Verticillium dahliae virulence gene, verticillium dahliae virulence protein and application

Abstract

The invention discloses a verticillium dahliae virulence gene, a verticillium dahliae virulence protein and application. The invention relates to the technical field of biology, and provides a method for preventing and treating cotton verticillium wilt based on RNAi (RNA interference) as well as related components and application thereof. Specifically, the invention discloses application of preventing and treating verticillium wilt by a method for inhibiting or silencing the expression of verticillium dahliae pathogenic gene VdHAT1 (the encoding protein of the verticillium dahliae pathogenic gene VdHAT1 is as shown in SEQ ID NO: 3), the core of the verticillium dahliae pathogenic gene VdHAT1 is to provide dsRNA molecules capable of targeting the gene, and the positive-sense strand of the dsRNA molecules is preferably selected from SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 7. Based on the molecule, the invention further provides a recombinant vector containing the coding sequence, a recombinant microorganism, a transgenic disease-resistant plant and an RNAi pesticide preparation. The scheme can be realized through host-induced gene silencing, microorganism-mediated gene silencing or preparation treatment and the like, the virulence of pathogenic bacteria can be effectively reduced, and a new technical approach is provided for green prevention and control of verticillium wilt.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of Verticillium dahliae pathogenic gene in the prevention and treatment of Verticillium wilt, especially to the method for inhibiting or silencing the expression of the pathogenic gene by RNAi (RAN interference) technology to achieve green prevention and control of Verticillium wilt. BACKGROUND

[0002] Verticillium dahliae belongs to the subphylum Deuteromycotina and the genus Verticillium, and can grow at a temperature range of 10-30℃, with an optimum temperature of 20-25℃. It has a wide host range, with reports of 660 plant species from 40 families, including 184 crop species. The host plants include cotton, sunflower, eggplant, pepper, tomato, tobacco, potato, melon, watermelon, cucumber, peanut, bean, mung bean, soybean, sesame, and sugar beet. Verticillium dahliae

[0003] Cotton Verticillium wilt is a soil-borne fungal disease caused by Verticillium dahliae, which is known as "cotton cancer". This disease has a wide distribution, severe damage, long survival time of the pathogen, and is difficult to control with chemical pesticides, making it one of the most devastating diseases in cotton growth, seriously threatening cotton production and development.

[0004] However, how to utilize the correlation between Verticillium dahliae pathogenic gene and cotton Verticillium wilt to screen for gene target fragments and develop new prevention and treatment methods remains a problem to be solved. In addition, how to improve the disease resistance of plants to Verticillium dahliae and enhance the defense ability of plant bodies is also a current research focus. Exploring the application of Verticillium dahliae pathogenic gene in the prevention and treatment of Verticillium wilt provides new ideas and methods for cotton production. SUMMARY

[0005] To solve the problems of poor prevention and treatment effect of cotton Verticillium wilt, environmental pollution and drug resistance caused by chemical methods, lack of biological control measures, and imperfect function research and targeted inhibition technology of Verticillium dahliae pathogenic gene in the prior art, the present application provides a method for inhibiting or silencing the expression of Verticillium dahliae pathogenic gene based on RNAi (RNA interference), which is applied to the prevention and treatment of Verticillium wilt to achieve the goal of reducing the virulence of the pathogen, reducing disease occurrence and disease index, and providing an environmentally friendly biological control strategy. VdHAT1

[0006] In one aspect of the present application, a Verticillium dahliae pathogenic protein is provided. Based on the homology analysis of its amino acid sequence, the protein is named VdHAT1 (Histone acetyl transferase HAT1, Genesymbol: VDAG_06353), which is derived from Verticillium dahliae. Verticillium dahliae ​​The amino acid sequence of this protein has been associated with Verticillium dahliae strain VdLs.17 (). Verticillium dahliae The genome sequence of *VdLs.17* has been publicly published and has been reported in research literature using comparative genomics to analyze pathogenicity-related genes in *Verticillium* (Klosterman SJ, Subbarao KV, Kang S, et al. Comparative Genomics Yields Insights into Niche Adaptation of Plant Vascular Wilt Pathogens[J]. PlosPathogens, 2011, 7(7):e1002137.). Although this literature focuses on the pathogenicity of *Verticillium*, it does not mention the gene encoding this protein, nor does it discuss its association with the pathogenicity of the pathogen, nor does it develop it as a molecular target for the control of cotton Verticillium wilt. This invention, through experimental verification, confirms that the... VdHAT1 The gene plays a key role in the pathogenesis of cotton Verticillium wilt, and the protein is shown in either 1) or 2) below:

[0007] 1) Proteins with amino acid sequences as shown in SEQ ID NO:3

[0008] 2) Variant proteins that have ≥85% sequence identity with the amino acid sequence of 1) and retain pathogenic function.

[0009] In another aspect, the present invention provides a *Verticillium dahliae* pathogenic gene encoding the aforementioned pathogenic protein. VdHAT1 (Gene), which encodes the aforementioned pathogenic protein and plays a role in causing Verticillium wilt in cotton, and is any one of the genes or nucleic acid molecules described in 1) to 5) below:

[0010] 1) The nucleotide sequence is as shown in SEQ ID NO:1 or SEQ ID NO:2;

[0011] 2) A polynucleotide encoding the amino acid sequence shown in SEQ ID NO:3;

[0012] 3) Variants of the polynucleotide described in 2) that have ≥85% sequence identity and retain pathogenic function;

[0013] 4) Polynucleotides that hybridize with complementary sequences of (2) or (3) under strict hybridization conditions;

[0014] 5) RNA molecules transcribed from (2), (3) or (4).

[0015] The "stringent conditions" are conditions sufficient to allow hybridization of nucleotide sequences to the gene sequences described above, and are well known to those skilled in the art, for example: hybridization in 0.1 x SSPE or 0.1 x SSC containing 0.1% SDS at 65°C, and washing the membrane with the solution.

[0016] The core aspect of the present application provides a new solution for preventing and controlling the Verticillium wilt: a method for inhibiting or silencing the pathogenic gene of the Verticillium dahliae by RNAi (RNA interference) VdHAT1 The method for expressing is applied in the prevention and control of the Verticillium wilt, the pathogenic gene is a polynucleotide encoding the amino acid sequence shown in SEQ ID NO: 3, the RNAi is mediated by a dsRNA (double-stranded RNA) molecule targeting the gene, and can reduce the virulence of the Verticillium dahliae.

[0017] Preferably, the inhibition or silencing is achieved by host-induced gene silencing, microbe-mediated gene silencing or RNAi pesticide preparation treatment.

[0018] Another aspect of the present application provides a dsRNA molecule for preventing and controlling the Verticillium wilt, the dsRNA molecule can target the pathogenic gene VdHAT1 , inhibit or silence the expression of the gene, and the nucleotide sequence of the sense strand of the dsRNA molecule is selected from SEQ ID NO: 4 to SEQ ID NO: 9; preferably, the nucleotide sequence of the sense strand of the dsRNA molecule is selected from SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 7.

[0019] Another aspect of the present application provides a recombinant vector, characterized in that it comprises a DNA sequence capable of expressing the above-mentioned dsRNA molecule. The vector can be a microbial expression vector or a plant expression vector. The recombinant vector can introduce the DNA sequence capable of expressing the dsRNA molecule targeting VdHAT1 into microorganisms or plants by genetic transformation technology, so that the microorganisms or plants can express the dsRNA molecule targeting VdHAT1 , thereby reducing the pathogenicity of the Verticillium dahliae.

[0020] Another aspect of the present application provides a recombinant microorganism, characterized in that it comprises the above-mentioned recombinant vector.

[0021] Another aspect of the present application provides a recombinant agricultural engineering bacterium, characterized in that the genome of the engineering bacterium comprises a DNA sequence capable of expressing the above-mentioned dsRNA molecule, and the engineering bacterium can be Trichoderma harzianum Trichoderma harzianum ). The engineering bacterium can continuously secrete the dsRNA molecule targeting VdHAT1The dsRNA molecule of the gene or the siRNA molecule produced by the dsRNA molecule can effectively reduce the pathogenicity of Verticillium dahliae when they co-grow with Verticillium dahliae, thus playing a role in preventing and controlling Verticillium wilt.

[0022] Another aspect of the present invention provides a method for cultivating plants resistant to Verticillium wilt, characterized by comprising introducing the aforementioned recombinant vector into plants or plant cells, thereby causing the plants or plant cells to express the targeted vector. VdHAT1 The dsRNA molecule of the gene. The plant is, for example, cotton, solanaceous crops, or cruciferous crops. When Verticillium dahliae infects, the dsRNA molecules expressed in the plant can specifically inhibit or silence the pathogen's target gene, thereby enhancing the plant's resistance to Verticillium wilt.

[0023] In another aspect, the present invention provides a plant resistant to Verticillium wilt, characterized in that the plant has undergone genetic transformation to contain the target expressed in the plant or plant cells. VdHAT1 The DNA sequence of the dsRNA molecule of the gene; preferably, the plant is cotton.

[0024] In another aspect, the present invention provides an RNAi pesticide formulation, characterized in that it comprises an agriculturally acceptable carrier and the dsRNA molecule for controlling Verticillium wilt, and / or siRNA molecules generated from the dsRNA molecule.

[0025] The beneficial effects of this invention are: it elucidates the pathogenic gene for the first time. VdHAT1 The study investigated the crucial role of the gene and its encoded protein in the infection of cotton by *Verticillium dahliae*, confirming the effectiveness of this gene as a target for Verticillium wilt control at the molecular level. Experiments showed that knocking out... VdHAT1 The gene significantly reduced the pathogenicity of Verticillium dahliae, and the disease index and severity of cotton plants also decreased substantially, providing a theoretical basis for targeted control. Secondly, through systematic design and high-throughput screening, genes targeting [the pathogen] were obtained. VdHAT1 Highly efficient dsRNA molecules for genes (such as dsVdHAT1-1 / 3 / 4). Validated through various technical pathways including host-induced gene silencing (HIGS), microbial-mediated gene silencing (MIGS), and RNAi pesticide formulation treatment, these molecules demonstrated stable control effects against Verticillium wilt in different systems.

[0026] This invention integrates gene target discovery, RNA interference molecular design, and multi-pathway delivery system validation to form a targeted and highly efficient Verticillium wilt control strategy. This approach overcomes the limitations of traditional control methods, providing a novel technological approach for the green control of cotton Verticillium wilt and sustainable agricultural development, and has significant application prospects and ecological implications. Attached Figure Description

[0027] Figure 1 PCR verification of VdΔ hat1 Knockout mutants.

[0028] Figure 2 Wild type V592 and knockout mutant VdΔ hat1 Pathogenicity assays.

[0029] Figure 3 Targeting VdHAT1 Schematic of dsRNA design for genes.

[0030] Figure 4 PCR verification of engineered Trichoderma harzianum strains.

[0031] Figure 5 Inhibition of V592 by engineered Trichoderma harzianum.

[0032] Figure 6 Disease incidence of cotton co-inoculated with engineered Trichoderma harzianum and V592.

[0033] Figure 7 Target genes VdHAT1 Expression levels in transgenic hairy roots infected with V592.

[0034] Figure 8 Control efficacy of RNAi pesticide formulations on cotton. DETAILED DESCRIPTION

[0035] The following definitions and methods are provided to better define the present application and to guide those of ordinary skill in the art in the practice of the present application. Unless otherwise defined, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. All patents, publications, scientific articles, and other public publications identified herein are incorporated herein by reference in their entirety.

[0036] In this application, the terms "comprise", "comprises" or "comprising" shall be understood to include elements, numbers or steps other than those described.

[0037] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxyl orientation, as customary. Amino acids can be referred to herein by either the common three letter code or by the one-letter code. Nucleotides, unless otherwise indicated, are referred to by their single-letter codes. Numeric ranges are inclusive of the numbers defining the range. As used herein, "nucleic acid" includes polynucleosides or polynucleotides in either single- or double-stranded form, and unless otherwise limited, includes known analogs of natural nucleotides (e.g., peptide nucleic acids) that have similar binding properties as the reference nucleotide and are functionally equivalent in that they hybridize to single-stranded nucleic acids in a manner similar to naturally-occurring nucleotides. As used herein, the term "encoding" or "encoded" with reference to a specified nucleic acid sequence, refers to the possession of a sequence, or the ability to possess a sequence, that can be translated into a specific protein when the sequence is read in the correct reading frame. The information is read in the 5' to 3' direction. The term "full-length sequence" as used herein with reference to a particular polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence of a naturally-occurring (non-synthetic) endogenous sequence. A full-length polynucleotide encodes a full-length, catalytically active form of the particular protein. The terms "polypeptide," "polypeptide," and "protein" are used interchangeably herein to refer to a polymeric form of amino acids. The term is used in its ordinary sense, including amino acid polymers in which one or more amino acid residues are artificial chemical mimics of a naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively "protein"). The amino acid can be a naturally occurring amino acid and, unless otherwise limited, can include known analogs of naturally occurring amino acids that can function in a manner similar to the naturally occurring amino acid.

[0038] Unless otherwise indicated, the use of the terms "about," "approximately," "substantially" and other terms of degree in the specification and claims are used to describe approximations which can vary by a small amount, e.g., ±20% in some embodiments, ±10% in some embodiments, ±5% in some embodiments, ±1% in some embodiments, ±0.5% in some embodiments, and ±0.1% in some embodiments, from the stated amount, as such variations are appropriate to perform the disclosed methods and / or use the disclosed compositions, nucleic acids, polypeptides, etc. Thus, unless specifically stated otherwise, the numerical parameters listed in this specification and attached claims are approximations.

[0039] The following examples are intended to illustrate but not limit the present application. Modifications or substitutions of the method, steps or conditions of the present application, without departing from the spirit and scope of the present application, are intended to fall within the scope of the present application. Unless otherwise specified, the examples were performed according to the conventional experimental conditions, such as the Molecular Cloning Laboratory Manual by Sambrook et al. (Sambrook J, Russell D W. Molecular cloning: a laboratory manual [M]. 3rd ed. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press, 2001), or the conditions suggested by the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples were conventional commercially available reagents, and the technical means used in the examples were conventional means known to those skilled in the art.

[0040] The materials, reagents, etc. used in the following examples, unless otherwise specified, were commercially available.

[0041] The L. macrospora V592 (Feng-Gao, Bang-Jun Zhou, Guo-Ying Li, et al. A Glutamic Acid-Rich Protein Identified in Verticillium dahlia from anInsertional Mutagenesis Affects Microsclerotial Formation and Pathogenicity.PLoS ONE, 2010, 5(12): e15319.) was available to the public from the Institute of Microbiology, Chinese Academy of Sciences, 20 years from the date of filing, and the biological material was only used for repeating the relevant experiments of the present application, and could not be used for other purposes.

[0042] In the following examples, "wild type" means an organism not containing a heterologous nucleic acid molecule, and is a non-transformed or non-transgenic organism. Specific embodiments

[0043] Example 1 Construction of L. macrospora knockout vector

[0044] 1. Construction of knockout vector

[0045] (1) Vector skeleton PGKO-HPT was cut with Pac I

[0046] Reaction system (50 μL): PGKO-HPT vector 5 μg, 10 x Fast Digest Buffer 5 μL, FastDigest PacI 5 μL, ddH2O to 50 μL. Incubate at 37°C for 15 min, inactivate at 65°C for 10 min.

[0047] (2) Amplification of homologous arm

[0048] Amplify the homologous arm sequence with V592 DNA as template:

[0049] Amplification of 5' homologous arm:

[0050] KO-HAT1-5F: ttcgagctcgctgagggtttaattaaatattcgaacctcttcgttg

[0051] KO-HAT1-5R: gatgggcccgctgaggacttaattaagacgaatcgaggaagaaagc

[0052] Amplification of 3' homologous arm:

[0053] KO-HAT1-3F: ccgactagtgctgaggcattaattaagtgatgtctggcatggc

[0054] KO-HAT1-3R: acgaagcttgctgaggtcttaattaagtgacgctttcggca

[0055] (3) Homologous recombination connection

[0056] Reaction system (10 μL): PGKO PacI enzyme digestion 2.5 μL, 5' homologous arm 20 ng, 3' homologous arm 20 ng, 5 x CE MultiS Buffer 2 μL, Exnase MultiS 1 μL, ddH2O to 10 μL. Incubate at 37°C for 30 min.

[0057] (4) Transformation of E. coli competent cells

[0058] Take out a competent cell, add the above 10 μL reaction system, place on ice for 30 min, heat shock at 42°C for 90 s, then add antibiotic-free LB, activate at 37°C for 50 min, and then spread on LB+Kan plate.

[0059] (5) Positive clone identification

[0060] The monoclonal is picked, and after positive identification by PCR with specific primers, the vector is recorded as: pPGKO-hat1 after successful alignment.

[0061] 2. Agrobacterium tumefaciens genetic transformation

[0062] (1) Agrobacterium electroporation

[0063] The successfully constructed knockout vector pPGKO-hat1 is transformed into Agrobacterium EHA105 competence by electroporation method, cultured on solid LB medium added with kanamycin (Kan, 50 μg / mL) and rifampicin (Rif, 50 μg / mL) at 28°C, washed 3 times with liquid IM medium containing acetyl-syringone AS (200 μM), and finally adjusted to OD600 of about 0.25.

[0064] (2) Preparation of L. helvolum spore solution

[0065] The wild-type V592 grown on solid PDA medium is washed with liquid IM medium containing AS, and adjusted to a concentration of about 1.0 x 10 7 cfu / mL.

[0066] (3) Mixing

[0067] The Agrobacterium solution in (1) above and the L. helvolum spore solution in (2) are mixed uniformly at a ratio of 1:1, spread on solid IM medium containing AS and covered with glass paper, and cultured at 26°C for 2 d.

[0068] (4) Cultivation

[0069] The mycelium grown on the glass paper is washed off with ddH2O and spread on PDA medium containing hygromycin (50 μg / mL) resistance, and cultured for 3-5 d.

[0070] (5) Single spore isolation

[0071] The grown single colony is picked with a toothpick and streaked on hygromycin-resistant PDA plate, and the grown single colony is the transformed strain, recorded as VdΔ hat1 .

[0072] 3. Verification of transformants

[0073] PCR with specific primers is used to verify whether the point knockout is successful.

[0074] 5' end identification primer:

[0075] KO-HAT1 iden-F: tggaggatcgttggagcc

[0076] HPT seq-R: tgctcaccgcctggac

[0077] Gene identification primers:

[0078] KO-HAT1 gene-F: atggccgaggagggtg

[0079] KO-HAT1 gene-R: ctaggcatcctccacacg

[0080] 3' end identification primers:

[0081] HPT seq-F: gtgctcaacggcctcaac

[0082] KO-HAT1 gene-R: agcagagtgcacctttgct

[0083] PCR detection was performed on V592 and knockout mutant VdΔ using primers on the 5' end (upstream) of the gene, on the gene sequence and on the 3' end (downstream) of the gene, respectively. hat1

[0084] The electrophoretogram results are shown in Figure 1 , indicating that the knockout strain VdΔ hat1 was successfully constructed.

[0085] Example 2 Verification of pathogenicity of knockout mutant

[0086] (1) Sterilized sowing

[0087] Cotton seeds were sown in small pots of nutrient soil (5 seeds per pot), and after 5 days of dark culture, the culture was subjected to light culture.

[0088] (2) Preparation of L. digitata spore solution

[0089] V592 and VdΔ hat1 strains were cultured on solid PDA medium for about 3 days, and then shaken in liquid Czapek's medium for 3 days. The bacterial solution was collected and adjusted to a spore concentration of about 1.0 x 10 8 cfu / mL with distilled water.

[0090] (3) Inoculation

[0091] When the cotton in (1) grew to 4 true leaves, the bacterial solution in (2) was poured into the soil culture box in (1), about 50 mL of bacterial solution per pot. Each strain was inoculated with 2 pots of cotton, and the experiment was repeated 3 times.

[0092] (4) Result statistics and analysis

[0093] After the cotton grew for 15-20 days, the results were counted and photographed.​

[0094] Pathogenicity was statistically analyzed based on the degree of disease on each cotton leaf, and was divided into 5 levels: Level 0: no disease; Level 1: ≤25% of leaves were diseased; Level 2: 25~50% of leaves were diseased; Level 3: 50~75% of leaves were diseased; Level 4: ≥75% of leaves were diseased.

[0095] The results are as follows Figure 2 The knockout mutant VdΔ hat1 Compared to wild-type V592 infected cotton, the incidence rate, disease index, and disease severity grade of the gene were significantly lower, indicating that this gene is directly related to the pathogenicity of Verticillium dahliae.

[0096] Example 3: Initial screening of the inhibitory effect of dsRNA on target genes

[0097] 1. Design of dsRNA molecules

[0098] by VdHAT1 Using the CDS sequence (SEQ ID NO:2) as a template, it was divided into 6 segments (see diagram). Figure 3 dsRNA molecules were designed using each DNA segment as a template. The six dsRNA molecules obtained were named dsVdHAT1-1 to dsVdHAT1-6, and their positive strand RNA sequences correspond to SEQ ID NO:4 to SEQ ID NO:9, with lengths ranging from 203 to 275 nt.

[0099] 2. Construction of engineered Trichoderma harzianum

[0100] Construct the corresponding fungal dsRNA transformation vector based on the designed dsRNA molecular sequence.

[0101] A dsRNA fragment containing a stem-loop structure (sense (dsVdHAT1-n)-loop-antisense (dsVdHAT1-n)) was inserted into the pNeo-Olic vector via homologous recombination to obtain the pNeo-Olic-dsVdHAT1i-n construct. The negative control vector, containing a dsRNA sequence targeting GFP, was constructed using the same method as pNeo-Olic-dsGFPi. The recombinant vector was transformed into *E. coli* DH5α competent cells, and single colonies were picked for PCR identification and enzyme digestion verification. Positive clones were sequenced to confirm the correct insertion direction and absence of sequence mutations.

[0102] The recombinant vectors pNeo-Olic-dsGFPi and pNeo-Olic-dsVdHAT1i-n were transformed into Agrobacterium EHA105 competent cells, and positive clones were picked and cultured in LB+Kan+Rif medium at 28°C to OD 600 =0.6~0.8, centrifuged to collect the bacteria, and resuspended in IM+As medium. Wild-type Trichoderma harzianum spore suspension (1×10 6 cfu / mL) was mixed with Agrobacterium liquid at a volume ratio of 1:1, spread on solid IM medium covered with glass paper, and co-cultured at 26°C for 3 d.

[0103] The co-cultured bacteria were transferred to PDA screening medium containing G418 (40 μg / mL) and cultured at 26°C for 3~5 d. Resistant single colonies were picked and subcultured for 3 times. Genomic DNA of the resistant strains was extracted, and the dsRNA expression cassette-specific fragment was amplified by PCR to verify whether the expression cassette was expressed in Trichoderma harzianum. The positive strains were named Th-dsGFPi, Th-dsVdHAT1i-1 to Th-dsVdHAT1i-6, respectively.

[0104] The results are shown in Table 1 and Figure 4 Table 1 and

[0105] 3. In vitro plate bacteria inhibition test

[0106] Th-dsGFPi, Th-dsVdHAT1i-1 to Th-dsVdHAT1i-6 strains were respectively shaken in Czapek's medium for 3 d, adjusted to the same concentration, mixed with PDA liquid medium, and poured into plates. V592 strain was taken with a puncher and inverted on the PDA mixed with Trichoderma harzianum, and cultured at 26°C for 3 d. The growth of V592 colonies was observed, and each treatment was repeated 9 times.

[0107] The results are shown in Table 1 and Figure 5 Table 1 and

[0108] Table 1. Inhibition of V592 by different dsRNA segments Strain V592 diameter range (mm) V592 diameter size (mm) Inhibition rate (%) Significance Th-dsGFPi 11.84~12.86 12.29 - a Th-dsVdHAT1i-1 9.27~10.47 9.92 19.31 c Th-dsVdHAT1i-2 10.84~12.25 11.60 5.65 ab Th-dsVdHAT1i-3 9.47~11.42 10.09 17.90 c Th-dsVdHAT1i-4 9.81~11.94 11.06 10.02 b Th-dsVdHAT1i-5 10.56~12.78 11.96 2.71 a Th-dsVdHAT1i-6 10.81~12.53 11.74 4.48 ab

[0109] One-way ANOVA (LSD, Tukey's test, P<0.05) was used for statistical analysis. PThe results showed that the inhibitory effects of Th-dsVdHAT1i-1, Th-dsVdHAT1i-3 and Th-dsVdHAT1i-4 on V592 were significantly stronger than that of the control Th-dsGFPi. Among them, the inhibitory effect of Th-dsVdHAT1i-1 was the best, with an inhibition rate of 19.31%; the inhibitory effect of Th-dsVdHAT1i-3 was relatively the weakest, with an inhibition rate of 17.90%, and the inhibition rate of Th-dsVdHAT1i-4 was still 10.02%.

[0110] Therefore, through the preliminary screening, it is preliminarily determined that dsVdHAT1-1 / 3 / 4 is a candidate dsRNA molecule for further testing.

[0111] Example 4: Verification of agricultural engineering bacteria

[0112] According to the preliminary screening results, Th-dsVdHAT1i-1, Th-dsVdHAT1i-3 and Th-dsVdHAT1i-4 were used as test strains for soil culture and root irrigation control effect test.

[0113] (1) Disinfection sowing

[0114] The cotton seeds were sown in small pots of nutrient soil (5 seeds per pot), and after 5 days of dark culture, the pots were subjected to light culture.

[0115] (2) Preparation of L. digitatum spore solution

[0116] V592 and Hartzwood strains transformed with different dsRNAs were cultured on solid PDA medium for about 3 days, and then shaken in liquid Czapek medium for 3 days. The bacterial solution was collected and adjusted to a spore concentration of about 1.0 x 10 8 cfu / mL with distilled water.

[0117] (3) Inoculation

[0118] When the cotton in (1) grew to 4 true leaves, the bacterial solution (V592 and Hartzwood transformed with dsRNA were mixed in equal proportions) in (2) was poured into the soil culture box in (1), about 50 mL of bacterial solution per pot. Each strain was inoculated in 2 pots of cotton, and repeated 3 times.

[0119] (4) Result statistics and analysis

[0120] After the cotton grew for 15-20 days, the statistics and photographs were taken.

[0121] The pathogenicity statistics were based on the degree of disease of each cotton leaf, which was divided into 5 levels, 0 level: no disease; 1 level: ≤25% of the leaves were diseased; 2 level: 25-50% of the leaves were diseased; 3 level: 50-75% of the leaves were diseased; 4 level: ≥75% of the leaves were diseased.

[0122] The results are as follows Figure 6 The results showed that, compared with the control Th-dsGFPi strain, the Th-dsVdHAT1i strain could inhibit the pathogenicity of V592 to cotton. Among them, Th-dsVdHAT1i-3 had the best effect, while Th-dsVdHAT1i-1 and 4 had weaker effects, but all of them showed obvious resistance to Verticillium wilt compared with the negative control.

[0123] Example 5: Hairy Root System Verification of HIGS Inhibition of Pathogenic Gene Expression

[0124] The hairy root system utilizes Agrobacterium rhizogenes (… Agrobacterium rhizogenes Agrobacterium-mediated genetic transformation technology induces the production of hairy roots by infecting explants (such as cotyledons and hypocotyls) with Agrobacterium. Traditional genetic transformation methods suffer from problems such as genotype limitations, long transformation cycles, and cumbersome operations, while the hairy root system overcomes these drawbacks. This genetic transformation method has been successfully applied in a variety of plants, including the herbaceous plants rubber grass and crown vetch, the tuberous plant sweet potato, and the woody plants ailanthus and Aralia elata. Currently, a large number of studies have used the hair follicle root transfer system for cotton genetic transformation, including for rapid screening of gene function and verification of the activity of the CRISPR / Cas system (Cao X, Xie H, Song M, et al. Cut-dip-budding delivery system enables genetic modifications inplants without tissue culture[J]. Innovation, 2022, 25;4(1):100345; Zhou Guantong, Lei Jianfeng, Dai Peihong, et al. Study on efficient screening system of effective sgRNA for cotton CRISPR / Cas9 gene editing[J]. Acta Agronomica Sinica, 2021,47(03):427-437.).

[0125] The Ruby reporter system is a reporter system built on the betaine synthesis pathway, which researchers have incorporated the genes of three enzymes in the pathway ( CYP76AD1 , DODA , GT) The gene can reconstitute the betalain metabolic pathway in vivo by fusion expression through self-cleavage polypeptide, thereby accumulating red betalain in cells (He Y, Zhang T, Sun H, et al. A reporter for noninvasively monitoring gene expression and plant transformation[J]. Horticulture Research, 2020, 7(1): 821-826.). Therefore, we constructed the candidate dsRNA fragments obtained by preliminary screening into a dsRNA expression cassette, and integrated the expression cassette into the same expression vector with the Ruby reporter system; after obtaining hairy roots by transformation, we used the Ruby reporter system to indicate whether the dsRNA expression cassette was successfully integrated into the genome of hairy roots, and further carried out functional verification test of dsRNA.

[0126] 1. Construction of dsRNA Agrobacterium rhizogenes

[0127] Design of dsRNA plant transformation vector according to candidate dsRNA molecule sequence

[0128] PCR was used to obtain dsRNA fragments containing stem-loop structure (sense (dsVdHAT1-n)-loop-antisense (dsVdHAT1-n)) in the vector, which was inserted into pCAM1300-Ruby vector by homologous recombination method to obtain pCAM1300-(dsVdHAT1-n)-Ruby vector. The control vector pCAM1300-Ruby and the recombinant vector pCAM1300-(dsVdHAT1-n)-Ruby were transformed into E. coli DH5α competent cells, and single colonies were picked for PCR identification and enzyme digestion verification. Positive clones were sent for sequencing to confirm that the target fragment was inserted in the correct direction and the sequence was not mutated. pCAM1300-Ruby and pCAM1300-(dsVdHAT1-n)-Ruby vectors were transformed into Agrobacterium rhizogenes K599 competent cells, respectively, and positive clones were picked and recorded as K599-Ruby and K599-(dsVdHAT1-n)-Ruby strains.

[0129] 2. Hairy root infection system for detecting target gene expression

[0130] (1) Spore suspension preparation

[0131] Phytophthora dahliae V592 was cultured in liquid Czapek's medium for 3 d, and the bacterial liquid was collected and adjusted to a spore concentration of about 1.0 × 10 8 cfu / mL.

[0132] (2) Inoculation with hairy roots

[0133] ① Inoculate Agrobacterium strains K599-Ruby and K599-(dsVdHDAC-n)-Ruby into 1 mL LB+Strep medium and shake for 6-8 h;

[0134] ② Spread 100 μL of bacterial suspension onto LB+Strep solid medium and incubate overnight. Scrape colonies from the plate and resuspend them in injection conversion buffer to OD. 600 =0.5-0.6;

[0135] ③ Cut the above-ground part of the seedling obliquely from the base of the cotton stem, make a light cut, insert it into the bacterial conversion solution, and incubate it overnight in the dark;

[0136] ④ Insert the base of the explant stem into moist vermiculite, cover it, and incubate overnight;

[0137] ⑤ Cultured under normal LD ​​conditions, and after 12 days of culture, it was removed and placed in a hydroponic box to continue growing.

[0138] (3) Detect the expression level of target genes

[0139] Successfully transformed hairy roots are red. Once sufficient hairy roots of cotton plants transformed with both control strain K599-Ruby and target strain K599-(dsVdHAT1-n)-Ruby have grown, they are inoculated with a V592 spore suspension. Three days after inoculation, samples are taken, and total RNA is extracted from the cotton roots. 1 μg of total RNA is used for reverse transcription according to the instructions of the reverse transcription kit (R333-01, Vazyme) to synthesize the first strand of cDNA, which is then stored at -20℃ for later use. Using the cDNA as a template... VdHAT1 Gene-specific primers (based on) VdHAT1 Gene sequence design, upstream primer: 5'-ctgacatcaacgtgcccg-3', downstream primer: 5'-gacatggtatgcatttcgacc-3') for RT-qPCR amplification, using the housekeeping gene of Verticillium dahliae (e.g.) VdElf () was used as an internal reference gene to correct for differences in template amount. 2 -ΔΔCt Method for calculating each treatment group VdHAT1 The relative transcription level of the gene was set at 1, with the transcription level of the Ruby control group as 1.

[0140] The results are as follows Figure 7 As shown: Compared with the control (K599-Ruby), the hairy roots transformed with K599-(dsVdHAT1-n)-Ruby showed increased levels of Verticillium dahliae after infection with V592. VdHAT1 Gene expression levels were downregulated to varying degrees, indicating that the candidate dsVdHAT1 segments could inhibit V592 expression.VdHAT1 The expression of genes. Among them, the inhibition effect of dsVdHAT1-4 is the most significant (the expression amount is reduced by about 48.8%), followed by dsVdHAT1-1 (reduced by about 20.5%) and dsVdHAT1-3 (reduced by about 19.7%). These results confirm that the dsVdHAT1 fragment can effectively interfere with the expression of the key genes of the pathogenic bacteria in the plant body, and provide direct evidence for subsequent disease resistance applications.

[0141] Example 6 Verification of disease resistance of RNAi pesticide preparation

[0142] 1. Nanoparticle preparation

[0143] dsVdHAT1-1 / 3 / 4 was prepared in large quantities by a T7 RNA polymerase in vitro transcription system, and then purified and quantified by a LiCl precipitation method. The purified dsVdHAT1-1 / 3 / 4 (100 μg / mL) was mixed with a chitosan solution (2 mg / mL, 1% acetic acid solution) at a ratio of 1:3 (w / w), and a TPP solution (1 mg / mL) was slowly added, and magnetic stirring was performed for 30 min to form a dsVdHAT1-n-chitosan-TPP nanoparticle complex.

[0144] 2. Verification of disease resistance of pot planting

[0145] (1) Sterilization and sowing

[0146] Cotton seeds were sown in small pots of nutrient soil (5 seeds per pot), and after 5 days of dark culture, the plants were subjected to light culture.

[0147] (2) Transplanting and inoculating cotton

[0148] After the cotton plants developed 4 true leaves, 6 treatment groups were set up, each group had 4 cotton plants, and the experiment was repeated 3 times. The specific treatments were as follows:

[0149] Treatment 1: water control;

[0150] Treatment 2: water control + V592;

[0151] Treatment 3: blank nanoparticle complex (without dsVdHDAC component) + V592;

[0152] Treatment 4: dsVdHAT1-1 nanoparticle complex + V592;

[0153] Treatment 5: dsVdHAT1-3 nanoparticle complex + V592;

[0154] Treatment 6: dsVdHAT1-4 nanoparticle complex + V592.

[0155] V592 in the above treatment represents root dipping inoculation treatment with L. digitata spore suspension (1.0 × 10 7 cfu / mL); subsequent irrigation treatment with dsVdHAT1-n-containing nanocomplex and blank nanocomplex every 7 d.

[0156] (3) Potted cotton disease resistance detection

[0157] The cotton disease incidence of each treatment group was investigated 15-20 d after inoculation, the incidence rate was recorded and the disease index was calculated to evaluate the control effect of different treatments.

[0158] The pathogenicity statistics were according to the disease degree of each cotton leaf, which was divided into 5 levels, 0 level: no disease; 1 level: ≤25% leaf disease; 2 level: 25-50% leaf disease; 3 level: 50-75% leaf disease; 4 level: ≥75% leaf disease.

[0159] The results are shown in Table 2. Figure 8 As shown in Table 2, the disease incidence rates of treatments 4-6 were significantly lower than that of the water control after irrigation treatment, indicating that the dsVdHAT1 molecules of the candidate segments could be applied to biological pesticides.

Claims

1. A method for inhibiting or silencing a pathogenic gene of Verticillium dahliae by RNAi, characterized in that, VdHAT1 the method for preventing and treating Verticillium wilt, characterized in that, The pathogenic gene is a polynucleotide encoding the amino acid sequence shown in SEQ ID NO: 3, the RNAi is mediated by a dsRNA molecule targeting the gene, and can reduce the virulence of L. rostrate.

2. Use according to claim 1, characterized in that, The inhibition or silencing is achieved by host-induced gene silencing, microbe-mediated gene silencing, or RNAi pesticide treatment.

3. A dsRNA molecule for controlling Gummy stem blight, characterized in that, The dsRNA molecule is capable of targeting the pathogenic gene as claimed in claim 1 VdHAT1 and inhibiting or silencing the expression of the gene, and the nucleotide sequence of the sense strand of the dsRNA molecule is selected from the group consisting of SEQ ID NO: 4 to SEQ ID NO:

9.

4. The dsRNA molecule of claim 3, wherein, The nucleotide sequence of the sense strand of the dsRNA molecule is selected from SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO:

7.

5. A recombinant vector, characterized in that, A DNA sequence comprising the dsRNA molecule of claim 3.

6. The recombinant vector of claim 5, wherein, The vector is a plant expression vector or a microbial expression vector.

7. A recombinant microorganism, characterized in that, A recombinant vector of claim 5 or 6.

8. A recombinant agricultural engineering bacterium, characterized in that, The agricultural engineering bacteria is Trichoderma harzianum (ATCC 20847) Trichoderma harzianum which contains in the genome a DNA sequence capable of expressing a dsRNA molecule according to claim 3.

9. A method for cultivating plants resistant to Verticillium wilt, characterized in that, The recombinant vector of claim 5 or 6 is introduced into a plant or plant cell, wherein the recombinant vector is a plant expression vector, and the plant or plant cell expresses the dsRNA molecule of claim 3.

10. A plant resistant to Verticillium wilt, characterized in that, The plant contains an exogenous DNA sequence capable of expressing the dsRNA molecule of claim 3, and the plant is cotton.

11. An RNAi pesticide formulation, characterized in that, An agricultural acceptable carrier and the dsRNA molecule of claim 3, and / or siRNA molecules produced from the dsRNA molecule.

Images