Application of AHP2 gene in regulating and controlling salt tolerance, plant height, tiller number and grain traits of rice
By overexpressing or knocking out the AHP2 gene in rice, and using the CRISPR/Cas9 system and homologous recombination technology, the problem of poor agronomic traits associated with existing salt tolerance genes was solved. This achieved synergistic improvement of rice salt tolerance, plant height, tiller number, and grain traits, and cultivated a new high-efficiency, stress-resistant, and high-yielding rice variety.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-16
- Publication Date
- 2026-04-10
AI Technical Summary
Existing salt tolerance genes often improve rice stress resistance but are accompanied by undesirable agronomic traits, such as dwarfing, reduced tillering, and smaller grains. There is a lack of gene resources that can synergistically improve rice salt tolerance with multiple important agronomic traits such as plant height, tillering, and grain size. Furthermore, the function of the rice AHP2 gene in abiotic stress and growth and development is unknown.
By overexpressing or knocking out the AHP2 gene in rice, the expression level or activity of the AHP2 gene can be regulated using the CRISPR/Cas9 system and homologous recombination technology, thereby achieving positive regulation of rice salt tolerance, plant height, tiller number and grain traits.
The AHP2 gene is not only a positive regulator of rice salt tolerance, but also maintains normal plant height, tiller number, and grain development. It achieves synergistic positive regulation of salt tolerance and multiple key yield traits, breaking through the adverse chain effects in traditional breeding and cultivating new rice varieties that are both stress-resistant and high-yielding.
Smart Images

Figure CN121825995A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and relates to... AHP2 Application of genes in regulating rice salt tolerance, plant height, tiller number and grain traits. Background Technology
[0002] Rice ( Oryza sativa Rice (L.) is the staple food for nearly half the world's population, and its production stability is directly related to food security. However, soil salinization is becoming increasingly serious globally, severely restricting rice yields. Salt stress not only directly inhibits rice germination and seedling growth, leading to reduced yields, but also disrupts the plant's ion homeostasis and physiological metabolism, affecting final yield components such as plant height, tiller number, and grain traits.
[0003] Breeding salt-tolerant and high-yielding rice varieties is the fundamental way to address the challenges of saline-alkali land. The core of this approach lies in identifying key salt-tolerant genes and elucidating their functions. Currently, researchers have cloned a number of rice salt-tolerant genes, mainly involving ion transport (such as...). OsHKT1;5 , OsNHX1 ), osmotic regulation (such as OsP5CS ) and reactive oxygen species scavenging (such as OsAPX8 However, current research on salt-tolerance genes mostly focuses on single stress response pathways. A significant shortcoming is that while most known salt-tolerance genes improve stress resistance, they often have negative impacts on normal plant growth and development, especially on key yield traits such as plant height, tillering ability, and grain size, or their associations are unclear. For example, some salt-tolerance-related mutants are often accompanied by undesirable agronomic traits such as dwarfing, reduced tillering, or smaller grains, which severely limits their direct application value in breeding. Therefore, finding and creating key genes that can synergistically improve salt tolerance and major yield traits, or improve salt tolerance without harming or even optimizing agronomic traits, has become a bottleneck that urgently needs to be overcome in the field of molecular breeding.
[0004] Cytokinins, as an important class of plant hormones, are widely involved in various biological processes such as cell division, plant development, and stress response. Histidine phosphotransferases (AHPs) are key mediators of cytokinin signaling from cell membrane receptors to the cell nucleus. In rice, the functions of the AHP gene family have not been fully elucidated, especially whether and how the AHP2 gene participates in salt stress response and simultaneously regulates core agronomic traits such as plant height, tillering, and grain development. This lack of understanding of the gene's function prevents the development and utilization of a potential key node that simultaneously regulates stress resistance and development.
[0005] In summary, existing technologies have the following shortcomings: 1) a lack of single-gene resources that can effectively and synergistically improve multiple important agronomic traits in rice, such as salt tolerance, plant height, tillering, and grain size; 2) a lack of key components of the rice cytokinin signaling pathway. AHP2 The specific functions and molecular mechanisms of genes in abiotic stress and growth and development are completely unknown, and their application value in breeding remains unexplored. This invention aims to fill this technological gap. Summary of the Invention
[0006] The existing salt tolerance genes in the background technology are insufficient to synergistically improve the stress resistance and key agronomic traits of rice, and rice AHP2 This invention aims to fill the technological gap of unknown gene function and provide [something]. AHP2 A novel application of genes. Specifically, the technical problem this invention aims to solve includes: providing a key gene resource capable of simultaneously and positively regulating rice salt tolerance while maintaining or optimizing plant height, tiller number, and grain traits, overcoming the shortcomings of traditional salt tolerance genes that are often accompanied by undesirable agronomic phenotypes. Revealing the rice... AHP2 The multifunctionality of genes in abiotic stress and growth and development should be investigated to clarify their application value and direction in molecular breeding.
[0007] To solve the above-mentioned technical problems, the present invention provides the following technical solution: In a first aspect, the present invention provides AHP2 The application of genes or their encoded proteins in regulating agronomic traits in rice, wherein the agronomic traits include at least one of salt tolerance, plant height, tiller number, and grain traits; AHP2 The CDS sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence it encodes is shown in SEQ ID NO.2.
[0008] The application involves overexpression in rice. AHP2 Genes that enhance rice's salt tolerance; by knocking out genes in rice. AHP2 Genes can reduce rice plant height, decrease the number of tillers, and reduce grain length, width, thickness, and thousand-grain weight.
[0009] In the aforementioned application, overexpression is performed in rice. AHP2 To improve the salt tolerance of rice, the following steps were performed: Using cDNA from Wuyunjing 7 as a template, the full-length (450 bp) coding region of AHP2 was amplified by PCR and ligated into the pCAMBIA1300-ubi-GFP vector via homologous recombination to construct a recombinant overexpression vector. This recombinant vector was then transformed into Wuyunjing 7 using Agrobacterium-mediated transformation, and the resulting rice varieties were screened for optimal salt tolerance. AHP2 Highly expressed transgenic lines ( AHP2 -OE). The primers for the PCR amplification are: Forward primer: AHP2-OE-F: TGTTACTTCTGCAGGAGCTCATGGCGGCCGCCGCTCTC (SEQ ID NO.3); Reverse primer: AHP2-OE-R: CTCACCATGGATCCGGTACCTTGCTGCTTGGGATCATAAG (SEQ ID NO.4).
[0010] In the aforementioned application, knockout is performed in rice. AHP2 Genes that reduce rice plant height, decrease tiller number, and reduce grain length, width, thickness, and thousand-grain weight include the following steps: constructing the gene using the CRISPR / Cas9 system. AHP2 The gene knockout vector was transferred into the callus tissue of Wuyunjing 7 varietal using Agrobacterium-mediated transformation to obtain transgenic plants. In the CRISPR / Cas9 system, AHP2 The primer pairs for the gene target sites are as follows: AHP2-U3-F: GGCAACCCGTCGTCAACTTCGATA (SEQ ID NO.5) and AHP2-U3-R: AAACTATCGAAGTTGACGACGGGT (SEQ ID NO.6).
[0011] Secondly, the present invention provides a method for cultivating rice with improved traits, the method comprising regulating the genetic characteristics of rice recipient varieties through genetic manipulation. AHP2 Gene expression levels or protein activity; the improved traits include increased salt tolerance, and / or, maintaining normal plant height, tiller number, and grain traits.
[0012] The genetic manipulation methods include: using transgenic technology to modify the genetically modified organism containing the genetically modified organism. AHP2 The expression vector of the gene CDS sequence was introduced into rice cells to obtain... AHP2 Rice materials with increased gene expression levels.
[0013] In this embodiment, the present invention also utilizes gene editing technology to knock out endogenous genes in rice. AHP2 Genes make AHP2 The expression level of the gene decreases, thus gaining ahp2 In loss-of-function rice materials, knockout rice showed significantly reduced plant height, significantly reduced tiller number, and significantly reduced grain length, grain width, grain thickness, and thousand-grain weight; scanning electron microscopy revealed mutants. AHP2 The length and width of the grain epidermal cells were significantly reduced, indicating that AHP2 The deletion of the gene affects the expansion of seed cells, resulting in smaller seeds in the mutant aphp2.
[0014] The beneficial effects of this invention are: First time revealedAHP2 The gene has brand-new and multi-effect biological functions: through systematic loss-of-function (knockout) and gain-of-function (overexpression) experiments, the present application first confirms that AHP2 The gene is not only a positive regulator of salt tolerance in rice, but also a key gene for maintaining normal plant height, tiller number and grain development. This discovery fills the functional gap of the gene in the field of stress resistance and growth and development, and establishes it as a core regulatory node connecting environmental stress response and internal development program.
[0015] (2) A valuable breeding gene resource with "one effect with multiple effects" is provided, solving the problem of coordinated improvement: in traditional breeding, the improvement of salt tolerance is often accompanied by plant dwarfing, tiller reduction, yield reduction and other adverse linkage effects. The present application has found that operating a single AHP2 gene can achieve coordinated positive regulation or lossless maintenance of salt tolerance and multiple key yield traits. Specifically, overexpression AHP2 can significantly improve salt tolerance (such as seedling survival rate from 53% of wild type to 82%), while maintaining the excellent plant type and grain size of wild type; and knockout Figure 1 results in multiple negative phenotypes of "salt-sensitive + dwarf + few tillers + small grains". This provides an unprecedented efficient target for molecular design breeding, making it possible to breed new rice varieties that are both stress-resistant and high-yielding. BRIEF DESCRIPTION OF DRAWINGS
[0016] ahp2 Wild type WYJ7, mutant AHP2-OE , overexpression material ahp2 Plant phenotype identification: (A) WYJ7, knockout mutant AHP2-OE , overexpression line ahp2 Plant and leaf phenotype. The plant and leaf scales are both 10 cm, and the leaf section scale is 0.2 cm. (B) Figure 2 Sequence detection of knockout line.
[0017] ahp2 WYJ7, AHP2-OE , Figure 3 Conventional agronomic trait statistics. Data are mean ± standard deviation (n = 8), and multiple comparisons were performed according to one-way ANOVA by Tukey test. Different lowercase letters indicate significant differences at the 0.05 level. P <0.05 level.
[0018] ahp2 Wild type WYJ7, mutant AHP2-OE , overexpression material ahp2 Grain trait comparison: (A) WYJ7, AHP2-OE and ahp2The length and width of each grain are measured in 1 cm. (B) WYJ7 AHP2-OE , Figure 4 Epidermal cells of the grain hull. Scale bar is 100 μm.
[0019] ahp2 WYJ7, AHP2-OE , Figure 5 Grain traits and grain hull epidermal cell size were statistically analyzed, including thousand-grain weight (A), grain length (B), grain width (C), grain thickness (D), (E) grain hull epidermal cell length, and (F) grain hull epidermal cell width. Data are presented as mean ± standard deviation (n = 10). Multiple comparisons were performed using a one-way ANOVA based on the Tukey test. Different lowercase letters indicate... P There were significant differences at the < 0.05 level.
[0020] AHP2 for AHP2 Expression pattern analysis: (A) AHP2 Expression levels of wild-type WYJ7 in different tissues. (B) Figure 6 Expression levels of wild-type WYJ7 cells before and at different time points after treatment with 150 mM NaCl. (Students's...) t -test, data is mean ± standard deviation (n = 3),** P < 0.01 indicates a highly significant difference between the two; ns indicates no significant difference.
[0021] ahp2 It is wild-type WYJ7, a mutant. AHP2-OE and ahp2 Seedling salt stress experiment: (A) Wild-type WYJ7, mutant AHP2 , AHP2-OE Overexpression lines ahp2 Salt stress experiment during seedling stage, Bar = 10 cm. (B) WYJ7, AHP2-OE , ahp2 Survival rate statistics. (C)WYJ7, AHP2-OE , SRL10 middle Figure 7 Expression level.
[0022] ahp2 It is the wild type WYJ7. AHP2-OE and Figure 8 Statistics on seedling length and aboveground fresh and dry weight: Data are presented as mean ± standard deviation (n = 3). Multiple comparisons were performed using a one-way ANOVA based on the Tukey test. Different lowercase letters indicate... P There were significant differences at the <0.05 level.
[0023] ahp2 The mutant is the wild-type WYJ7 before and after salt stress. AHP2-OE and Figure 9 Physiological indicators measured: (A) propylene glycol content. (B) hydrogen peroxide content. Data are presented as mean ± standard deviation (n = 3). Multiple comparisons were performed using one-way ANOVA based on the Tukey test. Different lowercase letters indicate the mean ± standard deviation. P There were significant differences at the < 0.05 level.
[0024] ahp2 The mutant is the wild-type WYJ7 before and after salt stress. AHP2-OE and Figure 10 Ion content determination: (A) Sodium ion content in leaves. (B) Potassium ion content in leaves. (C) Sodium-to-potassium ion ratio in leaves. (D) Sodium ion content in roots. (E) Potassium ion content in roots. (F) Sodium-to-potassium ion ratio in roots. Data are mean ± standard deviation (n = 3). Multiple comparisons were performed using one-way ANOVA based on the Tukey test. Different lowercase letters indicate the number of comparisons. P There were significant differences at the < 0.05 level.
[0025] Figure 11 Analysis of gene expression levels in response to salt stress: Analysis of expression levels of salt stress-related genes before and after 24 h of treatment with 170 mM NaCl (AD). Data are presented as mean ± standard deviation (n = 3). Multiple comparisons were performed using one-way ANOVA based on the Tukey test. Different lowercase letters indicate different values. P There were significant differences at the < 0.05 level.
[0026] ahp2 Analysis of gene expression levels related to cytokinin biosynthesis and degradation: wild-type WYJ7 and knockout mutant AHP2 Analysis of gene expression levels related to cytokinin biosynthesis and degradation in seedlings. Students's... t -test, data is mean ± standard deviation (n = 3), * P < 0.05 indicates a significant difference between the two studies; P < 0.01 indicates a highly significant difference between the two; ns indicates no significant difference. Detailed Implementation
[0027] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.
[0028] Example 1 AHP2 Gene function verification 1.1 AHP2 overexpression transgenic rice lines ( AHP2 Construction of -OE: Using cDNA from the rice variety Wuyunjing 7 (WYJ7) as a template, the cDNA was amplified by PCR to obtain AHP2- The full-length coding region is 450 bp (shown in SEQ ID NO.1). The amino acid sequence of the AHP2 protein is shown in SEQ ID NO.2. The primer pairs with enzyme restriction site adapters used for PCR amplification include: forward primer: AHP2 OE-F: TGTTACTTCTGCAGGAGCTCATGGCGGCCGCCGCTCTC (SEQ ID NO.3); Reverse primer AHP2 -OE-R: CTCACCATGGATCCGGTACCTTGCTGCTTGGGATCATAAG (SEQ ID NO.4). Then, homologous recombination was used to ligate it into pCAMBIA1300-ubi-GFP. After transformation of E. coli, positive clones were screened and sequenced to determine the correct vector plasmid pCAMBIA1300-ubi-GFP-AHP2.
[0029] The recombinant plasmid pCAMBIA1300-ubi-GFP-AHP2 was introduced into Agrobacterium tumefaciens strain EHA105, and the engineered strain was obtained after colony PCR verification. The strain was then transformed into callus tissue of Wuyunjing 7 varietal using Agrobacterium-mediated transformation. Subsequently, co-culture, sterilization, selection of resistant callus on hygromycin-containing selection medium, and regeneration of green seedlings on differentiation medium were performed sequentially to obtain transgenic seedlings (T0 generation). Genomic DNA was extracted from the T0 generation plants and verified by PCR and sequencing. AHP2 Gene integration and expression. Positive plants were planted in the field, self-pollinated, and T1 generation seeds were harvested. The T1 generation plants were then subjected to resistance screening and genotyping to obtain homozygous overexpressing plants. AHP2 -OE.
[0030] 1.2 ahp2 Loss-of-function mutants ( AHP2 Construction of ) Regarding the above AHP2 Design specific sgRNAs from the coding region of the gene. AHP2 The primer pairs for the gene target sites are: AHP2 -U3-F: GGCAACCCGTCGTCAACTTCGATA (SEQ ID NO.5) and AHP2-U3-R: AAACTATCGAAGTTGACGACGGGT (SEQ ID NO. 6). The double-stranded oligonucleotide containing the target sequence was chemically synthesized, and cloned into the gRNA expression cassette of the CRISPR-Cas9 knockout vector VK005 (Beijing Weishanglidesi Co., Ltd.) linearized by BspQ I enzyme through Bsa I enzyme digestion and ligation. The ligation product was transformed into E. coli DH5a, and the recombinant knockout plasmid with correct sgRNA sequence was obtained through colony PCR and sequencing verification, and named pVK005-AHP2.
[0031] The above-verified pVK005-AHP2 plasmid was transformed into Agrobacterium tumefaciens EHA105 competent cells. The LB plates containing the corresponding antibiotics were coated, and cultured at 28°C for 2-3 days. Single colonies were picked for colony PCR verification to obtain Agrobacterium engineering strains containing recombinant knockout vectors.
[0032] The callus of Wuyunjili No. 7 was co-cultured with Agrobacterium engineering bacteria liquid containing pVK005-AHP2 vector, and then degermed, selected (containing 50 mg / L hygromycin), and plant regenerated to obtain transgenic seedlings (T0 generation). The DNA of T0 generation plant leaves was extracted, and PCR amplification and sequencing were performed on the target site of the gene to screen plants with editing. After selfing, the homozygous mutant was obtained in the T1 generation population by sequencing identification, and in a specific strain, AHP2 a single base A insertion occurred in the coding region of the gene (B), resulting in a frameshift mutation and premature termination of protein translation. Finally, a functional loss Figure 1 mutant was obtained. AHP2 ahp2 ahp2
[0033] 1.3 Investigation of rice agronomic traits All materials in this example were sown at the same time. The growth status and agronomic traits of WYJ7, AHP2 , AHP2 OE and other related materials were investigated in the field, and the plant height, leaf length, leaf width, and tiller number of each material were measured in the field at the tillering stage. The measurement of each material was averaged from 8 single plants. After harvesting the seeds, the grain traits were investigated by Wansen particle analysis scanner (SC-G1, Hangzhou Wansen Co., Ltd.), and the grain length, grain width, grain thickness, and thousand seed weight of each material were measured, with each material measured repeatedly not less than 10 times.
[0034] Through phenotype observation of the T1 generation of the selfed progeny of the gene knockout mutant, it was found that the knockout and overexpression AHP2 plant leaf morphology did not change, but the knockout Figure 2 gene resulted in a significant decrease in plant height and tiller number.AHP2 Through observation of grain phenotype, it was found that knocking out... ahp2 This not only led to a decrease in rice plant height and a significant reduction in tiller number, but also resulted in a significant change in grain size. For the wild-type WYJ7, the mutant... AHP2-OE and Figure 3 Statistical analysis of grain size results showed that ( ahp2 Compared to the wild-type WYJ7, the mutant AHP2-OE The thousand-grain weight decreased significantly from 28.79 g to 22.88 g, a decrease of 20.53%; the grain length decreased significantly from 7.43 mm to 6.60 mm, a decrease of 11.17%; the grain width decreased significantly from 3.27 mm to 2.92 mm, a decrease of 10.70%; and the grain thickness decreased significantly from 2.44 mm to 2.26 mm, a decrease of 7.38%. AHP2 Grain characteristics showed no significant difference from the wild type. To investigate... ahp2 To investigate the cellular mechanisms affecting rice grain size, we used scanning electron microscopy to study WYJ7... AHP2-OE , ahp2 Observation of the epidermal cells of the grain husk showed that, compared to the wild type WYJ7, Figure 4 The length and width of the outer epidermal cells of the grain hull decreased by 22.74% and 18.29%, respectively. AHP2 (E and F in the text). The above data indicates that reducing... AHP2 Gene expression significantly affects rice grain cell expansion, leading to smaller grains.
[0035] 1.4 AHP2 Expression pattern analysis Detected by RT-qPCR AHP2 The expression of this substance in rice tissues was observed, and the results showed that... Figure 5 It is constitutively expressed in rice, with the highest expression levels in young panicles and leaf sheaths. AHP2 By treating wild-type WYJ7 seedlings approximately two weeks old with 150 mM NaCl, leaf RNA was extracted and reverse transcribed into cDNA at different time points before and after treatment. RT-qPCR experiments revealed… Figure 5 Expression was induced by salt stress, reaching its maximum value 12 hours after salt stress, and then gradually decreased. AHP2 ).
[0036] 1.5 ahp2 Positive regulation of salt tolerance in rice seedlings For wild-type WYJ7, mutant AHP2-OE and overexpression materials ahp2Physiological experiments on salt stress during the seedling stage were conducted. Results showed that after treatment with 170 mM NaCl for 5 days, the survival rate of wild-type WYJ7 seedlings was 53%; the mutant... AHP2 The survival rate was 23.25%, significantly lower than that of the wild type; Figure 6 The survival rate of overexpression seedlings was 82%, significantly higher than that of wild-type seedlings. ahp2 (B) Under nutrient solution growth conditions, wild-type WYJ7, mutant AHP2-OE and ahp2 There were no significant differences in root length, seedling length, and fresh and dry weight of the aboveground and underground parts among the three types; after treatment with 170 mM NaCl for 5 days, the wild-type WYJ7 had a fresh weight of 95 mg aboveground parts and a dry weight of 26 mg, and a fresh weight of 78 mg underground parts and a dry weight of 9 mg; the mutant AHP2-OE The above-ground parts had a fresh weight of 73 mg and a dry weight of 22 mg, while the underground parts had a fresh weight of 65 mg and a dry weight of 8 mg, both significantly lower than the wild type WYJ7. Figure 7 The above-ground fresh weight was 119 mg, and the underground fresh weight was 84 mg, both significantly higher than that of wild-type WYJ7. ahp2 ), wild-type WYJ7, mutant AHP2-OE and AHP2 They were conducted separately AHP2 Expression level detection. Results showed that, compared to the wild type, Figure 6 Expression levels were significantly reduced in knockout lines, while expression levels were significantly increased in overexpression lines, approximately 10 times higher than in wild-type. AHP2 (C in the text). The above experiments preliminarily show that, AHP2 Deletion leads to reduced tolerance to salt stress in rice, while overexpression... ahp2 Improve the salt tolerance of rice.
[0037] At the same time, we determined the wild-type WYJ7 and the mutant AHP2-OE Overexpression materials ahp2 The pyridine and hydrogen peroxide contents of seedlings before and after treatment were compared. Results showed that under normal nutrient solution culture conditions, the wild-type WYJ7 and the mutant... AHP2-OE and ahp2 There were no significant differences in propylene glycol and hydrogen peroxide content in seedlings, but after treatment with 170 mM NaCl for 2 days, the mutants showed... AHP2-OE The levels of propylene glycol and hydrogen peroxide in the body were significantly higher than in the wild type, while Figure 8 The levels of propylene glycol and hydrogen peroxide in seedlings were significantly lower than those in wild-type seedlings. AHP2 ).
[0038] 1.5 ahp2 Influences on ion transport regulation of rice salt tolerance Rice plants accumulate large amounts of sodium when subjected to salt stress. +And reduce the accumulation of K + An imbalance in intracellular ion homeostasis leads to disordered enzymatic reactions, failing to meet the demands for organic matter synthesis, resulting in abnormal plant growth and development, and even death. Using 170 mM NaCl on approximately three-week-old wild-type WYJ7 mutants... AHP2-OE and overexpression strains ahp2 After 5 days of treatment, leaf and root samples were taken to determine sodium and potassium ion content. The results showed that under normal growth conditions, the wild-type WYJ7 and the mutant... AHP2-OE and overexpression strains AHP2-OE Na in leaves + K + Content and Na + / K + No significant differences were found in any of the mutants after salt stress treatment. srl10 Na in leaves + The content was significantly higher than that of the wild type. AHP2-OE Na in leaves + The content was significantly lower than that of the wild type; K + The content was not significantly different from that of the wild type; leading to mutants srl10 Na in leaves + / K + Significantly higher than the wild type, and Figure 9 Na in leaves + / K + Significantly lower than wild type ( ahp2 (A to C in the original text). Under normal growth conditions, wild-type WYJ7, AHP2-OE and ahp2 Na in the root + K + Content and Na + / K + All were not significantly different from the wild type; after salt stress treatment, the wild type WYJ7, mutant AHP2-OE and overexpression strains Figure 9 Na root + The content increased significantly, K + Significant decrease, but no significant difference among the three ( AHP2 (D to F in the text). The results show that under salt stress... AHP2 It can reduce Na + Accumulation in the leaves, thereby reducing Na + / K + Relieve Na + The poisoning gives rice its salt tolerance.
[0039] 1.6 AHP2 affects the expression levels of genes responding to salt stress For further analysis ahp2The mechanism of regulating salt tolerance in rice was investigated by treating wild-type WYJ7 and mutant rice with 170 mM NaCl. AHP2-OE and overexpression strains AHP2 RNA was extracted from leaves of approximately 3-week-old seedlings before and 24 hours after treatment and reverse transcribed into cDNA. Na+ was then detected using RT-qPCR. + / H + OsNHX family of retrotransporter genes, Na + / K + Expression levels of OsHKT family genes and other salt stress-responsive genes were measured. The results showed that... Figure 10 Changes in expression levels can lead to alterations in the expression levels of many salt stress-related genes. OsSOS1 ); such as Na + / H + Antitransporter OsNHX1 Salt stress-induced expression can reduce intracellular Na+ in yeast cells. + Content. Vacuole membrane Na + / H + reverse transporter gene OsNHX1 High concentrations of Na in the cytoplasm + and K + Isolation plays an important role in vacuoles, overexpression OsP5CS2 It can improve the salt tolerance of rice. Proline biosynthesis enzyme AHP2-OE By influencing proline biosynthesis, salt tolerance in rice is positively regulated. These results indicate that under salt stress... OsSOS1 Able to maintain OsHKT1;1 , OsNHX1 , OsP5CS2 , AHP2 The expression of genes such as [specific gene name] alleviates ion toxicity and maintains osmotic pressure, thereby improving the salt tolerance of rice.
[0040] 1.7 AHP2 Affecting the biosynthesis and degradation of cytokinins because AHP2 It participates in rice cytokinin signaling and is a key positive regulator. To gain a deeper understanding... ahp2 We extracted pathways for regulating salt tolerance in rice from wild-type WYJ7 and knockout mutants, respectively. ahp2 RNA was extracted from seedling leaves and reverse transcribed into cDNA. The expression levels of genes related to cytokinin biosynthesis and degradation were detected by RT-qPCR. The results showed that, compared to wild-type WYJ7, LOG The expression levels of some genes related to cytokinin synthesis were significantly upregulated in seedlings, such as cytokinin activating enzyme. LOGL8 , LOG6 Cytokinin synthaseCKX5 ; the expression level of part cytokinin degradation related genes is significantly down-regulated, such as cytokinin oxidase / dehydrogenase CKX8 , CKX9 , CKX10 , Figure 11 ( AHP2 ). The above experimental results show that, can directly or indirectly regulate the biosynthesis and degradation of cytokinin in rice, thereby maintaining a certain level of cytokinin in the body, and then affecting the salt tolerance of rice.
Claims
1. AHP2 The application of genes in regulating rice agronomic traits is characterized in that, The agronomic traits include salt tolerance, plant height, tiller number, grain traits; the grain traits include grain length, grain width, grain thickness and 1000-grain weight; the application is to improve salt tolerance of rice by only over-expressing AHP2 a gene in rice; to reduce plant height, tiller number, grain length, grain width, grain thickness and 1000-grain weight of rice by only knocking out AHP2 a gene in rice; The expression was only overexpressed in rice. AHP2 Genes that enhance the salt tolerance of rice include the following steps: PCR amplification using primer pairs with enzyme restriction site adapters, to obtain... AHP2 The coding region sequence of the gene; the construction of an expression vector for rice transformation; the transformation of the constructed expression vector into Agrobacterium tumefaciens, the transformation of rice, and the acquisition of transgenic plants; The primers with the restriction site linker are as follows: Forward primer: TGTTACTTCTGCAGGAGCTCATGGCGGCCGCCGCTCTC; Reverse primer: CTCACCATGGATCCGGTACCTTGCTGCTTGGGATCATAAG; The method for reducing plant height of rice by knocking out only the AHP2 gene in rice, reducing the number of tillers of rice, and reducing the grain length, grain width, grain thickness and 1000-grain weight of rice, comprises the following steps: constructing a knockout vector of the AHP2 gene by using a CRISPR / Cas9 system, transforming the knockout vector into a rice recipient material to obtain a transgenic plant. in the CRISPR / Cas9 system, AHP2 the primer pairs for the target sites of the genes are as follows: AHP2 - U3-F: GGCAACCCGTCGTCAACTTCGATA; AHP2 - U3-R: AAACTATCGAAGTTGACGACGGGT; The AHP2 The CDS sequence of the gene is shown as SEQ ID NO.
1.
2. Use according to claim 1, characterized in that, The AHP2 The CDS sequence of the gene encodes a protein with an amino acid sequence as set forth in SEQ ID NO.
2.
3. A method of obtaining a salt tolerant rice plant, characterized in that, The method involves overexpression only in rice. AHP2 Genes were used to obtain rice with improved salt tolerance. AHP2 The CDS sequence of the gene is shown in SEQ ID NO.
1.
4. The method of claim 3, wherein, The overexpression in rice only AHP2 The gene is made to overexpress by using transgenic technology AHP2 The expression amount of the gene is increased.
5. A method for obtaining a rice plant having reduced plant height or reduced tiller number or reduced grain length, grain width, grain thickness, and 1000-grain weight, characterized by, The method comprises only knocking out AHP2 a gene in rice to obtain rice with reduced plant height or reduced tiller number or reduced grain length, grain width, grain thickness and 1000-grain weight of the rice. AHP2 The CDS sequence of the gene is shown as SEQ ID NO.
1.
6. The method of claim 5, wherein, The knockout of the gene in rice only AHP2 The expression amount of the gene is decreased by using a gene knockout technology. AHP2 The expression amount of the gene is decreased by using a gene knockout technology.
Citation Information
Patent Citations
Cytokinin response regulators and uses thereof
US20060185030A1
Putative Cytokinin Receptor and Methods for Use Thereof
US20110023187A1