Method for improving rooting and growth traits of poplar by knocking out PeMYB33 gene

Abstract

The invention discloses a method for improving poplar rooting and growth traits by knocking out a PeMYB33 gene, and belongs to the technical field of plant genetic engineering. According to the method, a multi-target CRISPR / Cas9 gene editing vector is constructed by designing specific sgRNA targeting a PeMYB33 gene exon region in Nanlin 895 poplar, an agrobacterium-mediated method is utilized to transform poplar, and a PeMYB33 gene knockout mutant is obtained through screening and identification. Compared with a non-transgenic plant, the mutant has the advantages that the cutting rooting quantity is obviously increased, and the obvious plant height growth advantage is shown. The invention provides a new germplasm with excellent rooting ability and fast-growing potential for genetic improvement of the poplar, and has important application value in improved variety breeding of the poplar and afforestation of land where the poplar is difficult to grow.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a method for improving the rooting and growth traits of poplar trees by knocking out the PeMYB33 gene. Background Technology

[0002] The formation of adventitious roots is regulated by a complex genetic network, in which transcription factors play a crucial role. The MYB transcription factor family, especially the R2R3-MYB subfamily, has been shown to play important roles in plant growth and development, secondary metabolism, and stress response. Studies have shown that genes such as AtMYB33 in Arabidopsis thaliana are involved in floral organ development and hormone responses, but their function in forest tree root development remains unclear.

[0003] Traditional poplar breeding relies mainly on hybridization and selection, which suffers from problems such as long cycles, low efficiency, and easy linkage between desirable traits (e.g., rapid growth) and undesirable traits (e.g., difficulty in rooting). In recent years, the maturity of CRISPR / Cas9 gene editing technology has provided a new approach for the precise improvement of forest tree traits. This technology can achieve targeted knockout or modification of specific genes, thereby rapidly creating new germplasm with the desired traits. Currently, research using this technology to edit poplar rooting-related genes is still limited, especially regarding the functional verification and breeding applications of the MYB33 gene, which have not yet been reported.

[0004] Therefore, the method of precisely regulating the rooting traits of poplar trees from the genetic essence, thereby improving the rooting and growth traits of poplar trees, has important theoretical value and application prospects for overcoming the rooting difficulties of existing poplar varieties, accelerating the breeding process of superior varieties, and improving the afforestation effect in difficult sites. Summary of the Invention

[0005] To overcome the shortcomings of existing technologies, the primary technical problem to be solved in this application is to provide a method for obtaining enhanced rooting ability and / or height growth advantage of poplar trees by knocking out the PeMYB33 gene using CRISPR / Cas9.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0007] An sgRNA for knocking out the poplar PeMYB33 gene via a CRISPR / Cas9 system, wherein the target sequence of the sgRNA is selected from the sequences shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.

[0008] A gene-engineered vector capable of expressing the sgRNA.

[0009] In some embodiments, the genetic engineering vector contains a gRNA expression cassette sequence as shown in SEQ ID NO.7.

[0010] A recombinant Agrobacterium, wherein the recombinant Agrobacterium contains the aforementioned gene engineering vector.

[0011] A kit containing the gRNA, the genetic engineering vector, or the recombinant Agrobacterium.

[0012] A method for knocking out the PeMYB33 gene in poplar trees, wherein the method uses the sgRNA, or the genetic engineering vector, or the recombinant Agrobacterium, to knock out the PeMYB33 gene in poplar cells or tissues via a CRISPR / Cas9 system.

[0013] In some embodiments, the poplar is 'Nanlin 895 Poplar'.

[0014] In some embodiments, the method includes the following steps:

[0015] Poplar stem explants were infected and co-cultured with the recombinant Agrobacterium, followed by resistant bud induction screening, rooting culture and molecular identification to obtain PeMYB33 gene mutant plants. Compared with wild type, the PeMYB33 gene mutant plants have enhanced cutting rooting ability and / or plant height growth advantage.

[0016] Poplar cells, tissues, or plants with PeMYB33 gene editing obtained by the method.

[0017] The application of poplar cells, tissues, or plants edited with the PeMYB33 gene in poplar genetic improvement or forest tree breeding.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] This application uses the MYB33 gene, a member of the R2R3-MYB family, as the cloning target. The protein-coding sequence and genomic sequence of PeMYB33 were amplified from 'Nanlin 895 Poplar' using PCR technology. Four sgRNA targets were designed for the exon regions of this gene. A CRISPR / Cas9-PeMYB33 knockout vector was constructed using the pYLCRISPR / Cas9 system, and 'Nanlin 895 Poplar' was successfully transformed using Agrobacterium-mediated transformation to obtain transgenic lines. Sanger sequencing screening identified five gene-editing mutant lines: NFUmyb33-895KO#71, NFUmyb33-895KO#74, NFUmyb33-895KO#79, NFUmyb33-895KO#90, and NFUmyb33-895KO#115. Phenotypic analysis showed that, compared with non-transgenic plants, the mutant lines significantly increased the number of roots produced from cuttings and exhibited a clear advantage in plant height, making them potential new lines for poplar genetic improvement. Therefore, the enhanced rooting ability and height advantage of the PeMYB33 gene mutant poplar plants obtained through the method of this invention can improve afforestation survival rate and early growth, which is of significant practical importance in alleviating the production bottleneck problem of "difficulty in rooting" in some fast-growing poplar clones. The method of this invention provides a referable technical path for the genetic improvement of traits in poplar and even other forest trees. Attached Figure Description

[0020] Figure 1 This is a schematic diagram of the PeMYB33 gene structure;

[0021] Figure 2 Subcellular localization of PeMYB33 in poplar protoplasts; Note: GFP represents green fluorescence; Auto represents chloroplast autofluorescence; Bright represents bright-field microscopy; Merge1 represents all fluorescence fusion; Merge2 represents all fluorescence and bright-field fusion; Scale bar is 20 μm;

[0022] Figure 3 Diagram of the PeMYB33 gene and vector components;

[0023] Figure 4 Image showing transgenic positive plants identified by PCR;

[0024] Figure 5 Figure showing the editing status of the target site NFUmyb33-895KO#71 in the mutant plant;

[0025] Figure 6 Figure showing the editing status of the target site NFUmyb33-895KO#74 in the mutant plant;

[0026] Figure 7Figure showing the editing status of the target site NFUmyb33-895KO#79 in the mutant plant;

[0027] Figure 8 Figure showing the editing status of the target site NFUmyb33-895KO#90 in the mutant plant;

[0028] Figure 9 Figure showing the editing progress of the target site NFUmyb33-895KO#115 in the mutant plant. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. Unless otherwise described in detail, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, or are performed according to the kit and product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0030] Example 1: Cloning and sequence analysis of the poplar PeMYB33 gene

[0031] Using cDNA from 'Nanlin 895 Populus tomentosa' as a template, the full-length sequence of PeMYB33 was obtained using RACE technology. The complete cDNA sequence is 1966 bp long, including a 1395 bp ORF, a 445 bp 5'-UTR, and a 126 bp 3'-UTR. Amplification and cloning sequencing using 'Nanlin 895 Populus tomentosa' DNA yielded a 2081 bp DNA sequence (SEQ ID NO.1). Alignment revealed that PeMYB33 contains one intron (…). Figure 1 ORF sequence analysis showed that PeMYB33 encodes a 464-amino acid protein (SEQ ID NO.2), with serine being the most abundant, accounting for 12.1%. Physicochemical properties of the PeMYB33 protein were predicted using the ExPASy ProtParam tool, revealing a relative molecular mass (MW) of 51.23 kDa, a theoretical isoelectric point (pI) of 5.32, and a gravitational affinity of -0.605, indicating that it is a hydrophilic protein. Further prediction of its secondary structure using SPOIMA software revealed that the PeMYB33 protein contains various structural elements, including α-helices (Hh), β-turns (Tt), extended strands (Ee), and random coils (Cc) (Table 1).

[0032] Table 1 Structural characteristics of PeMYB3 protein

[0033]

[0034] Using Gateway technology, the ORF sequence of PeMYB33 (excluding the stop codon) was ligated to the transient overexpression vector p2FGW7.0. Transient expression vectors with correct sequence and insertion orientation were obtained after bacterial culture detection and sequencing. Subcellular localization of PeMYB33 protein was observed using poplar protoplast experiments. The positive control 35S::GFP plasmid and the constructed transient expression vector 35S::PeMYB33-GFP containing the target gene fragment were transformed into isolated poplar leaf mesophyll protoplasts using PEG-mediated transformation. After approximately 16 hours of incubation in the dark, subcellular localization results were observed and analyzed under a fluorescence microscope. As shown in the figure, the PeMYB33-GFP fusion protein is mainly located in the cell nucleus (…). Figure 2 ).

[0035] Example 2: Construction of CRISPR / Cas9 gene editing vector

[0036] Four specific sgRNA targets were designed and screened using CRISPR-GE online software targeting the conserved sequence of the PeMYB33 gene coding region (exon) of 'Nanlin 895 Yang', as follows:

[0037] Target 1: GATTTGAGTCGATATTGGGCG (SEQ ID NO.3);

[0038] Target 2: GCAGAGCAACAGTTATGGGA (SEQ ID NO.4);

[0039] Target 3: AAGCAGCCATGCTGATGGA (SEQ ID NO.5);

[0040] Target 4: CTTCTGAGGCTGTGAAGTTG (SEQ ID NO.6).

[0041] Four expression cassettes were ligated and constructed into the pYLCRISPR / Cas9p35s-DN vector. Figure 3 Each expression cassette contains a promoter and an sgRNA with a 20bp target site. The AtU3d, AtU3b, AtU6-1, and AtU6-29 promoters initiate sgRNA transcription. The 20bp target site is designed to target the exon region of the gene and is recognized and cleaved by the Cas9 protein. The PeMYB33 gene target gRNA expression cassette sequence was constructed and inserted into the pYLCRISPR / Cas9p35s-DN vector.

[0042] Example 3: Obtaining, positive identification, and sequence analysis of transgenic poplar trees

[0043] After thawing EHA105 Agrobacterium competent cells on ice, 100 ng of CRISPR-PeMYB33 vector was added. After ice bath, liquid nitrogen flash freezing and 37℃ heat shock followed by ice bath, the cells were recovered in antibiotic-free LB medium for 3 hours. After centrifugation, the cells were spread on LB plates containing Kan and Rif. After incubation at 28℃ for 48 hours, single colonies were picked for expansion culture. After PCR verification of positive results, the target seed culture was obtained. The genetic transformation steps of poplar are as follows: (1) 1 mL of PCR positive bacterial culture was inoculated into 5 mL of LB liquid medium containing Kan and Rif and cultured at 28℃ and 250 rpm for 12 hours to obtain the seed culture. (2) 1 mL of seed culture was transferred to 50 mL of the same medium and cultured at 28℃ and 250 rpm until OD. 600 (3) After centrifuging the bacterial solution at 5000 rpm for 10 minutes, discard the supernatant and resuspend the bacterial cells in 50 mL of fresh culture medium. (4) Melt 50 mL of solid culture medium (T1) for callus culture and add 20 μM acetylsuccinone (AS), mix well and pour into a plate to allow coagulation. (5) Select petioles of well-grown 'Nanlin 895 Populus davidiana' tissue culture seedlings and cut them into 0.3 cm segments. Take 10 segments and place them in T1 culture medium as a negative control, and immerse the rest in positive bacterial solution for 10 min. After filtration, aspirate the bacterial solution on the surface of the petiole and transfer it to antibiotic-free T1 culture medium. (6) After culturing at 25℃ in the dark for 48 h, wash with T1 liquid culture medium containing Tim (100 mg / mL) for 10 min by shaking. (7) After filtration and aspirate again, take 10 segments and place them in T1 culture medium containing Tim as a positive control, and inoculate the rest in T1 culture medium containing Kan and Tim, and culture under light for 2 weeks until callus formation. (8) Filter the petioles using a cell sieve and blot off excess liquid culture medium on the petioles with filter paper. Take 10 petioles and place them in T1 solid medium containing Tim as a positive control. Place the remaining petioles in T1 solid medium containing Kan and Tim and culture them under normal light for about 2 weeks to grow callus tissue. (9) Transfer the callus tissue to differentiation medium (T2) containing Kan and Tim. After adventitious buds form, transfer them to seedling strengthening medium (T3) containing the same antibiotic. (10) When the adventitious buds grow to 1 cm, cut them and transfer them to rooting medium (WPM) containing the same antibiotic to induce rooting.

[0044] First, the genomic DNA of transgenic plants was amplified using primers SP-DL and SP-R containing gRNA expression cassettes to detect whether the knockout vector was successfully introduced into the plants. Subsequently, genomic DNA was extracted from positive transgenic plants and wild-type plants for PCR molecular detection. The electrophoresis results are shown below. Figure 4As shown. After Sanger sequencing of the PCR products, the sequencing files were analyzed using decoding software (https: / / ice.synthego.com / ) to screen for strains with bimodal peaks. The PCR reaction system was as follows: PrimeSTAR MAX premix (2×) 25 μL, Crispr-PeMYB33F 1 μL, Crispr-PeMYB33R 1 μL, cDNA / DNA 1 μL, ddH2O 22 μL. The reaction tubes were placed in the PCR instrument, and the cycling program was set according to the following parameters: 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 56℃ annealing for 5 s, 72℃ extension for 5 s, 32 cycles; final extension at 72℃ for 3 min, and storage at 4℃. Subsequently, the amplified target gene was cloned into the Blunt Zero vector using the Blunt Zero cloning kit, and 12 recombinant colonies from each strain were selected for Sanger sequencing. Finally, the mutated knockout transgenic plants were obtained.

[0045] Further screening using direct sequencing of PCR products and Sanger sequencing identified five lines with editing activity, including two homozygous mutants (NFUmyb33-895KO#74 and NFUmyb33-895KO#79) and three heterozygous mutants (NFUmyb33-895KO#71, NFUmyb33-895KO#90, and NFUmyb33-895KO#115). Direct sequencing of the PCR product of the NFUmyb33-895KO#71 mutant revealed a heterogeneous peak at target site 4. Single-clone sequencing results showed a 27-base deletion in one allele at target site 4. However, no editing was detected in the other allele, indicating a heterozygous mutation. Figure 5 Direct sequencing of the PCR product of the NFUmyb33-895KO#74 mutant revealed a 3-base deletion at target site 4, with a single peak at the editing site and no extraneous peaks. Single-clone sequencing verification showed that all sequencing results were consistent with the direct PCR sequencing results, indicating a homozygous mutant. Figure 6 The NFUmyb33-895KO#79 mutant is also a homozygous mutant, with an insertion of one A base after the first base upstream of the PAM at target site 4, and a deletion of 8 bases (corresponding to bases 2-8 upstream of the PAM in the original sequence). Figure 7 The NFUmyb33-895KO#90 mutant exhibits a heterozygous mutation, with an insertion of only one A base in one allele at target site 4. Figure 8The NFUmyb33-895KO#115 mutant has an 8-base deletion in only one allele at target site 4, classifying it as a heterozygous mutation. Figure 9 ).

[0046] Example 4: Phenotypic analysis of PeMYB33 gene-edited mutant plants

[0047] The PeMYB33 gene-edited mutants (NFUmyb33-895KO#71, #74, #79, #90,#115) identified above, along with the non-transgenic wild-type control (895CK), were propagated by micro-cutting under the same conditions. After 40 days of culture, the rooting status and plant height growth of each line were statistically analyzed.

[0048] Table 2. Statistical analysis of root number and plant height of PeMYB33 gene-edited mutant and control.

[0049]

[0050] The statistical results are shown in Table 2. The results indicate that, compared with the wild-type control, several mutant lines exhibited significant phenotypic improvements. For example, the average number of adventitious roots in lines #79 and #90 was significantly higher than the control, indicating an increase in the number of adventitious roots. The average plant height of lines #74 and #79 during the same growth period was significantly higher than the control. These results demonstrate that knocking out the PeMYB33 gene using CRISPR / Cas9 technology can yield new poplar germplasm with enhanced rooting ability and faster growth.

[0051] The above description is illustrative only and not restrictive of the present invention. Those skilled in the art will understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all such modifications, variations or equivalents will fall within the protection scope of the present invention.

Claims

1. An sgRNA for knocking out the PeMYB33 gene in poplar trees using a CRISPR / Cas9 system, characterized in that, The target sequence of the sgRNA is selected from the sequence shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO:

6.

2. A gene engineering vector, characterized in that, The genetic engineering vector is capable of expressing the sgRNA as described in claim 1.

3. The gene engineering vector as described in claim 2, characterized in that, The genetic engineering vector contains a gRNA expression cassette sequence as shown in SEQ ID NO.

7.

4. A recombinant Agrobacterium, wherein the recombinant Agrobacterium contains the gene engineering vector as described in claim 2 or 3.

5. A kit comprising the gRNA of claim 1, the genetic engineering vector of claim 2 or 3, or the recombinant Agrobacterium of claim 4.

6. A method for knocking out the PeMYB33 gene in poplar, characterized in that, The method uses the sgRNA described in claim 1, or the gene engineering vector described in claims 2 and 3, or the recombinant Agrobacterium described in claim 4, to knock out the poplar PeMYB33 gene in poplar cells or tissues using the CRISPR / Cas9 system.

7. The method as described in claim 6, characterized in that, The poplar tree in question is 'Nanlin 895 Poplar'.

8. The method as described in claim 6, characterized in that, The method includes the following steps: Poplar stem explants were infected and co-cultured with the recombinant Agrobacterium described in claim 4, followed by resistant bud induction screening, rooting culture and molecular identification to obtain PeMYB33 gene mutant plants. Compared with wild type, the PeMYB33 gene mutant plants have enhanced cutting rooting ability and / or plant height growth advantage.

9. Poplar cells, tissues, or plants with PeMYB33 gene editing obtained by the method of any one of claims 6-8.

10. The application of the poplar cells, tissues or plants according to claim 9 in poplar genetic improvement or forest tree breeding.

Images