Gene GhCesA4D07 for regulating and controlling cotton fiber elongation and application of gene GhCesA4D07

Abstract

The invention discloses a gene GhCesA4D07 for regulating and controlling cotton fiber elongation and application thereof, the full-length sequence of the gene GhCesA4D07 is 3102bp, the gene GhCesA4D07 encodes a protein sequence with 1033 amino acids, and phenotypic investigation on virus-induced gene silencing and gene editing cotton shows that the fiber length and the fracture ratio strength are obviously shorter than those of a wild type. Therefore, the gene GhCesA4D07 plays an important role in regulating and controlling the elongation and growth of cotton fiber cells and the formation of related quality characters, and has a potential application value of improving the quality of cotton fibers.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of cotton genetic engineering, and particularly relates to a gene for regulating cotton fiber elongation and breaking specific strength and application of the gene in cotton fiber cell elongation GhCesA4_D07 The gene can positively regulate the elongation growth of Gossypium hirsutum fiber, and is a gene of important value in cotton fiber quality improvement. The gene can be used in molecular breeding research of cotton fiber quality improvement through hybridization, transgenic and other technical methods. BACKGROUND

[0002] CesA4 (cellulose synthase A4) is widely distributed in plants. The cellulose microfibrils of cotton fiber cell secondary wall (SCW) deposition are synthesized on the plasma membrane by a cellulose synthase multimeric complex (CSC) formed by multiple cellulose synthase catalytic subunits (CESA), which contains at least three types of CesA proteins required for glucan chain cooperative extension. There are 228 cellulose synthase proteins CesA and cellulose synthase-like proteins (Csl) in Gossypium hirsutum, Gossypium barbadense, Gossypium arboreum and Gossypium raimondii, CesA4 The expression level of the gene in tetraploid cotton fiber is higher than that in diploid cotton, while Csl is the opposite [1] . CESA1 / CESA3 / CESA6 or similar CESA6 Cellulose synthase complex (CSC) is involved in the synthesis of primary cell wall, while CSC assembled by CESA4 / CESA7 / CESA8 is involved in the synthesis of secondary cell wall [2] . Cellulose is synthesized by CSC, which is assembled in the Golgi apparatus and then transported to the plasma membrane, after which active synthesis of cellulose [3] In Gossypium hirsutum, GhCesA4 , GhCesA7 and GhCesA8 are assembled into 36-mer-like cellulose synthase supercomplex (CSS) in fiber cells, and this CSS synthesizes cellulose of 72-chain microfibrils, forming a unique mechanism [4]. In the process of fiber SCW formation, the initiation and process of SCW cellulose synthesis need to be strictly controlled to balance fiber elongation and cell wall deposition, and many transcription factors are involved in the regulation of the expression or function of CesA . In Arabidopsis, GhCSLD3 The gene can mediate the downstream genes of ethylene response pathway to regulate root growth and cell elongation, and also can restore cell elongation and cell wall integrity by enhancing the primary wall cellulose content of Arabidopsis CesA6 mutant [5,6] . GhSTLs The GhCesAs interaction related to cell wall formation can affect cellulose synthesis and cotton fiber development [7] . GhMYB7 (R2R3-MYB) can directly bind to three different cis-acting elements on the promoters of GhCesA4 , GhCesA7 and GhCesA8 to regulate the deposition of SCW cellulose in cotton fibers [8] . GhTCP4 can interact with GhHOX3 to balance cotton fiber cell elongation and SCW thickening [9] . In the SCW biosynthesis stage, NAC transcription factors specifically expressed in fiber cells GhFSN1 can activate their downstream SCW-related GhDUF231L1 , GhKNL1 , GhMYBL1 , GhGUT1 and GhIRX12 to regulate SCW biosynthesis and fiber development

[10] . Therefore, the study of CesA4 genes has important value in the application of cotton quality improvement.

[0003] Reference: [1] Zou X, Zhen Z, Ge Q, et al. Genome-wide identification and analysis of the evolution and expression patterns of the cellulose synthase gene superfamily in Gossypium species[J]. Gene, 2018, 646: 28-38. [2] Du J, Vandavasi V G, Molloy K R, et al. Evidence for plant-conserved region mediated trimeric CESAs in plant cellulose synthase complexes[J]. Biomacromolecules, 2022, 23(9): 3663-3677. [3] Polko J K, Kieber J J. The regulation of cellulose biosynthesis in plants[J]. The Plant Cell, 2019, 31(2): 282-296. [4] Wen X, Zhai Y, Zhang L, et al. Molecular studies of cellulose synthase supercomplex from cotton fiber reveal its unique biochemical properties[J]. Science China Life Sciences, 2022, 65(9): 1776-1793. [5] Hu H, Zhang R, Dong S, et al. AtCSLD3 and GhCSLD3 mediate root growth and cell elongation downstream of the ethylene response pathway in Arabidopsis[J]. Journal of experimental botany, 2018, 69(5): 1065-1080. [6] Hu H, Zhang R, Tang Y, et al. Cotton CSLD3 restores cell elongation and cell wall integrity mainly by enhancing primary cellulose production in the Arabidopsis cesa6 mutant[J]. Plant molecular biology, 2019, 101(4-5): 389-401. [7] Guo Y, Chen F, Luo J, et al. The DUF288 domain containing proteins GhSTLs participate in cotton fiber cellulose synthesis and impact on fiber elongation[J]. Plant science, 2022, 316: 111168. [8] Huang J, Chen F, Guo Y, et al. GhMYB7 promotes secondary wall cellulose deposition in cotton fibres by regulating GhCesA gene expression through three distinct cis-elements[J]. New Phytologist, 2021, 232(4): 1718-1737. [9] Cao J F, Zhao B, Huang C C, et al. The miR319-Targeted GhTCP4 Promotes the Transition from Cell Elongation to Wall Thickening in Cotton Fiber[J]. Molecular plant, 2020, 13(7): 1063-1077.

[10] Zhang J, Huang G Q, Zou D, et al. The cotton (Gossypium hirsutum) NAC transcription factor (FSN1) as a positive regulator participates in controlling secondary cell wall biosynthesis and modification of fibers[J]. New Phytologist, 2018, 217(2): 625-640. SUMMARY

[0004] The purpose of the present application is to provide a gene that can regulate the elongation development of cotton fibers GhCesA4_D07Preliminary evidence was obtained through virus-induced gene silencing (VIGS) induced by cotton leaf crumple virus (CLCrV) and the CRISPR / Cas9 gene editing technology (Clustered regularly interspaced short palindromic repeats) to demonstrate the gene... GhCesA4_D07 It positively regulates the fiber elongation of cotton.

[0005] The technical solution of the present invention is as follows: Regulating plant development GhCesA4_D07 The gene, whose nucleotide sequence is shown in SEQ ID No. 1.

[0006] Furthermore, the aforementioned GhCesA4_D07 The protein sequence encoded by the gene is shown in SEQ ID No. 2.

[0007] Furthermore, the present invention also provides the aforementioned GhCesA4_D07 The gene was expressed using a virus-induced gene silencing vector CLCrV, a gene editing vector CRISPR / Cas9, and a transgenic cell line; the vector was a plant expression vector, and preferably, the gene fragment was ligated into the vector CLCrV or CRISPR / Cas9 to obtain the recombinant plasmid CLCrV-. GhCesA4_D07 and CRISPR / Cas9- GhCesA4_D07 .

[0008] Furthermore, the present invention also provides the aforementioned GhCesA4_D07 Application of genes or recombinant expression vectors in regulating plant development.

[0009] Furthermore, the application is in the regulation of plant fiber cell development, preferably in the regulation of plant fiber cell elongation.

[0010] Furthermore, the application is to GhCesA4_D07 Genes were introduced into target plants and overexpressed to obtain transgenic plants with elongated fibroblasts.

[0011] Furthermore, the plant is one of dicotyledonous plants, monocotyledonous plants, grasses, or cruciferous plants; preferably, the plant is cotton; more preferably, the plant is one of Asian cotton, Raymond cotton, upland cotton, or sea island cotton.

[0012] The beneficial effects of this invention are: 1. It provides a new cotton gene. GhCesA4_D07 1. The full-length gene sequence and the protein sequence it encodes; 2. Using cotton genetic transformation combined with gene editing technology to silence genes in cotton.GhCesA4_ D07 Expression of ， It was found that the fiber length of the plants was significantly shortened. GhCesA4_D07 The application has potential application value in improving cotton fiber quality by regulating the elongation of cotton fiber cells. The application can be used for molecular breeding research of cotton fiber quality improvement by hybridization, transgenic and other methods, and provides a new idea for the mechanism of cotton fiber development, and has important significance in cultivating excellent cotton fiber varieties or research. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 Gene GhCesA4_D07 Structure.

[0014] Figure 2 Gene GhCesA4_D07 Protein domain analysis.

[0015] Figure 3 Silenced gene GhCesA4_D07 Cotton fiber length phenotype identification in plants, a. qRT-PCR of silenced plants; b. mature cotton fibers of silenced plants and blank controls; c. fiber length of silenced plants. * indicates p value < 0.05; ** indicates p value < 0.01; *** indicates p value < 0.001, p is the significant level.

[0016] Figure 4 : GhCesA4_D07 Results of experiments on participating in regulating cotton fiber elongation, a. gene editing vector sequencing primer detection; b. gene editing plant kana full-length detection; c. gene editing target mutation detection; d. cotton fiber phenotype of knockout plants; e. fiber length and fiber strength performance of knockout lines. DETAILED DESCRIPTION

[0017] The application will be described in detail below by means of the accompanying drawings and examples, but does not limit the protection scope of the application.

[0018] Cotton gene GhCesA4_D07 Genomic DNA sequence and cDNA isolation and cloning RNA extraction and reverse transcription from cotton fiber tissue 10 days after flowering. Several mortars were prepared, cleaned, dried, and sterilized by igniting with 95% alcohol. After cooling, liquid nitrogen was added for pre-cooling. Plant tissue (the tissue was cotton fiber tissue from the upland cotton variety Xinluzao 24, 10 days after flowering, pre-stored in the freezer) was taken from a −80 ℃ ultra-low temperature freezer, placed in a mortar, and rapidly ground with liquid nitrogen until thoroughly ground into powder. The powder was then transferred to pre-cooled 2 mL centrifuge tubes using a liquid nitrogen-pre-cooled spatula for immediate RNA extraction or storage in an ultra-low temperature freezer. RNA extraction was performed using the RNAprep Pure Polysaccharide-Polyphenol Plant Total RNA Extraction Kit (catalog number: DP441) from Tiangen Biotech (Beijing) Co., Ltd. The procedure is described in the kit's instruction manual. Reverse transcription was performed using the AT341 Reverse Transcription Kit from Beijing TransGen Biotech Co., Ltd. The procedure is described in the kit's instruction manual. Gene-specific primers (…) were used. GhCesA4_D07 -F:5'- ATGGCTGGCTTTGGTTCA -3' and GhCesA4_D07 -R:5'- TCAGCACTCCACTCCACA -3') and high-fidelity DNA polymerase PFU were used in the PCR reaction program as follows: 98 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 20 s, 55 ℃ annealing for 20 s, 72 ℃ extension for 120 s, 35 cycles; 72 ℃ extension for 5 min, storage at 10 ℃, and a DNA fragment of approximately 3.1 kb was amplified. GhCesA4_D07 The fragment was inserted into the T vector. The target DNA fragment was sequenced using the universal primers M13F and M13R on the plasmid, yielding the sequence shown in SEQ ID No. 1. The results showed: GhCesA4_D07 The full-length gene sequence is 3102 bp. This gene has 12 exons and 11 introns. ATG is the start codon, and TCA is the stop codon. The gene structure is as follows: Figure 1 As shown. Cotton genes GhCesA4_D07 The encoded protein sequence is shown in SEQ ID No. 2, and the protein domains of this gene are as follows: Figure 2 As shown.

[0019] Virus-induced genes GhCesA4_D07 cotton phenotypic identification ① Construct CLCrV- GhCesA4_D07 After the expression vector was verified to be correct by sequencing, it was transformed into Agrobacterium LBA4404 competent cells and activated by overnight shaking at 28 ℃. At the same time, the helper bacteria Clcrv-VB, blank control Clcrv-VA, and positive control Clcrv-PDS were activated.

[0020] (2) Take the activated bacteria liquid to the liquid YEB medium containing kanamycin and rifampicin, and cultivate at 28°C on a shaking table. When the OD600 of the bacteria is about 1, centrifuge at 5000 rpm / min for 10 minutes. Discard the supernatant.

[0021] (3) Resuspend the Agrobacterium liquid with the prepared infection buffer (add 1M MgCl2: 1ml, 1M MES: 1ml, 100mM As: 200ul per 100ml), and then place it at room temperature in the dark for about 3 hours. Mix Clcrv-VB with Clcrv-VA, Clcrv-PDS, and CLCrV- GhCesA4_D07 at a ratio of 1:1, and obtain three different mixed bacterial liquids for injection experiments.

[0022] (4) Select cotton seedlings with two leaves and one heart in good growth condition, and inject the two cotyledon leaves. Gently draw a small line on the back of the cotyledon with a needle, and then fill the entire leaf with the bacterial liquid using a needleless syringe. Culture the plants in the dark for 24 hours (25°C), and then move them to the greenhouse (25°C; light cycle 16 / 8h) for culture. After 10-21 days of culture, the positive control (cotton plants injected with Clcrv-PDS) will exhibit white symptoms, indicating that the injection operation is successful. Discard the plants, and then observe the phenotype and determine the silencing efficiency of the gene by quantifying the fluorescence of the leaves of the blank control and gene-silenced plants.

[0023] (5) The qRT-PCR results show that the relative expression level of GhCesA4_D07 in the VIGS plants is significantly reduced compared with the blank control Figure 3 a). When the cotton bolls naturally mature, harvest the naturally shed cotton bolls of the blank control and the silenced plants, and count the FL phenotype Figure 3 b-c). The average fiber length of the silenced plants reaches 27.06 mm and 28.18 mm, which is significantly lower than that of the blank control (30.79 mm), indicating that the silenced gene GhCesA4_D07 after inhibits the elongation of cotton fibers.

[0024] Gene GhCesA4_D07 Creation of transgenic cotton and phenotype analysis Gene GhCesA4_D07The open reading frame (ORF) was predicted on the gene editing website (http: / / crispr.hzau.edu.cn / ), two editing sites (Site1: CGAGATACGTAAACAAGCCG, Site2: CGACACACTATCGGAAACTG) were selected for gene editing, the candidate target sequence sgRNA+NGG was constructed into the CRISPR / Cas9 (p7n-Cas9) binary expression vector, after sequencing verification that the sequence was correct, the agrobacterium GV3101 was transformed, the positive clones (the size was consistent with the target gene) detected by PCR were shaken and expanded, and then glycerol was preserved, and stored in the ultra-low temperature refrigerator at -80 ℃. Then the cotton hypocotyls were immersed by agrobacterium-mediated, the transformed explants were screened and cultured, and the resistant callus was selected. Then the embryogenic callus was induced by differentiation culture medium, and the somatic embryo was induced by differentiation into embryogenic callus, and the seedlings were regenerated, transplanted into the field to grow and develop into mature, flowering and fruiting. After the cotton matured, the upper half of the mature cotton bolls was collected for fiber quality detection (Cotton Fiber Quality Inspection and Supervision and Detection Center (Institute of Cotton Research, Chinese Academy of Agricultural Sciences)).

[0025] The DNA of the T1 generation of the knockout plant was detected by PCR, and primer detection and kana full-length detection were performed, and 6 positive plants were detected. Figure 4 a-b);Then the gene GhCesA4_D07 was cloned and connected to the T vector for sequencing, and it was found that the target position of the 6 transgenic lines appeared mutations, and there were 3 types of mutations (+1 / -13; -12 / -2; -1 / -1) Figure 4 c);Then the 3 types of mutant lines were added to the T1 generation in Bai Bi Town, Anyang, Henan in 2022, and were named GhCesA4_D07 -1, GhCesA4_D07 -2, GhCesA4_D07 -3, and the mature fiber detection results (Table 1) showed that compared with the control, the fiber length of the T1 generation knockout lines was 27.90 mm, 26.60 mm and 25.00 mm, which were lower than the control 28.21 mm; the fiber strength was 29.60 cN / tex, 29.70 cN / tex and 27.20 cN / tex, which were lower than the control 30.40 cN / tex.

[0026] Table 1 GhCesA4_D07 Cotton fiber quality traits of knockout lines (T1)

[0027] In October 2022, three mutant plants of the T1 generation were planted in Hainan, planted in mature rows. All three T2 generation lines were harvested as individual plants. Fiber analysis results were obtained. Figure 4 (See Appendix Table 2) The results show that, compared with the control, the average fiber length of the three knockout lines (T2) was 26.88 mm, 26.75 mm, and 26.13 mm, all significantly lower than the control (31.93 mm); the average fiber strength was 26.88 cN / tex, 28.09 cN / tex, and 29.50 cN / tex, all significantly lower than the control (32.88 cN / tex); and the average micronaire values ​​were 4.80, 4.19, and 4.07, all significantly higher than the control (3.63). The lint percentages of the yield traits were 55.71%, 50.46%, and 49.48%, all significantly higher than the control (39.24%).

[0028] Table 2 GhCesA4_D07 cotton fiber quality traits and lint percentage of the knockout strain (T2)

[0029]

[0030] Phenotypic analysis showed that transgenic cotton plant height, plant type, leaf size and morphology, seed setting rate, boll size, and seed size were not significantly different from the wild type, but its fiber length and fiber strength were significantly shorter than those of the wild type. Figure 4 These results all indicate that... GhCesA4_D07 It plays an important regulatory role in the elongation growth of cotton fiber cells and the formation of related quality traits.

[0031] In summary, the name provided by this invention is GhCesA4_D07 The gene, with a full-length sequence of 3102 bp, encodes a protein sequence of 1033 amino acids and belongs to the cellulase family. We analyzed the gene. GhCesA4_D07 The protein structure contains the cellulose synthase domain PLN02915. Phenotypic investigation of virus-induced gene silencing and gene-edited cotton revealed that fiber length and breaking strength were significantly shorter than the wild type. This indicates that the gene... GhCesA4_D07 It plays an important regulatory role in the elongation and growth of cotton fiber cells and the formation of related quality traits, and has potential application value in improving cotton fiber quality.

Claims

1. Regulating plant development GhCesA4_D07 The gene, whose nucleotide sequence is shown in SEQ ID No.

1.

2. As described in claim 1 GhCesA4_D07 The protein sequence encoded by the gene is shown in SEQ ID No.

2.

3. Containing the contents of claim 1 GhCesA4_D07 Virus-induced gene silencing vector CLCrV, gene editing vector CRISPR / Cas9, and transgenic cell lines.

4. The vector of claim 3 is a plant expression vector. The gene fragment is ligated into the vector CLCrV / CRISPR / Cas9 to obtain the recombinant plasmid CLCrV- GhCesA4_D07 and CRISPR / Cas9- GhCesA4_D07 .

5. The claim 1 or claim 4 GhCesA4_D07 Application of genes or recombinant expression vectors in regulating plant development.

6. The application described in claim 5 is its application in regulating plant fiber cell elongation.

7. The application described in claim 6 is to... GhCesA4_D07 Genes were introduced into target plants and overexpressed to obtain transgenic plants with elongated fibroblasts.

8. The plant described in claim 7 is one of the following: a dicotyledonous plant, a monocotyledonous plant, a grass family plant, or a cruciferous plant.

9. The plant described in claim 8 is cotton.

10. The cotton of claim 9 is any one of Asian cotton, Raymond cotton, upland cotton, or Sea Island cotton.

Images