6 has the largest capacitive arc radius, indicating that the corrosion inhibition efficiency of the additive is best at a dosage of 4%. The compressive strength results show that the compressive strength of the mortar sample in Example 6 was increased by 17.03% compared with that without the rust inhibitor. This indicates that the rust inhibitor not only has a good rust-inhibiting effect, but its core-shell structure also plays a positive role in the pore structure of the mortar, thereby improving strength and durability.

[0076] The advantages of this invention are: compared with existing rust inhibitors, it significantly improves the rust-inhibiting effect while avoiding the problem of unstable chemical structure of the effective components, and achieves rust-inhibiting self-healing ability based on the response to environmental pH. Simultaneously, the nanostructure can refine the pore structure of concrete, improve strength, and reduce the risk of corrosion from harmful media. This invention has good compatibility with cement concrete and broad application prospects.

[0077] The above description is merely a preferred embodiment of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A rust-inhibiting admixture for reinforcing steel bars, characterized in that, The steel reinforcement rust inhibitor uses zeolite imidazole ester skeleton material as a carrier, and the pores of the carrier are encapsulated with NAB-Complex. By mass percentage, the NAB-Complex includes the following components: nucleic acid solution 40-60%, benzotriazole 15%-25%, onion extract 5%-25%, and 3-dimethylamino-1-propanol 5%-10%.

2. The steel reinforcement rust inhibitor according to claim 1, characterized in that, The concentration of the nucleic acid solution was 55 mg / L-213 mg / L.

3. The steel reinforcement rust inhibitor according to claim 1, characterized in that, The nucleic acid solution is made from deoxyribonucleic acid (DNA) powder, which contains 20-80 bases of DNA.

4. A method for preparing a steel reinforcement rust-inhibiting admixture according to any one of claims 1-3, characterized in that, include: (1) Add 2-methylimidazole solution to NAB-Complex solution. After it is fully dissolved, add zinc nitrate hexahydrate solution dropwise and stir to activate and react to obtain the reaction solution. (2) Centrifuge the solution after the reaction and collect the precipitate to obtain the steel reinforcement rust inhibitor.

5. The method for preparing the steel reinforcement rust inhibitor according to claim 4, characterized in that, The NAB-Complex solution is prepared by adding benzotriazole and 3-dimethylamino-1-propanol to a nucleic acid solution and an onion extract, and reacting in the dark to obtain the NAB-Complex solution.

6. The method for preparing the steel reinforcement rust inhibitor according to claim 5, characterized in that, The method for preparing the nucleic acid solution is to dissolve deoxyribonucleic acid dry powder in a buffer solution containing tris(hydroxymethyl)aminomethane hydrochloride and ethylenediaminetetraacetic acid to form a nucleic acid solution.

7. The method for preparing the steel reinforcement rust inhibitor according to claim 5, characterized in that, The preparation method of onion extract is as follows: peel and clean the onion, crush it into small particles, heat it and use water as a solvent to extract it, and concentrate the solution obtained after extraction to obtain onion extract.

8. The method for preparing the steel reinforcement rust inhibitor according to claim 4, characterized in that, In step (1), the molar amount of 2-methylimidazole added is 4-8 times the molar amount of zinc nitrate hexahydrate.

9. The method for preparing the steel reinforcement rust inhibitor according to claim 4, characterized in that, In step (2), after collecting the precipitate, wash the precipitate with water 2-3 times, and then dry it to obtain the steel reinforcement rust inhibitor.

10. A method of using the steel reinforcement rust inhibitor according to any one of claims 1-3, characterized in that, The steel reinforcement rust inhibitor can be directly coated on the surface of the steel reinforcement or mixed with cement and added to the concrete. The dosage of the steel reinforcement rust inhibitor in the concrete is 2%-6% of the mass of the mixing water.