Bacillus velezensis G7-32 for preventing and treating potato dry rot and application of bacillus velezensis G7-32
By using Bacillus berberis G7-32 and its volatile metabolites, the problems of high equipment investment, chemical pollution and biological instability in the control of potato dry rot have been solved, achieving efficient and safe control results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-04-10
AI Technical Summary
Existing technologies are insufficient for effectively, safely, and economically controlling potato dry rot. Physical control requires high investment in equipment, chemical control is prone to drug resistance and environmental pollution, and biological control is unstable.
Bacillus bellis G7-32 and its volatile metabolites, including 2-ethylhexanol, guaiacol, and acetophenone, were used to inhibit the pathogen of potato dry rot through fumigation.
It effectively inhibits the pathogen of potato dry rot, reduces tuber weight loss and lesion size, is environmentally friendly with no chemical residues, and is suitable for potato cultivation and storage.
Smart Images

Figure CN121825811A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of agricultural microbial technology, specifically relating to a strain of Bacillus vesiculus G7-32 for the prevention and control of potato dry rot and its application. Background Technology
[0002] potato( Solanum tuberosum Solanum (L.) is an annual herbaceous plant belonging to the genus Solanum in the family Solanaceae. It is the world's fourth largest staple food crop, with its cultivation covering multiple regions including cold, temperate, and subtropical zones. It is not only high-yielding and highly adaptable, but also rich in various nutrients such as starch, protein, vitamins, and minerals. It plays an irreplaceable core role in ensuring food security, promoting agricultural economic development, and meeting the needs of the food processing industry.
[0003] However, potatoes are highly susceptible to various diseases and pests throughout their cultivation cycle and post-harvest storage. Potato dry rot, caused by Fusarium spp., is one of the most serious diseases. This disease is prevalent in all major potato-producing regions worldwide, and the pathogens mainly include Fusarium spp. (…). Fusarium sambucinum Fusarium solani ( ) Fusarium solani Fusarium oxysporum ( Fusarium oxysporum It is susceptible to various Fusarium species, including Fusarium moniliforme, and is characterized by diverse infection routes, wide spread, and long-term damage, which seriously restricts potato yield and quality.
[0004] Potato dry rot can occur during both cultivation and storage periods, primarily infecting potato tubers, with the damage being significantly greater during storage than during cultivation. In the early stages, circular or irregularly shaped, dark brown, sunken lesions appear on the tuber surface, with clear edges and a hard texture. As the disease progresses, the lesions enlarge and spread deeper into the tuber, forming multiple concentric wrinkles on the surface, often accompanied by a grayish-white mold layer. In the later stages, the internal tissues of the tuber gradually necrotize and rot, forming cavities filled with white, pink, or grayish-brown cottony mycelia. The entire tuber becomes noticeably hard, lighter, and shrunken, darkening in color to grayish-brown or dark brown, completely losing its edible and commercial value. Furthermore, Fusarium spores may produce toxic metabolites during infection, posing a food safety risk even to mildly infected tubers, further exacerbating the disease's harm.
[0005] Currently, the main control methods for potato dry rot include physical control, chemical control, and biological control. However, each method has obvious limitations and it is difficult to achieve efficient, safe, and sustainable control goals.
[0006] Physical control methods mainly rely on temperature, humidity, and ventilation equipment. During potato storage, the temperature is controlled at 2-4℃ and the relative humidity at 85%-90%, combined with regular ventilation to reduce tuber respiration and inhibit pathogen growth, thereby reducing the occurrence of dry rot. While this method has the advantage of no chemical residue, it requires significant investment in equipment and high energy consumption, making it difficult for small-scale storage operators to afford. Furthermore, temperature fluctuations or improper humidity control during storage can easily lead to chilling injury or secondary infection of the tubers, resulting in poor stability of the control effect.
[0007] Chemical control is a widely used method in current production, its core being the use of chemical pesticides to inhibit or kill pathogens. Common pesticides used to prevent dry rot in potatoes during storage include benomyl, thiophanate-methyl, carbendazim, and metalaxyl-mancozeb. These agents are mostly applied through seed treatment, spraying, or potato soaking. However, the long-term and excessive use of chemical pesticides has led to a series of prominent problems: First, pathogens easily develop resistance, resulting in a gradual decline in the efficacy of pesticides, requiring increasingly higher dosages to achieve the desired effect; second, chemical pesticide residues contaminate potato tubers and the soil environment, harming human health and disrupting the ecological balance.
[0008] Biological control technology, with its environmentally friendly, safe, and residue-free characteristics, has become a hot research area for the control of potato dry rot in recent years. Its core principle is to use natural active substances or beneficial microorganisms and their metabolites to inhibit the growth and reproduction of pathogens. Among them, microbial antimicrobial peptides (such as nisin) and enzymes (such as lysozyme) have shown good application prospects in the field of postharvest preservation of fruits and vegetables due to their broad-spectrum antimicrobial activity, high safety, and easy degradation. Natural active substances such as melatonin, as chemical preservatives, have also been proven to reduce the damage of dry rot by regulating the resistance of potato tubers themselves. However, existing biological control technologies still have many shortcomings: for example, antimicrobial peptides and enzymes have high production costs and poor stability, and are easily inactivated in the field and storage environments; the control effect of natural substances such as melatonin is easily affected by environmental factors, and it is difficult to cope with high-intensity pathogen infection when used alone; the mechanism of action of some biological control reagents is unclear, and the stability of their control effect is insufficient, making it difficult to promote and apply them on a large scale in production.
[0009] Therefore, developing a control technology for potato dry rot that is highly effective, environmentally safe, cost-effective, and easy to industrialize has become a key technical problem urgently needing to be solved in the current potato industry. Beneficial microorganisms and their volatile metabolites offer unique advantages such as broad-spectrum activity, low resistance to drug development, and no direct contact contamination, providing a new approach for the green control of potato dry rot and possessing significant research value and application prospects. Summary of the Invention
[0010] To address the shortcomings of existing technologies, the present invention aims to provide a strain of Bacillus belyssus G7-32, the volatile metabolites of which can effectively inhibit the pathogen of potato dry rot and can be used to prevent and control potato dry rot.
[0011] The objective of this invention is achieved through the following technical solution: This invention provides a strain of Bacillus belye ( Bacillus velezensis The Bacillus belyssus G7-32 has the accession number CGMCC No. 35271.
[0012] This invention provides a microbial inoculant, comprising Bacillus belye G7-32 as described in the above technical solution.
[0013] Preferably, the viability of Bacillus vesiculus G7-32 in the microbial agent is 10. 2 ~10 10 cfu / mL.
[0014] This invention provides a method for preparing the microbial inoculant described in the above technical solution, comprising: The Bacillus belye G7-32 was cultured in a culture medium to obtain a microbial inoculum.
[0015] This invention provides the application of *Bacillus belyssus* G7-32 described in the above-mentioned technical solution, the microbial agent described in the above-mentioned technical solution, or the microbial agent prepared by the preparation method described in the above-mentioned technical solution in the preparation of volatile metabolites. The volatile metabolites include any one or more of the following: 2-ethylhexanol, guaiacol, acetophenone, 2-nonanone, 3-hydroxy-2-butanone, n-decanol, 1-nonanol, 2-undecanoone, 2-tetradecanoone, 1-octanol, 2,4,6-trimethylpyridine, 6,10-dimethyl-5,9-undecadien-2-one, 2-heptanone, butyl isobutyrate, isoprene, ethyl 2-methylbutyrate, 2-nonanol, 5-methyl-2-furanol, 2,3-butanediol, 2-ethyl-5-methylpyrazine, and 3-methyl-2-butenal.
[0016] This invention provides a volatile metabolite of Bacillus belyssus G7-32 described in the above technical solution, wherein Bacillus belyssus G7-32 is cultured in a culture medium and the volatile metabolite is collected.
[0017] Preferably, the volatile metabolites include: 2-ethylhexanol, guaiacol, acetophenone, 2-nonanone, 3-hydroxy-2-butanone, n-decanol, 1-nonanol, 2-undecanoone, 2-tetradecanoone, 1-octanol, 2,4,6-trimethylpyridine, 6,10-dimethyl-5,9-undecadien-2-one, 2-heptanone, butyl isobutyrate, isoprene, ethyl 2-methylbutyrate, 2-nonanol, 5-methyl-2-furanethanol, 2,3-butanediol, 2-ethyl-5-methylpyrazine, and 3-methyl-2-butenal.
[0018] This invention provides the application of Bacillus berberis G7-32 described in the above-mentioned technical solution, the microbial agent described in the above-mentioned technical solution, the microbial agent prepared by the preparation method described in the above-mentioned technical solution, or the volatile metabolites described in the above-mentioned technical solution in inhibiting the pathogen of potato dry rot.
[0019] This invention provides the application of Bacillus berberis G7-32 described in the above technical solution, the microbial agent described in the above technical solution, the microbial agent prepared by the preparation method described in the above technical solution, or the volatile metabolites described in the above technical solution in the prevention and control of potato dry rot.
[0020] This invention provides the application of an agent in inhibiting the pathogen of potato dry rot and / or controlling potato dry rot, the agent comprising any one or more of 2-ethylhexanol, guaiacol, and acetophenone.
[0021] The beneficial effects of this invention are: This invention provides a strain of Bacillus belye ( Bacillus velezensis The *Bacillus berleis* G7-32, with preservation number CGMCC No. 35271, is the first to combine the volatile organic compounds of *Bacillus berleis* with the control of potato dry rot, a disease that affects potato storage. The invention systematically elucidates the antibacterial mechanism of *Bacillus berleis* volatile organic compounds against potato dry rot pathogens from the perspectives of apparent antibacterial activity, cell structure, and energy metabolism. The *Bacillus berleis* G7-32 provided by this invention, after screening and identification, can stably produce a variety of highly active volatile metabolites, including 2-ethylhexanol, guaiacol, and acetophenone. These volatile metabolites can effectively inhibit the mycelial growth and spore germination of potato dry rot pathogens, such as *Fusarium*, through fumigation. Furthermore, it exhibits good environmental compatibility and no risk of chemical residues, and can be directly applied to the control of dry rot during potato cultivation and storage. The Bacillus berreatus G7-32 provided by this invention offers a new, efficient, and safe solution for constructing a green control system for potato dry rot, and lays the foundation for studying the biocontrol effects of volatile organic compounds in Bacillus.
[0022] Biological Preservation Information Bacillus belyssus G7-32, Latin scientific name Bacillus velezensis It was deposited on July 17, 2025 at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 35271. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 The graph shows the inhibitory effects of different Bacillus strains on the dry rot pathogen; where A represents the classification of the screened Bacillus strains based on the width of the inhibition band; and B represents the plate effect of different Bacillus fermentation broths on the dry rot pathogen. Figure 2 The first image shows the plate inhibition effect of volatile gases produced by different Bacillus species on dry rot pathogens; A shows the plate effect of volatile substances produced by different Bacillus species on dry rot pathogens; B shows the classification of the screened Bacillus species based on their inhibition rate. Figure 3 The images show the effects of different concentrations of strain G7-32 fumigation on potato tubers affected by dry rot; A represents the effect of different concentrations of strain G7-32 fumigation on potato tubers; B, C, and D represent the weight loss rate, lesion diameter, and lesion depth of the tubers, respectively. Figure 4 The effect of different doses of strain G7-32 fumigation on potato tubers with dry rot is shown in Figure A; Figure B shows the effect of different doses of strain G7-32 fumigation on potato tubers; Figures C and D show the weight loss rate, lesion diameter, and lesion depth of potato tubers, respectively. Figure 5 The effect of fumigation with strain G7-32 for different times on potato tubers with dry rot is shown in Figure A. Figure A shows the effect of fumigation with strain G7-32 for different times on potato tubers. Figures B, C, and D show the weight loss rate, lesion diameter, and lesion depth of the tubers, respectively. Figure 6 The images show the morphological identification results of strain G7-32; A shows the colony morphology of G7-32 on the plate; B shows the single colony morphology of G7-32; C shows the Gram staining of strain G7-32. Figure 7 Phylogenetic tree diagram of strain G7-32; Figure 8 Microscopic morphology of mycelia of the potato dry rot pathogen observed using SEM; Figure 9 The images show the hyphal morphology of the control group stained with Evans blue and neutral red, and the mycelium treated with G7-32. Figure 10 The graph shows the changes in chitin content between the control group and the G7-32 treatment group. Figure 11 This is a graph showing the component percentages in the fermentation broth of strain G7-32. Figure 12 The antibacterial effect of 20 and 40 µL of pure volatile components on potato dry rot pathogen (the icon on the right represents the antibacterial rate). Figure 13 PCA analysis score chart; Figure 14 Figure showing the comparative effects of 2-ethylhexanol and guaiacol on potato tuber dry rot; Figure 15 Microscopic morphology of mycelia of the potato dry rot pathogen observed using SEM; Figure 16 Microscopic morphology of spores of the potato dry rot pathogen observed using SEM; Figure 17 Comparison of sporulation rates of 2-ethylhexanol and guaiacol against dry rot pathogens; A represents the sporulation rate after treatment with 2-ethylhexanol and guaiacol; B represents the number of sporozoites observed under a microscope. Figure 18 Comparison of spore germination of *Dry Rot* fungus by 2-ethylhexanol and guaiacol; A shows the spore germination rate after treatment with 2-ethylhexanol and guaiacol; B shows the spore germination observed under a microscope. Figure 19 The effect of 2-ethylhexanol on the cell membrane of *Hypertitis solani*; A shows the luminescence of spores after 2-ethylhexanol treatment; B shows the spore luminescence rate. Figure 20 The effect of 2-ethylhexanol on the cell wall of *Hypertitis solani*; A shows the luminescence of spores after 2-ethylhexanol treatment; B shows the spore luminescence rate. Figure 21 A shows the effect of 2-ethylhexanol on the mitochondria of the dry rot pathogen; A represents the luminescence of spores after treatment with 2-ethylhexanol; B represents the luminescence rate of spores. Detailed Implementation
[0025] This invention provides a strain of *Bacillus belyssus* G7-32, with the preservation number CGMCC No. 35271. The *Bacillus belyssus* G7-32 provided by this invention was isolated from potato rhizosphere soil. When cultured on LB agar plates for 24 h, *Bacillus belyssus* G7-32 forms irregular colonies with a milky-white film. The colonies are relatively flat in the center and extend radially outwards. They are Gram-positive, and the bacterial cells are short rod-shaped. The volatile metabolites of *Bacillus belyssus* G7-32 can effectively inhibit potato dry rot pathogens, showing an inhibition rate of up to 80.64% against *Fusarium* species. The *Bacillus belyssus* G7-32 provided by this invention can be used for the prevention and control of potato dry rot during post-harvest storage. Fumigation of potato tubers inoculated with the pathogen using volatile metabolites of Bacillus belyi G7-32 can significantly inhibit the occurrence and development of potato dry rot, reduce potato weight loss, and decrease the diameter and depth of lesions on the tubers.
[0026] This invention provides a microbial inoculant comprising *Bacillus belye* G7-32 as described in the above-mentioned technical solution. As an optional embodiment of this invention, the viability of *Bacillus belye* G7-32 in the microbial inoculant can be 10... 2 ~10 10 cfu / mL, or 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 Or 10 10 cfu / mL.
[0027] This invention provides a method for preparing the microbial inoculant described in the above-mentioned technical solution, comprising: culturing *Bacillus belye* G7-32 in a culture medium to obtain the microbial inoculant. As an optional embodiment of this invention, the culture medium can be LB medium; the culturing temperature can be 25-37℃, or 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37℃; the culturing time can be 24 hours. After culturing, a culture solution is obtained. This invention can use the obtained culture solution directly as a microbial inoculant, or it can isolate the bacterial cells from the culture solution and use the obtained bacterial cells as a microbial inoculant, or it can use the culture supernatant as a microbial inoculant.
[0028] This invention provides the application of *Bacillus belyssus* G7-32 described in the above-mentioned technical solution, the microbial agent described in the above-mentioned technical solution, or the microbial agent prepared by the preparation method described in the above-mentioned technical solution in the preparation of volatile metabolites. The volatile metabolites include any one or more of the following: 2-ethylhexanol, guaiacol, acetophenone, 2-nonanone, 3-hydroxy-2-butanone, n-decanol, 1-nonanol, 2-undecanoone, 2-tetradecanoone, 1-octanol, 2,4,6-trimethylpyridine, 6,10-dimethyl-5,9-undecadien-2-one, 2-heptanone, butyl isobutyrate, isoprene, ethyl 2-methylbutyrate, 2-nonanol, 5-methyl-2-furanol, 2,3-butanediol, 2-ethyl-5-methylpyrazine, and 3-methyl-2-butenal.
[0029] This invention provides volatile metabolites of *Bacillus belyssus* G7-32 as described in the above-mentioned technical solution. *Bacillus belyssus* G7-32 is cultured in a culture medium, and the volatile metabolites are collected. As an optional embodiment of this invention, the volatile metabolites include: 2-ethylhexanol, guaiacol, acetophenone, 2-nonanone, 3-hydroxy-2-butanone, n-decanol, 1-nonanol, 2-undecanoone, 2-tetradecanoone, 1-octanol, 2,4,6-trimethylpyridine, 6,10-dimethyl-5,9-undecadien-2-one, 2-heptanone, butyl isobutyrate, isoprene, ethyl 2-methylbutyrate, 2-nonanol, 5-methyl-2-furanol, 2,3-butanediol, 2-ethyl-5-methylpyrazine, and 3-methyl-2-butenal.
[0030] This invention provides the application of *Bacillus bellsii* G7-32, the microbial agent, the microbial agent prepared by the method described above, or the volatile metabolites described above in inhibiting the pathogen causing potato dry rot. The pathogen causing potato dry rot includes *Fusarium* species.
[0031] This invention provides the application of *Bacillus berberis* G7-32, the microbial agent, the microbial agent prepared by the method described above, or the volatile metabolites described above in the control of potato dry rot. As an optional embodiment of this invention, the control of potato dry rot includes the control of postharvest potato dry rot.
[0032] This invention provides an agent for inhibiting and / or controlling potato dry rot pathogens, wherein the agent comprises any one or more of 2-ethylhexanol, guaiacol, and acetophenone. The results of the embodiments of this invention show that 2-ethylhexanol, guaiacol, or acetophenone all have good antibacterial effects against potato pathogens, achieving 100% inhibition against Fusarium oxysporum. Using any one or more of 2-ethylhexanol, guaiacol, and acetophenone can be effectively used for the control of potato dry rot, inhibiting its occurrence and development, reducing potato weight loss, and decreasing the diameter and depth of lesions on tubers.
[0033] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0034] The pathogen tested in the following protocol is *Fusarium*.
[0035] The tested plant was Longshu No. 7, a potato variety susceptible to potato dry rot fungus.
[0036] Test Culture Media: LB Liquid Medium: Weigh 10 g peptone, 10 g NaCl, and 5 g yeast extract into beakers, add deionized water to a final volume of 1 L, adjust pH to 7, dispense, and autoclave for later use. LB Solid Medium: After dispensing the LB liquid medium, add 2% agar powder, and autoclave for later use. PDA Medium: Dissolve 25 g PD powder in deionized water, bring to a boil over low heat, and finally bring the volume to a final volume of 1 L. After dispensing, add 2% agar powder, and autoclave for later use. Water Agar Medium: Weigh 10 g agar powder, add deionized water to a final volume of 1 L, dispense, and autoclave for later use.
[0037] Test reagents: Evans blue staining solution (Solebio Biotechnology Co., Ltd.); PI staining solution (Solebio Biotechnology Co., Ltd.); Plant spore wall calcium fluorescent white staining kit (BioBio); Reactive oxygen species detection kit (Solebio Biotechnology Co., Ltd.); Malondialdehyde detection kit (Solebio Biotechnology Co., Ltd.).
[0038] Table 1. Pure volatile organic compounds from strain G7-32
[0039] The following data statistical methods were used: Excel 2017 was used for basic data calculations, and SPSS 23.0 was used for significance analysis. Origin 2021 was used to generate charts.
[0040] Example 1 1. Determination of the antibacterial effect of different Bacillus fermentation broths on potato dry rot pathogens 1.1 Determination of the antibacterial effect of different Bacillus fermentation broths on potato dry rot pathogen Bacillus strains were screened, isolated, and purified from potato rhizosphere soil. Using the Bacillus strains isolated from potato rhizosphere soil as the screening target, the plate confrontation method was used to screen for the pathogen causing potato dry rot (Fusarium solani). Fusarium sambucinum The antibacterial effect of ) was tested, and the results are as follows: Figure 1 As shown.
[0041] The results showed that among the spore-forming strains with antibacterial effects, strain QY-20 had the best antibacterial rate against the dry rot pathogen, with an inhibition zone width of 8 mm, while strain G7-32 had a relatively good antibacterial rate against the dry rot pathogen, with an inhibition zone width of 6 mm.
[0042] 1.2 Inhibitory effect of volatile gases from different Bacillus species on potato dry rot pathogen The antibacterial activity of volatile organic compounds (VOCs) produced by 211 Bacillus strains from the Potato Disease Research Laboratory was detected using the double-plate method. LB solid medium was poured into a petri dish, and after solidification, 200 µL of 1×10⁻⁶ Bacillus subtilis medium was added. 8 cfu·mL -1 The Bacillus fermentation broth was evenly spread, and PDA was poured into another petri dish. The mycelial cake of the dry rot pathogen was placed in the center of the PDA medium. The two plates were then inverted and sealed. 200 μL of LB liquid medium was used as a control. Both were co-cultured in an incubator at 25°C. When the control plate was fully colonized, the diameter of the dry rot pathogen colony was measured using the cross-sectional method, and the inhibition rate was calculated. Mycelial growth inhibition rate = (control colony diameter - treated colony diameter) / (control colony diameter - mycelial cake diameter) × 100%.
[0043] Bacillus strains with an inhibition zone width of 3 mm or more were selected from the above-mentioned strains. A double-plate inverted test was used to screen strains exhibiting highly effective inhibitory effects on potato dry rot caused by their volatile gases. The results are as follows: Figure 2 As shown, the results indicated that 6 strains exhibited inhibition rates exceeding 70% against the dry rot pathogen, 77 strains had inhibition rates between 30% and 70%, and 117 strains had inhibition rates exceeding 30%. This demonstrates that most Bacillus strains can release volatile organic compounds (VOCs), and these VOCs have a certain inhibitory effect on the dry rot pathogen. However, the inhibitory effects of VOCs released by different strains on the dry rot pathogen varied. Screening of the antibacterial effects of Bacillus strains using the double-plate method revealed that the VOCs produced by *Bacillus belyssus* G7-32 showed the best inhibition rate against the dry rot pathogen, at 80.64%.
[0044] Effects of VOCs (volatile organic compounds) released by strain G7-32 on potato tuber dry rot 2.1 Inhibitory effect of fumigation with volatile gases from strain G7-32 on tuber dry rot The G7-32 strain was cultured in LB liquid medium at 25°C and 200 rpm for 24 hours. After the culture was completed, the bacterial culture and LB liquid medium were mixed at a ratio of 1:100 to continue the incubation, which yielded the fermentation broth of the G7-32 strain. The OD value was measured. 600 The viable count of the fermentation broth of strain G7-32 was subsequently found to be 10. 10 CFU / mL. Add 10 10 The fermentation broth of strain G7-32, CFU / mL, was serially diluted to 10... 8 CFU / mL, 10 6 CFU / mL, 10 4 CFU / mL and 10 2 CFU / mL.
[0045] Select potato pieces of the same size, wash and dry them, then disinfect them with 75% alcohol for 1 minute, rinse with sterile water and dry them. Prepare a solution with a concentration of 1×10⁻⁶. 6 A suspension of spores of the dry rot pathogen was prepared by punching holes in potato tubers and inoculating them with the spore suspension. The treatment group was placed with a biocontrol bacterial solution at a concentration of 10. 2 10 4 10 6 10 8 10 10 Five CFU / mL gradients were used, all with a dosage of 40 mL for fumigation. The control group was placed in LB liquid medium as a control. Potatoes inoculated with dry rot fungus and different concentrations of biocontrol bacteria were placed in a preservation box, sealed tightly with plastic wrap, and incubated in a constant temperature incubator at 25℃ for 20 days. The weight loss rate, lesion area, and depth were then calculated.
[0046] Five different concentrations of fermentation broth from strain G7-32 were used to fumigate detached potato tubers. After 20 days, three indicators were measured: weight loss rate, lesion diameter, and lesion depth. Results are as follows: Figure 3 As shown. The results indicate that, compared to the control, 10 8 CFU / mL, 10 10 CFU / mL showed good inhibitory effects on dry rot, with significant differences in lesion diameter and depth. 8 When fermentation broth of strain G7-32 was used to fumigate detached potato tubers, the diameter and depth of lesions were reduced by 3 times and 3.4 times, respectively, compared with the control. 10When fumigated with CFU / mL, the diameter and depth of lesions decreased by 2.6 times and 2.9 times, respectively, compared to the control, indicating no significant difference in lesion diameter and depth between the two concentrations. Therefore, the optimal fermentation broth concentration of strain G7-32 for inhibiting the occurrence and development of potato dry rot is 10. 8 CFU / mL.
[0047] 2.2 Antifungal effect of different doses of G7-32 strain fumigation on tubers with dry rot The concentration of 10 was prepared using the method described in section 2.1 above. 8 CFU / mL G7-32 strain fermentation broth
[0048] Select potato pieces of the same size, wash and dry them, then disinfect them with 75% alcohol for 1 minute. Rinse with sterile water and dry them. Prepare a solution with a concentration of 1×10⁻⁶. 6 A spore suspension of the dry rot pathogen was prepared by punching holes in potato tubers and inoculating them with the spore suspension. The treatment groups were inoculated with biocontrol bacteria at four different volumes: 20 mL, 40 mL, and 60 mL. The control group was inoculated with LB liquid medium. All tubers were placed in a sealed container and incubated at 25°C for 20 days. The weight loss rate, lesion area, and depth were then calculated.
[0049] Extracted tubers were fumigated using fermentation broth from strain G7-32 at three different doses (20 mL, 40 mL, and 60 mL, respectively). After 20 days, the weight loss rate, lesion diameter, and lesion depth of the tubers were measured. Results are as follows: Figure 4 As shown in the figure. The results showed that compared with the control, fumigation with 40 mL of fermentation broth had a good inhibitory effect on dry rot, with significant differences in weight loss rate, lesion diameter, and lesion depth. When 40 mL of G7-32 strain fermentation broth was used to fumigate detached potato tubers, the weight loss rate was reduced by 2.57% compared with the control, and the lesion diameter and lesion depth were reduced by 2.45 times and 2.30 times respectively compared with the control. Based on the optimal dosage of 40 mL and the volume of the preservation box of 4.5 L, the optimal fumigation concentration of G7-32 strain fermentation broth for inhibiting the occurrence and development of potato dry rot was calculated to be 8.89 mL / L.
[0050] 2.3 Antifungal effect of fumigation with strain G7-32 for different durations on tubers with dry rot The concentration of 10 was prepared using the method described in section 2.1 above. 8 CFU / mL G7-32 strain fermentation broth
[0051] Select potato pieces of the same size, wash and dry them, then disinfect them with 75% alcohol for 1 minute. Rinse with sterile water and dry them. Prepare a solution with a concentration of 1×10⁻⁶. 6A spore suspension of the dry rot pathogen was prepared by punching holes in potato tubers and inoculating them with the spore suspension. The treatment group used 40 mL of biocontrol bacteria solution, while the control group used LB liquid medium as a control. All tubers were placed in a sealed container with plastic wrap and incubated at 25°C for 7, 14, 21, and 28 days. The weight loss rate, lesion area, and depth were then calculated.
[0052] By fumigating detached potato tubers with the fermentation broth of strain G7-32 for different durations, three indicators—weight loss, lesion diameter, and lesion depth—were measured every 7 days. The results are as follows: Figure 5 As shown in the figure. The results showed that, compared with the control, the extension and expansion of lesions were significantly inhibited after 21 days of fumigation, with a statistically significant difference. When fumigating detached tubers with the fermentation broth of strain G7-32, the weight loss rate was reduced by 2.75% compared with the control, and the lesion diameter and depth were reduced by 3.26 times and 2.50 times, respectively. With the extension of time to 28 days of fumigation, the weight loss rate when fumigating detached tubers with the fermentation broth of strain G7-32 was reduced by 1.48% compared with the control, and the lesion diameter and depth were reduced by 3.26 times and 3.22 times, respectively.
[0053] Example 2 Identification of biocontrol strains 1. Morphological identification: Strain G7-32 was streaked onto LB agar and incubated at 37°C for 24 hours. Colony morphology was observed, including size, color, and surface characteristics. Gram staining was performed, and the strain's properties were determined by microscopic observation. Results showed that after 24 hours of incubation on LB plates, strain G7-32 formed irregular colonies with a milky-white membrane. The colonies were relatively flat in the center and extended radially outwards. Gram staining was positive, and the bacterial cells were short rod-shaped. Figure 6 As shown.
[0054] 2. Molecular Identification: The test strain G7-32 was streaked onto LB agar plates to activate it, and single colonies were cultured. Each single colony was picked and incubated overnight in LB liquid medium with shaking. DNA from strain G7-32 was extracted using a bacterial genomic DNA extraction kit. The primers for gyr-B gene fragment amplification were gyrB-F: 5'-GAAGTCATCAT GACCGTTCTGCAYGCNGGNGGNAARTTYGA-3' (SEQ ID NO.1) and gyrB-R: 5'-AGCAGGGTACGGATGTGCGAGCCRTCAACRTCNGCRTCNGTCAT-3' (SEQ ID NO.2). The PCR amplification products were sequenced by Sangon Biotech (Shanghai) Co., Ltd. Based on the sequencing results, sequences of strains with high homology were compared with those of the tested antagonistic strains using NCBI-Blast sequence alignment. A phylogenetic tree was constructed using MEGA 7.0 software.
[0055] The gyrB sequence of strain G7-32 is shown in SEQ ID NO.3, specifically: CCAATGCCTCCGGAATGCTCGGATCTTTAGAAGACAGTCCGCCAGTTTGCCCGGCAGATTGGAAATCTCAAGCGCACTTTTGCGGCGGGTCAATTCCCGCGCTTTTTTCGCTGCCATCCGCGCTCTTGCGGCCATTAAACCTTTTTCAACGATTTTGCGGGCTGAGTCCGGATTTTCAAGAAGGAATGTTTCCAGCGCAGAAGAAAACAGCGTATCAGTGATCGTTCTCGCTTCGGAGTTGCCGAGCTTCGTTTTCGTCTGACCTTCGAATTGCGGATCAGGGTGCTTAATTGAAATAATGGCAGTCAGCCCTTCTCTCACATCATCCCCGCTTAAATTCGGATCATTTTCTTTGAAAATCCCTTTTCTTCTTGCATAGTCGTTTATGACACGGGTCAGACCGGTTTTAAATCCGGCCTCGTGCGTGCCGCCTTCGTATGTGTTGATATTATTCGTGAAAGAATAAATATTGCTTGTATAGCTGTCGTTGTATTGCAATGCAACTTCAACCGTTATGCCGTCTTTCTCGCCTTCGATATAAATCGGCTCTTCATGAACGACTTCTTTGGAACGGTTTAAGTACTCAACATAGCTTTTGATTCCGCCTTCGTAGTGGTACTCGTTTTTCCGTTCTTGTCCTTCACGTTTGTCTTCAATCGTGATGTTTACGCCTTTTGTCAGGAAGGCCAATTCCCGGACACGGTTTGAAAGCAGATCATAGTCGTATACGGTTGTTTCTTTGAAAATTTCCGGATCCGGAACGAAGTGCGTAATCGTTCCGGTCTTATCAGTATCACCGATCACTTCAAGATCGGCCACAGGTACACCGCGCTCGTACGCCTGATAGTGGATTTTTCCGTCACGATGAACCGTAACGTCAAGAGTGGTCGACAAGGCGTTTACGACAGACGCCCCTACACCGTGAAGACCGCCGGATACTTTATACCACCGCCGCCAA。
[0056] The phylogenetic tree constructed using the sequence information of strain G7-32, showing a 97% similarity to Bacillus belyssus B13, is as follows: Figure 7 As shown, based on morphological characteristics, strain G7-32 was identified as Bacillus belye (B. belye). Bacillus velezensis ).
[0057] Example 3 The effect of fumigation of strain G7-32 on the mycelium of dry rot pathogen. 1. Using the double-plate inverted experiment method described above, first inoculate the potato dry rot pathogen cake onto PDA medium, and incubate in the dark at 25°C for 3 days. Then, prepare a 10% concentration using the same method as described above. 8 Fermentation broth of CFU / mLG7-32 strain was used on another plate, coated with 200 μL of 10 8 CFU / mLG7-32 bacterial fermentation broth was incubated in solid LB culture dishes, which were then sealed tightly with sealing film. After fumigation for a period of time, mycelia from both the control and treatment groups were collected and examined under a light microscope. The results are as follows: Figure 8 As shown. By Figure 8 It can be seen that the volatile organic compounds produced by strain G7-32 can cause the hyphae of the dry rot pathogen to shrink and deform, changing the original morphology of the hyphae.
[0058] 2. Following the same method as in experiment 1 above, mycelia from the control and G7-32 strain fermentation broth were taken and stained with Evans blue and neutral red. After staining for 5 minutes, they were examined under an optical microscope. The results are as follows: Figure 9 As shown, the results indicate that the hyphae of *Dry Rot Fungus* exposed to VOCs exhibited a uniform blue color after application of Evans Blue, while the hyphae not exposed to VOCs showed a weak blue staining. The control hyphae, stained uniformly red by Neutral Red, showed very little staining in the VOCs-exposed hyphae. These phenomena suggest altered hyphal membrane permeability and disruption of cell membrane integrity.
[0059] 3. Following the same method as experiment 1 above, mycelia were collected at 0 h, 12 h, 24 h, 36 h, and 48 h, with a blank control set up at each time point. Mycelia were scraped off after fumigation with Bacillus volatile organic compounds as the treatment group, and the chitin content in the mycelia was measured using the KOH digestion method. The mycelia were dried, ground into powder, and weighed (W1). Then, the powder (W1) was treated with saturated KOH solution at 140℃ for at least 60 minutes. The product was poured onto filter paper and slowly rinsed with distilled water. The extract was dehydrated successively with 95% and 100% ethanol, and weighed again (W2). The chitin content was calculated using the following formula: Chitin content (%) = W2 / W1 × 1.26 × 100%, where 1.26 is a conversion factor.
[0060] The results are as follows Figure 10 As shown in the figure. The results indicated that the chitin content in the mycelium increased with prolonged treatment time and mycelial growth. At each time point, the chitin content in the treatment group was higher than that in the control group, and the chitin content increased with increasing treatment time. The cell wall of the dry rot fungus mycelium was affected.
[0061] Example 4 1. Analysis of volatile components and antibacterial activity of G7-32 Collection of volatile substances from strain G7-32: First, a single colony of G7-32 was picked and placed in liquid LB. The culture was incubated at 37°C with shaking at 200 rpm for 1 day to obtain the seed culture. The seed culture was then added to the liquid LB at a ratio of 1:100, and the culture was incubated at 25°C with shaking at 200 rpm until the bacterial concentration reached 1×10⁻⁶. 8 The fermentation broth of strain G7-32 was obtained by dispersing cfu / mL.
[0062] Sample pretreatment: Before the experiment, age the chromatographic column until no impurity peaks are observed. Then, age the DVB / CAR / PDMS extraction head at the gas chromatograph injection port until no impurity peaks are observed. Accurately measure 5.0 mL of bacterial culture (concentration 1×10⁻⁶). 8 The extract (cfu / mL) was placed in a 20 mL headspace vial and equilibrated at 50°C for 30 min in a water bath with magnetic stirring. A pre-aged extraction head was then inserted, and extraction was performed for 40 min. The extraction head was then removed and immediately inserted into the injection port for 5 min of resolution. Gas chromatography conditions: One-dimensional column HP-innowax (30 m × 0.25 mm × 0.25 μm); two-dimensional column DB17-MS (1.2 m × 0.18 mm × 0.18 μm), helium as carrier gas, flow rate 1.0 mL / min; temperature program: initial temperature 50°C, increased to 240°C at 4°C / min, held for 10 min; injection port temperature 250°C, splitless mode, split ratio 40.0 mL / min. Mass spectrometry conditions: EI source, electron energy 70 eV, transfer line temperature 250°C; ion source temperature 230°C; quadrupole temperature 150°C. The solvent delay was 3 min, and the proton scan range (m / z) was 40-550. The mass spectra obtained by GC-MS were analyzed by searching the NIST mass spectrometry database, and components with a relative peak area greater than 1% and a retention index greater than 800 were selected for dynamic component analysis.
[0063] The components in the fermentation broth of strain G7-32 were analyzed by gas chromatography, and the results are as follows: Figure 11 As shown in Table 2.
[0064] Table 2. Detection results of components in the fermentation broth of strain G7-32 by gas chromatography.
[0065] The results showed that strain G7-32 produced 21 volatile organic compounds, including 3 esters, 7 ketones, 6 alcohols, 2 aromatic compounds, 1 aldehyde, 1 pyrazine, and 1 pyridine. Ketones were the most abundant, accounting for 33.34%. 2-Ethylhexanol had the highest peak area, while guaiacol and acetophenone had moderate peak area proportions.
[0066] 2. Antibacterial effect of volatile organic compounds released by strain G7-32 on agar plates. The inhibitory effect of volatile organic compounds (VOCs) on *Dry Rot* pathogens was determined using the mycelial growth rate method and the double-plate inversion method. First, two concentration gradients were set up to preliminarily screen the antibacterial effects of 21 purchased individual compounds. For each compound, the dosage per plate was set at two gradients: 20 μL and 40 μL, with sterile water as a blank control. The experiment was repeated three times. After 3–5 days, the colony growth of *Dry Rot* pathogens was observed, and the colony diameter was measured using the cross-sectional method to calculate the inhibition rate. Inhibition rate = (Coronary diameter of control group - Colony diameter of treatment group) / (Coronary diameter of control group - Diameter of mycelial cake) × 100%.
[0067] The antibacterial efficacy of all measured volatile compounds was screened using two dosages: 20 and 40 µL. Results are as follows: Figure 12 As shown, the results indicate that when using two dosages of 20 μL and 40 μL respectively, the antibacterial rates of 2-ethylhexanol, guaiacol, and acetophenone are all above 90%, with the three showing the best effect. Therefore, subsequent experiments compared these three and selected the volatile component with the best antibacterial effect.
[0068] 3. Perform PCA analysis on the above dataset using statistical software. The PCA score chart is shown below. Figure 13 As shown in the figure. The results indicate that all components are within the elliptical orbital plane, indicating a good fit and no outliers. The cumulative variance contribution rate of the first principal component (PC-1) reached 97%, and that of the second principal component (PC-2) reached 3%. Specifically, the coordinates of 2-ethylhexanol, guaiacol, and acetophenone are relatively close in the space of the first principal component (PC-1), indicating high sample similarity and strong antibacterial activity.
[0069] 4. Determination of the EC50 of volatile organic compounds with good antibacterial effects against dry rot pathogens. Two pure products with the best measured inhibition rates were selected and tested at five concentration gradients, with 2, 4, 6, 8, and 10 μL per dish, following the methods described in section 2. When calculating the concentration, the used concentration (μL / dish) was converted to the actual concentration (μL / mL) using the following formula: Actual concentration = Dosage / Dishe volume. The logarithm of the concentration (x) and the probability value (y) of the percentage of colony growth inhibition were calculated. IBM SPASS statistics were used to obtain the virulence regression equation y = a + bx and EC50 for each compound against the dry rot pathogen using the least squares method.
[0070] The effective median concentration (EC50) of three chemical agents—2-ethylhexanol, guaiacol, and acetophenone—inhibiting *Dry Rot* was determined. Five gradients were set as the dosage per dish: 2, 4, 6, 8, and 10 µL. The radius of the double-dish inverted system was 4.25 cm, and the height (excluding the gas space after removing the culture medium thickness) was 1.70 cm, resulting in a calculated volume of 96.42 cm³. 3 Based on the dosage and petri dish volume, the drug concentrations were calculated to be 0.02, 0.04, 0.06, 0.08, and 0.10 µL / mL, respectively. Colony diameters were measured, and the virulence regression equation and EC50 were calculated using Spass software. The effective median concentrations (EC50) of the three chemical agents—2-ethylhexanol, guaiacol, and acetophenone—inhibiting *Heterobacter pylori* were determined. 50 As shown in Table 3.
[0071] Table 3. EC50 values of three active ingredients: ethylhexanol, guaiacol, and acetophenone. The results showed that 2-ethylhexanol had the best antibacterial effect, with an EC50 of 0.027 μL / mL.
[0072] Example 5 1. The effect of fumigation with effective volatile components on potato tubers with dry rot. Referring to the method for determining the EC50 value mentioned above, detached potato tubers were fumigated using volatile pure 2-ethylhexanol and guaiacol. The dosage of the drugs was calculated to be 121.5 μL / mL and 184 μL / mL, respectively, based on the dosage and the volume of the preservation box. After fumigation for 20 days, the weight loss rate, lesion diameter, and lesion depth of the potato tubers were measured.
[0073] The results are as follows Figure 14As shown in the results, compared with the control, fumigation with 2-ethylhexanol and guaiacol resulted in significant changes in the lesions. Fumigation with 2-ethylhexanol reduced the weight loss of detached potato tubers by 3.86% compared to the control, and decreased the lesion diameter and depth by 1.33 times and 1.78 times, respectively. Fumigation with guaiacol reduced the weight loss of detached potato tubers by 2.89% compared to the control, and decreased the lesion diameter and depth by 1.31 times and 1.34 times, respectively. Therefore, 2-ethylhexanol showed a relatively better inhibitory effect on potato dry rot, and there was no significant difference in the inhibitory effect of the two components on dry rot.
[0074] Effects of 2,2-Ethylhexanol and guaiacol treatment on the mycelium of *Dry Rot* fungus In a clean bench, a 5 mm sterile punch was used to make holes along the edge of the activated *Potato rot causal agent* fungus. Intact colonies were picked up with a sterile inoculation needle and placed upside down in the center of a potato dextrose agar plate. Then, based on two effective concentrations, 2.6 μL and 4.4 μL of pure 2-ethylhexanol and guaiacol were added to the PDA agar plate respectively for inverted treatment. A culture dish without pure products was used as a blank control. After 3 days, mycelia from both the treated and control groups were scraped off, and the ultrastructural changes on the fungal hyphae surface were observed using a scanning electron microscope (SEM). The microscopic morphology of the *Potato rot causal agent* hyphae was observed using SEM as follows: Figure 15 As shown, the hyphae in the control group were plump and straight, while those in the 2-ethylhexanol-treated group were distorted, with obvious shrinkage and swelling of the hyphae surface. The guaiacol-treated group also showed significant shrinkage, indicating that 2-ethylhexanol and guaiacol have significant teratogenic effects on the hyphae of the dry rot pathogen, although the teratogenic mechanisms may be slightly different.
[0075] Effects of 3,2-Ethylhexanol and guaiacol on the treatment of spores of the dry rot fungus In the following experiments, when treating potato dry rot pathogens, the effective inhibitory concentrations (EC50) of 2-ethylhexanol and guaiacol were used; the fumigation time was 3 days.
[0076] 1) Effects of 2-ethylhexanol and guaiacol treatment on spore morphology of dry rot pathogens Scanning electron microscopy was used to observe the spore morphology of the potato dry rot pathogen: The pathogen was treated with pure 2-ethylhexanol and guaiacol using the double-plate method. After collecting the pathogen spore suspension, 1 mL of a 10% concentration was added to a 2 mL sterile centrifuge tube. 6 cells / mL F. sambucinumThe spore suspension (not filtered through gauze) was centrifuged at 20℃ and 8000 g for 6 min, and the supernatant was discarded. Each group was repeated three times. The treated samples were fixed in 2.5% glutaraldehyde at 4℃ for 24 h. Dehydration was then performed sequentially with 50%, 70%, 80%, 90%, and 100% ethanol, followed by dehydration with tert-butanol, each step for 20 min. The samples were then freeze-dried for two to three days, adhered to the substrate, and coated with an ion sputtering coating for 60 s. Finally, the resulting samples were observed using a scanning electron microscope. Figure 16 As shown, the spores in the control group were regularly sickle-shaped with clearly visible septa and abundant contents; the spores in the 2-ethylhexanol-treated group became shriveled, swollen, and ruptured, with the septa disappearing and contents spilling out; the spores in the guaiacol-treated group became smaller and deformed. Therefore, 2-ethylhexanol disrupts the morphology of the dry rot fungus spores, resulting in severe morphological damage.
[0077] 2) Effects of 2-ethylhexanol and guaiacol treatments on sporulation of dry rot pathogens Using the double-plate inverted method, holes were punched at the edge of the activated potato dry rot fungus using a 5 mm sterile punch in a clean bench. Intact colonies were picked up with a sterile inoculation needle and placed upside down in the center of a potato solid culture medium plate. After three days of fungal growth, based on the effective median concentrations of 2-ethylhexanol and guaiacol against potato dry rot, dosages of 2.6 μL and 4.4 μL, respectively, were used to fumigate the potato dry rot fungus. The fumigation was carried out at 25℃ for 12 h, 24 h, 36 h, and 48 h, respectively. Plates with long mycelia were removed, and 1 ml of sterile water was added to obtain a pathogen spore suspension, which was then adjusted to a concentration of 10. 6 Cells / mL were counted using a hemocytometer under a microscope, with 1 μL of the sample taken for each treatment. Each treatment was repeated three times. Results are as follows: Figure 17 As shown, the results indicate that, compared with the control, fumigation with 2-ethylhexanol significantly affected the sporulation of *Dry Rot*, with the sporulation gradually decreasing over time. Guaiacin, on the other hand, had no significant effect on the sporulation of *Dry Rot*.
[0078] 3) Effects of 2-ethylhexanol and guaiacol treatment on the spore germination rate of dry rot pathogens. Using the same method as described above, spore suspensions were obtained by fumigating the dry rot pathogen with 2-ethylhexanol and guaiacol for 12 h, 24 h, 36 h, and 48 h, respectively. These spore suspensions were then placed in PD medium and shaken at 28°C and 180 rpm for 6 h. The spore suspensions were then examined under a microscope to observe the germination of the dry rot pathogens under different treatments. Each treatment was repeated three times. Figure 18As shown in the figure. The results showed that, compared with the control, 2-ethylhexanol fumigation significantly affected the germination rate of *Dry Rot* spores. After 48 hours of fumigation, compared with the control, the germination rate of *Dry Rot* spores decreased by 85.45% after 2-ethylhexanol fumigation and by 30.19% after guaiacol fumigation. Therefore, 2-ethylhexanol fumigation had a significant inhibitory effect on the germination of *Dry Rot* spores, while guaiacol had a certain inhibitory effect.
[0079] 4) Effects of 2-ethylhexanol treatment on the spore membrane of the dry rot pathogen. Following the method described above for preparing spore suspensions, spore suspensions of the dry rot pathogen at 0 h, 12 h, 24 h, 36 h, and 48 h were collected. For each treatment, 5 μg / mL PI staining solution was added, and the mixtures were incubated at 28°C in the dark for 30 min. Observation was then performed using a fluorescence microscope. The effect of 2-ethylhexanol on the cell membrane of the dry rot pathogen is as follows: Figure 19 As shown in the figure. PI staining was used to detect the integrity of the microsporidian membrane and microsporidian viability. No red fluorescence emitted by PI was detected in the control group. Compared with the control group, the number of microsporidians emitting red fluorescence gradually increased in the experimental group with increasing treatment time, and the fluorescence intensity also increased accordingly. The results indicate that 2-ethylhexanol damages the microsporidian membrane integrity and causes loss of microsporidian viability in *Dry Rot* fungi, and this destructive effect is time-dependent.
[0080] 5) Effect of 2-ethylhexanol treatment on the spore walls of dry rot fungi. Following the method described above for preparing spore suspensions, spore suspensions of the dry rot pathogen at 0 h, 12 h, 24 h, 36 h, and 48 h were taken, and 1 μg / mL CFW staining solution was added. The suspensions were incubated at room temperature in the dark for 20 min. After centrifugation, the suspensions were resuspended in PBS and observed using a fluorescence microscope.
[0081] CFW staining analysis of the effect of 2-ethylhexanol on the microsporidian wall structure of the dry rot pathogen is as follows: Figure 20 As shown, most spores in the control group emitted a bright blue fluorescence, while in the treatment group, the blue fluorescence emitted by the spores weakened and the number of spores decreased with prolonged fumigation time. This indicates that 2-ethylhexanol alters the cell wall structure of the dry rot pathogen.
[0082] 6) Effect of 2-ethylhexanol treatment on reactive oxygen species in spores of the dry rot pathogen. According to the above method for preparing spore suspension, spore suspensions of the dry rot pathogen at 0 h, 12 h, 24 h, 36 h, and 48 h were taken, 10 μmol / L DCFH-DA staining solution was added, and the suspensions were incubated at 37°C in the dark for 60 min. The suspensions were then observed using a fluorescence microscope.
[0083] The effects of 2-ethylhexanol on the mitochondria of dry rot pathogens, such as Figure 21As shown in the figure, no fluorescence was detected in the spores of the control group of dried putrefactive fungi. Compared with the control group, the number of luminescent spores in the 2-ethylhexanol-treated group gradually increased with the extension of fumigation time, and the fluorescence intensity increased. These results indicate that 2-ethylhexanol causes a large accumulation of reactive oxygen species in dried putrefactive fungi, interfering with mitochondrial function and energy metabolism.
[0084] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A strain of Bacillus belye ( Bacillus velezensis The Bacillus belyssus G7-32 has the accession number CGMCC No. 35271.
2. A microbial inoculant, characterized in that, Includes the Bacillus belyssus G7-32 as described in claim 1.
3. The microbial agent according to claim 2, characterized in that, The activity level of Bacillus vesiculus G7-32 in the microbial agent was 10. 2 ~10 10 cfu / mL.
4. The method for preparing the microbial inoculant according to claim 2 or 3, characterized in that, include: The Bacillus belye G7-32 was cultured in a culture medium to obtain a microbial inoculum.
5. The application of the Bacillus belyssus G7-32 of claim 1, the microbial agent of claim 2 or 3, or the microbial agent prepared by the preparation method of claim 4 in the preparation of volatile metabolites, wherein the volatile metabolites include any one or more of 2-ethylhexanol, guaiacol, acetophenone, 2-nonanone, 3-hydroxy-2-butanone, n-decanol, 1-nonanol, 2-undecanoone, 2-tetradecanoone, 1-octanol, 2,4,6-trimethylpyridine, 6,10-dimethyl-5,9-undecadien-2-one, 2-heptanone, butyl isobutyrate, isoprene, ethyl 2-methylbutyrate, 2-nonanol, 5-methyl-2-furanol, 2,3-butanediol, 2-ethyl-5-methylpyrazine, and 3-methyl-2-butenal.
6. A volatile metabolite of Bacillus belyssus G7-32 as described in claim 1, characterized in that, The *Bacillus belye* G7-32 was cultured in a culture medium, and volatile metabolites were collected.
7. The volatile metabolite according to claim 6, characterized in that, The volatile metabolites include: 2-ethylhexanol, guaiacol, acetophenone, 2-nonanone, 3-hydroxy-2-butanone, n-decanol, 1-nonanol, 2-undecone, 2-tetradecone, 1-octanol, 2,4,6-trimethylpyridine, 6,10-dimethyl-5,9-undecadien-2-one, 2-heptanone, butyl isobutyrate, isoprene, ethyl 2-methylbutyrate, 2-nonanol, 5-methyl-2-furanol, 2,3-butanediol, 2-ethyl-5-methylpyrazine, and 3-methyl-2-butenal.
8. The application of Bacillus berberis G7-32 of claim 1, the microbial agent of claim 2 or 3, the microbial agent prepared by the preparation method of claim 4, or the volatile metabolite of claim 6 or 7 in inhibiting the pathogen of potato dry rot.
9. The application of Bacillus berberis G7-32 of claim 1, the microbial agent of claim 2 or 3, the microbial agent prepared by the preparation method of claim 4, or the volatile metabolite of claim 6 or 7 in the prevention and control of potato dry rot.
10. The use of an agent in inhibiting the pathogen of potato dry rot and / or controlling potato dry rot, said agent comprising any one or more of 2-ethylhexanol, guaiacol, and acetophenone.