Propionibacterium freudenreichii LC13, microecological preparation and application thereof
By using Propionibacterium fischeri LC13 microecological preparation, the problem of incomplete intestinal structure in juvenile large yellow croaker was solved, improving their digestive and absorptive capacity and immunity, enhancing intestinal health, and achieving increased survival and growth rates.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- OCEAN UNIV OF CHINA
- Filing Date
- 2026-01-26
- Publication Date
- 2026-04-10
AI Technical Summary
During the artificial breeding and early cultivation of juvenile large yellow croaker, the intestinal structure of the juveniles is not fully developed and the composition of the microbial community is unreasonable, resulting in low digestive enzyme activity and incomplete immune barrier. This makes them susceptible to external environmental stimuli, leading to high mortality and morbidity rates, which hinders the sustainable development of seedling cultivation.
A strain of Propionibacterium fischeri LC13 and its microecological preparation are provided. By preparing a freeze-dried powder feed additive, the intestinal digestive and absorptive capacity and intestinal mucosal barrier function of juvenile large yellow croaker are improved, and the immune capacity is enhanced.
It significantly improves the survival rate, weight and specific growth rate of juvenile large yellow croaker, enhances intestinal digestive and absorptive capacity and mucosal barrier function, improves intestinal health, and reduces morbidity and mortality.
Smart Images

Figure CN121825825A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of aquatic feed probiotic additives, in particular to a Propionibacterium freudenreichii LC13, a microecological preparation and application thereof. BACKGROUND
[0002] Pseudosciaena crocea is a fish of Perciformes, Sciaenidae and Pseudosciaena, also known as yellow croaker, big fresh, yellow fish and cucumber. The body of Pseudosciaena crocea is elongated and flat; the otolith is slightly shield-shaped; the head and the front part of the body are covered with round scales, and the back part of the body is covered with scale-like scales; the lateral line is complete; the swim bladder is large and does not protrude on both sides to form a lateral sac; the dorsal fin is continuous, and there is a deep recess between the fin spine and the fin strip; the tail handle is thin, and the tail fin is wedge-shaped. The back of the body is grayish yellow; the scales on the lower part of the body side are often golden yellow due to the presence of a golden yellow gland, and the back fin and tail fin are grayish yellow, and the rest of the fins are yellow. At present, with the rapid development of intensive and large-scale breeding mode, the demand for high-quality seedlings continues to rise, and the quality and survival rate of seedling cultivation are increasingly required. However, during artificial breeding and early cultivation, juvenile fish often face complex and changing breeding environment, which easily causes intestinal health problems, resulting in high mortality.
[0003] The intestine is a core organ in the digestive and immune system of fish, which bears the important functions of nutrient digestion and absorption and resistance to pathogenic microorganism invasion. However, as the key period of fish intestinal development, the intestinal structure development of juvenile fish is not perfect, and the composition of intestinal flora is not reasonable, resulting in low digestive enzyme activity and incomplete establishment of immune barrier. The intestine of juvenile fish at this stage is easy to be stimulated by external environment, leading to intestinal damage and high mortality and morbidity, which seriously hinders the sustainable development of seedling cultivation. Therefore, it is urgent to take measures to promote the health of juvenile fish intestine, improve the digestive and absorptive capacity, and enhance the immune capacity, so as to reduce the morbidity and mortality of juvenile fish and promote the green and efficient development of aquaculture industry. SUMMARY
[0004] The purpose of the present application is to provide a Propionibacterium freudenreichii LC13, a microecological preparation and application thereof, so as to solve the problems existing in the prior art.
[0005] To achieve the above-mentioned purpose, the present application provides the following solutions.
[0006] The present application provides a Propionibacterium freudenreichii LC13, and the preservation number of the Propionibacterium freudenreichii LC13 is CCTCC NO: M 20252742.
[0007] The present application provides the application of the above-mentioned Propionibacterium freudenreichii LC13 in any one of the following,
[0008] (1) Preparation of microecological preparation for improving survival rate of large yellow croaker juveniles;
[0009] (2) Improving body weight of large yellow croaker juveniles;
[0010] (3) Preparation of microecological preparation for improving body weight of large yellow croaker juveniles;
[0011] (4) Improving specific growth rate of large yellow croaker juveniles;
[0012] (5) Preparation of microecological preparation for improving specific growth rate of large yellow croaker juveniles;
[0013] (6) Preparation of microecological preparation for improving intestinal digestion and absorption capacity of large yellow croaker juveniles;
[0014] (7) Preparation of microecological preparation for enhancing intestinal mucosal barrier function of large yellow croaker juveniles.
[0015] The present application provides a microecological preparation, which comprises the above-mentioned Propionibacterium freudenreichii LC13.
[0016] Preferably, the microecological preparation further comprises an auxiliary material;
[0017] The dosage form of the microecological preparation is a freeze-dried powder.
[0018] Preferably, the microecological preparation is used for improving survival rate of large yellow croaker juveniles, improving body weight of large yellow croaker juveniles, improving specific growth rate of large yellow croaker juveniles, improving intestinal digestion and absorption capacity of large yellow croaker juveniles and enhancing intestinal mucosal barrier function of large yellow croaker juveniles.
[0019] The present application provides application of the above-mentioned Propionibacterium freudenreichii LC13 or the above-mentioned microecological preparation in preparation of a feed additive or a feed.
[0020] The present application provides a feed additive, which comprises the above-mentioned Propionibacterium freudenreichii LC13 or the above-mentioned microecological preparation.
[0021] The present application provides a feed, which comprises the above-mentioned Propionibacterium freudenreichii LC13, the above-mentioned microecological preparation or the above-mentioned feed additive.
[0022] Preferably, the effective viable bacterial number of Propionibacterium freudenreichii LC13 in the feed is 1x10 8 ~4x10 8 cfu / g of feed.
[0023] The present application provides a method for feeding large yellow croaker juveniles, which comprises the step of feeding the above-mentioned feed to the large yellow croaker juveniles.
[0024] The present application discloses the following technical effects:
[0025] The application provides a Propionibacterium freudenreichii LC13, and the preservation number of the Propionibacterium freudenreichii LC13 is CCTCC NO: M 20252742. The application verifies through in-vivo experiments that the Propionibacterium freudenreichii LC13 separated from a commercially available fermented seafood food can be used for preparing a large yellow croaker juvenile fish feed additive and a large yellow croaker juvenile fish feed, and after the Propionibacterium freudenreichii LC13 is used as the large yellow croaker juvenile fish feed to feed the large yellow croaker juvenile fish, beneficial effects are obtained, and the beneficial effects are as follows: the Propionibacterium freudenreichii LC13 can improve the intestinal health of the large yellow croaker juvenile fish by improving the intestinal digestion and absorption capacity of the large yellow croaker juvenile fish and enhancing the intestinal mucosal barrier function of the large yellow croaker juvenile fish, and then the survival and growth of the large yellow croaker juvenile fish are improved. BRIEF DESCRIPTION OF DRAWINGS
[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative effort on the basis of these drawings.
[0027] Figure 1 It is a schematic diagram of the 16S rDNA gene phylogenetic tree of the Propionibacterium freudenreichii LC13;
[0028] Figure 2 It is a result graph of the influence of the Propionibacterium freudenreichii LC13 on the survival rate of the large yellow croaker juvenile fish;
[0029] Figure 3 It is a result graph of the influence of the Propionibacterium freudenreichii LC13 on the body weight in the growth performance of the large yellow croaker juvenile fish;
[0030] Figure 4 It is a result graph of the influence of the Propionibacterium freudenreichii LC13 on the growth rate in the growth performance of the large yellow croaker juvenile fish;
[0031] Figure 5 It is a result graph of the influence of the Propionibacterium freudenreichii LC13 on the trypsin activity in the intestinal digestion and absorption function of the large yellow croaker juvenile fish;
[0032] Figure 6 It is a result graph of the influence of the Propionibacterium freudenreichii LC13 on the lipase activity in the intestinal digestion and absorption function of the large yellow croaker juvenile fish;
[0033] Figure 7 It is a result graph of the influence of the Propionibacterium freudenreichii LC13 on the creatine kinase activity in the intestinal digestion and absorption function of the large yellow croaker juvenile fish;
[0034] Figure 8 It is a result graph of the influence of the Propionibacterium freudenreichii LC13 on the ATPase activity in the intestinal digestion and absorption function of the large yellow croaker juvenile fish;
[0035] Figure 9 Figure for the influence of Propionibacterium freudenreichii LC13 on the expression of the intestinal tight junction protein related zo1 gene of large yellow croaker juveniles;
[0036] Figure 10 Figure for the influence of Propionibacterium freudenreichii LC13 on the expression of the intestinal tight junction protein related zo2 gene of large yellow croaker juveniles;
[0037] Figure 11 Figure for the influence of Propionibacterium freudenreichii LC13 on the expression of the intestinal tight junction protein related claudin5 gene of large yellow croaker juveniles;
[0038] Figure 12 Figure for the influence of Propionibacterium freudenreichii LC13 on the expression of the intestinal tight junction protein related occludin gene of large yellow croaker juveniles.
[0039] Biological preservation information
[0040] The Propionibacterium freudenreichii LC13 provided by the present application was preserved in the China Center for Type Culture Collection on December 1, 2025, the preservation address is Wuhan, Wuhan University, China, and the preservation number is CCTCC M 20252742. DETAILED DESCRIPTION
[0041] Various exemplary embodiments of the present application will now be described in detail, which should be considered in a descriptive sense only and not for purposes of limitation to the present application. Rather, it is understood that certain features of the present application, to the extent they do not inherently conflict with each other, can be present in one or more embodiments of the application.
[0042] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where particular ranges of values are given, it is understood that each intervening value, to the extent it does not inherently conflict with the expression is encompassed by the disclosure. Any smaller ranges given greater than the minimum range, as well as smaller ranges within the minimum ranges stated, are also contemplated. These smaller ranges are also encompassed within the application.
[0043] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In the case of conflict between the present specification and any document incorporated by reference, the present specification will control.
[0044] Many modifications and variations of the present application described herein will be apparent to those of ordinary skill in the art from descriptions herein. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples herein. The description and examples herein are illustrative only.
[0045] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional, unrecited elements or method steps.
[0046] Example 1 Isolation and identification of Propionibacterium freudenreichii LC13.
[0047] 1. Isolation of Propionibacterium freudenreichii LC13
[0048] 10 g of commercially available fermented seafood food was added to 90 mL of MRS liquid medium, and cultured anaerobically at 37°C for 72 hours. After the fermentation culture was thoroughly mixed, 1 mL was subjected to 10-fold serial dilution. Subsequently, 100 μL of the 10 7 and 10 8 fold dilution of the fermentation broth was uniformly spread on MRS solid medium, and cultured anaerobically at 37°C for 72 hours. After single colonies were isolated, repeated streaking and purification were performed until a pure strain was obtained. The purified single colony was picked into MRS liquid medium, and cultured at a temperature of 28°C and a shaking speed of 200 rpm for 18 hours.
[0049] 2. Molecular identification of the isolated Propionibacterium freudenreichii LC13
[0050] The bacterial genomic DNA was extracted from the bacterial liquid, and the 16S rDNA sequence of the strain was amplified using 16S rDNA universal primers 27F (AGAGTTTGATCCTGGCTCAG, SEQ ID NO. 2) and 1492R (GGTTACCTTGTTACGACTT, SEQ ID NO. 3). The PCR reaction system was as follows: Premix STAR Max DNA Polymerase 12.5 μL, DNA template 2 μL, ddH2O 8.5 μL, forward primer 1 μL, reverse primer 1 μL. The PCR program was as follows: 98°C for 10 s, 55°C for 15 s, 72°C for 1.5 min, for a total of 35 cycles; 72°C for 10 min. The PCR product was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing. The obtained 16S rDNA sequence was compared on the NCBI website, and a phylogenetic tree was made, as shown in Figure 1 .
[0051] The strain is named as LC13, and the 16S rDNA sequence thereof is shown as SEQ ID NO. 1:
[0052]
[0053] From Figure 1 It can be seen that LC13 is clustered with MK756319.1 Propionibacterium freudenreichii and MF564051.1 Propionibacterium freudenreichii subsp. freudenreichii. Therefore, LC13 is preliminarily identified as Propionibacterium freudenreichii.
[0054] 3. Physiological and biochemical identification of Propionibacterium freudenreichii LC13
[0055] Strain LC13 is gram-positive and short rod-shaped, and the single colony on MRS solid medium is white, smooth, convex and round. The physiological and biochemical indexes of strain LC13 were determined by Hangzhou Binhe bacterial micro-biochemical reaction tube. Strain LC13 can utilize glucose, lactose, maltose, mannose, mannitol, fructose, galactose, beta-galactoside, lysine decarboxylase, urease, nitrate (reduction), glycerol, pyruvate sodium, acetate. The main physiological and biochemical characteristics are shown in Table 1. Combined with the morphological, physiological and biochemical results and the above-mentioned 16S rDNA phylogenetic tree results, it can be confirmed that strain LC13 is Propionibacterium freudenreichii, and is named as Propionibacterium freudenreichii LC13.
[0056] Table 1. Physiological and biochemical characteristics
[0057]
[0058] Note: +: positive, -: negative.
[0059] Subsequently, Propionibacterium freudenreichii LC13 was biologically preserved on December 01, 2025. The preservation center is China Center for Type Culture Collection, the preservation address is Wuhan University, Wuhan, China, and the preservation number is CCTCC NO: M 20252742.
[0060] Example 2. Preparation of Propionibacterium freudenreichii LC13 freeze-dried bacterial powder
[0061] The preserved Propionibacterium freudenreichii strain LC13 was inoculated into MRS solid medium and incubated at 30°C under anaerobic condition for 48-72 hours. A typical single colony was picked and inoculated into seed medium, wherein the activation medium and the seed medium used for activation were both composed of 10 g / L casein peptone, 5 g / L yeast extract powder and 10 mL / L (i.e. 1% v / v) 60% sodium lactate solution, and agar powder 15 g / L was added when used for preparing solid plates. The pH value of the medium was adjusted to 7.0-7.2 before sterilization. After inoculation, the seed liquid was incubated at 30°C under anaerobic condition for 24-36 hours to obtain the activated seed liquid.
[0062] The above seed liquid was inoculated into fermentation medium at a volume fraction of 5%-10% for anaerobic fermentation, wherein the fermentation medium was composed of 54.3 g / L glucose, 17.6 g / L yeast extract powder, 30 g / L corn syrup dry powder, 2.7 g / L potassium dihydrogen phosphate, 2 g / L ammonium sulfate and 3.5 g / L glycine, and the pH value of the fermentation medium was controlled at 7.0. The anaerobic fermentation was carried out at 30°C under anaerobic condition, and the anaerobic fermentation cycle was 42 hours.
[0063] After the fermentation was completed, the fermentation liquid was separated by centrifugation at 12000 rpm (centrifugation time: 10 minutes) using a tubular centrifuge to collect the wet bacteria. Then, the obtained wet bacteria were uniformly mixed with a pre-cooled freeze-drying protective agent solution at a mass ratio of 1:1 (w / w) to obtain a bacteria suspension. The freeze-drying protective agent was prepared by dissolving the following components in water: 8% skim milk powder, 6% trehalose, 2% fructose, 0.7% glycine and 0.1% L-cysteine hydrochloride.
[0064] The uniformly mixed bacteria suspension was pre-frozen at -45°C for 4 hours, and then transferred to a freeze dryer. Under a vacuum degree of <20 Pa, sublimation drying (the baffle temperature was slowly increased from -10°C to 5°C, and maintained for 30 hours) and desorption drying (the baffle temperature was increased to 28°C, and maintained for 8 hours) were carried out to finally obtain dried bacteria powder. After low-temperature crushing, a powder product with good fluidity was obtained, i.e. the freeze-dried bacteria powder of Propionibacterium freudenreichii LC13, wherein the effective viable count of Propionibacterium freudenreichii LC13 in the freeze-dried bacteria powder was between 1×10 11 cfu / g and 1.8×10 11 cfu / g.
[0065] Example 3 Preparation of feed for juvenile Pseudosciaena crocea containing the Propionibacterium freudenreichii LC13
[0066] The raw materials and the amounts of the basic feed for the juvenile Pseudosciaena crocea used in the embodiments of the present application are shown in Table 2. The above raw materials are screened with a 120 mesh screen, and then mixed according to the order of gradual enlargement. The freeze-dried bacteria powder of Propionibacterium freudenreichii LC13 with different amounts of live bacteria obtained according to the preparation method of Example 2 is diluted with an equal amount of sterile ultrapure water to obtain a suspension containing different amounts of live bacteria. The suspension containing different amounts of live bacteria is added to the basic feed, and mixed to make the content of the bacteria added to the feed be 1×10 8 cfu / g~4×10 8 cfu / g. The control group feed is the basic feed to which an equal volume of microcrystalline cellulose solution (concentration of 2 g / mL) is added. Finally, the feed is extruded into an elongated strip shape using an axial single-screw spherical extruder, and then the feed is made into microparticle feed with a particle size of 1 mm using a rounding machine. The prepared microparticle feed is air-dried indoors and stored in a 4℃ refrigerator.
[0067] Table 2 Formulation of the basic feed
[0068]
[0069] Note: 1 Multi-vitamins (mg / kg): retinyl acetate, 32; α-tocopherol, 240; menadione, 10; thiamine hydrochloride, 25; pyridoxine hydrochloride, 20; vitamin B12, 10; riboflavin, 45; pantothenic acid, 60; vitamin D3, 5; folic acid, 20; nicotinic acid, 200; biotin, 60; myo-inositol, 800; microcrystalline cellulose, 13473;
[0070] 2 Multi-minerals: MgSO4·7H2O, 1200; FeSO4·H2O, 80; ZnSO4·H2O, 50; CuSO4·5H2O, 10; MnSO4·H2O, 45; CoCl2·6H2O, 50; Na2SeO3, 20; H2CaIO4, 60; zeolite powder, 13485.
[0071] Example 4 Application effect of Propionibacterium freudenreichii LC13 on the feed of juvenile Pseudosciaena crocea
[0072] The juvenile Pseudosciaena crocea used in the experiment has an initial weight of 4.99±0.48 mg, and 36000 individuals are randomly divided into 4 groups, with 3 replicates in each group, and 3000 individuals in each replicate, for a feeding growth experiment for 30 days. The water temperature is 23-26℃, the pH is 7.8-8.2, and the salinity is 22-24‰.
[0073] The experimental groups are fed with the basic feed to which 1×10 8 cfu / g, 2×10 8 cfu / g and 4×108 cfu / g of feed of Propionibacterium freudenreichii LC13 prepared as in Example 3, fed 7 times a day, always ad libitum, at 05:30, 08:30, 10:30, 13:30, 15:30, 17:30 and 23:00.
[0074] The specific growth rate and survival rate of the juvenile P. major were calculated by weighing and counting at the beginning and end of the culture.
[0075] The extraction of the intestinal brush border membrane was first performed by homogenizing the intestinal segment in 2 mL of a mixture containing 50 mmol / L mannitol and 2 mmol / L Tris (1:1, by volume). Subsequently, 1 mL of 0.1 mol / L CaCl2solution was added to the homogenate. Next, the mixture was centrifuged at 9000 x g for 10 min, and the supernatant was collected. Then, the supernatant was centrifuged at 34000 x g for 20 min, and the supernatant was discarded. Finally, the obtained intestinal brush border membrane-rich pellet was resuspended in 1 mL of a mixture consisting of 0.1 mol / L KCl, 5 mmol / L Tris-Hepes (pH = 7.5), and 1 mmol / L DTT (1:1:1, by volume). This method effectively isolated the intestinal brush border membrane.
[0076] Lipase, trypsin, Na + K + Both the ATPase and creatine kinase assays were performed using commercial kits, which were purchased from Nanjing Jiancheng Biological Engineering Institute; the kit names were:
[0077] Lipase assay kit (microplate method) (A054-2-1), trypsin assay kit (ultraviolet colorimetric method) (A080-2-2), ultra-micro Na + K + -ATPase (tissue, general cell) kit (A070-2-2), creatine kinase (CK) assay kit (colorimetric method).
[0078] The expression level of intestinal mucosal barrier related genes was determined by quantitative q-PCR. ChamQ Universal SYBR qPCR Master Mix (Novozyme Biotech Co., Ltd.) was used to detect the following genes by q-PCR, and the expression of mRNA was obtained, and beta-actin (β-actin) was used as an internal reference gene. The q-PCR primers were designed according to the nucleotide sequence of P. olivaceus (Table 3).
[0079] Table 3 q-PCR primer sequences
[0080]
[0081] The experimental data were statistically analyzed by one-way ANOVA in SPSS 20.0, and Tukey's multiple comparison was performed after significant difference, with a significant level of P<0.05. The experimental data were expressed as means ± S.E.M. (n=3). The results are shown in Figures 2-12 .
[0082] The experimental results show that the survival rate of P. olivaceus juveniles fed with 1×10 8 ~4×10 8 cfu / g of P. faecium LC13 feed showed an upward trend, although there was no significant difference, but the survival rate was higher than that of the control group (P>0.05) Figure 2 . In addition, the final weight and specific growth rate of P. olivaceus juveniles fed with 4×10 8 cfu / g of P. faecium LC13 feed were significantly higher than those of the control group (P<0.05) Figure 3 and Figure 4 . For the digestive and absorptive function of P. olivaceus juveniles, the addition of 4×10 8 cfu / g of P. faecium LC13 significantly improved the trypsin activity in the intestine of P. olivaceus juveniles (P<0.05), and the addition of 2×10 8 cfu / g of P. faecium LC13 significantly improved the lipase activity in the intestine of P. olivaceus juveniles (P<0.05) Figure 5 and Figure 6 . In addition, the enteric brush border muscle creatine kinase activity of P. olivaceus juveniles fed with 4×10 8 cfu / g of P. faecium LC13 feed was significantly higher than that of the control group (P<0.05) Figure 7 , and at the same time, the addition of 1×10 8 cfu / g~4×108 cfu / g of P. freudenreichii LC13 feed on the intestinal brush border Na + -K + -ATPase activity was significantly higher than that of the control group (P<0.05) Figure 8 For the intestinal mucosal barrier function of large yellow croaker larvae, feeding 4×10 8 cfu / g of P. freudenreichii LC13 significantly increased the expression of intestinal tight junction protein-related genes (zo1, zo2, claudin5 and occludin) of large yellow croaker larvae (P<0.05) Figures 9-12 In summary, compared with the control group, the addition of P. freudenreichii LC13 significantly improved the digestive and absorptive capacity of the intestinal tract of large yellow croaker larvae, enhanced the intestinal mucosal barrier function, improved the intestinal health, and thus improved the survival and growth.
[0083] The above-described embodiments are only to describe the preferred modes of the present application, and not to limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.
Claims
1. A strain of Propionibacterium freudenreichii LC13, characterized in that, The preservation number of Propionibacterium fischeri LC13 is CCTCC NO: M 20252742.
2. The use of Propionibacterium fischeri LC13 as described in claim 1 in any of the following: (1) Preparation of a microecological agent to improve the survival rate of juvenile large yellow croaker; (2) Increase the weight of juvenile large yellow croaker; (3) Preparation of a microecological agent to increase the weight of juvenile large yellow croaker; (4) Improve the specific growth rate of juvenile large yellow croaker; (5) Prepare a microecological preparation to improve the specific growth rate of juvenile large yellow croaker; (6) Prepare a microecological preparation to improve the intestinal digestion and absorption capacity of juvenile large yellow croaker; (7) Prepare a microecological preparation to enhance the intestinal mucosal barrier function of juvenile large yellow croaker.
3. A microecological preparation, characterized in that, The microecological preparation includes Propionibacterium fischeri LC13 as described in claim 1.
4. The microecological preparation according to claim 3, characterized in that, The microecological preparation also includes excipients; The dosage form of the microecological preparation is lyophilized powder.
5. The microecological preparation according to claim 3 or 4, characterized in that, The microecological preparation is used to improve the survival rate of juvenile large yellow croaker, increase the weight of juvenile large yellow croaker, increase the specific growth rate of juvenile large yellow croaker, improve the intestinal digestion and absorption capacity of juvenile large yellow croaker, and enhance the intestinal mucosal barrier function of juvenile large yellow croaker.
6. The use of Propionibacterium fischeri LC13 as described in claim 1 or the microecological preparation as described in any one of claims 3-5 in the preparation of feed additives or feed.
7. A feed additive, characterized in that, The feed additive includes Propionibacterium fischeri LC13 as described in claim 1 or the microecological preparation as described in any one of claims 3-5.
8. A feed, characterized in that, The feed includes Propionibacterium fischeri LC13 as described in claim 1, the microecological preparation as described in any one of claims 3-5, or the feed additive as described in claim 7.
9. The feed according to claim 8, characterized in that, The effective viable count of Propionibacterium fibrillosa LC13 in the feed was 1×10⁻⁶. 8 ~4×10 8 cfu / g feed.
10. A method for raising juvenile large yellow croaker, characterized in that, The step includes feeding juvenile large yellow croaker the feed described in claim 8 or 9.