Method for preparing dammarendiol in nicotiana benthamiana and teasel

Abstract

The invention relates to a method for preparing dammarendiol in nicotiana benthamiana and teasel, and belongs to the technical field of biology. The method comprises the following steps: inserting a target gene into a transient expression vector to obtain a recombinant vector; the target gene is as shown in SEQ ID NO. 1; the method comprises the following steps: by taking leaves of seedlings of nicotiana benthamiana and teasel as materials, infecting GV3101 / pEAQ-HT-DDS agrobacterium liquid, culturing, and extracting the cultured plant leaves, thereby obtaining dammarendiol. According to the method, tobacco and teasel leaves are infected by using an agrobacterium tumefaciens vacuum infiltration method, and a safe and efficient transient expression system which is easy for large-scale production of dammarendiol is established in the tobacco and teasel leaves.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for preparing dammarene diol from tobacco styrax and Dipsacus asperoides. Background Technology

[0002] Currently, the most commonly used plant bioreactor is *Nicotiana benthamiana*. As a model plant, *Nicotiana benthamiana* possesses advantages that other plants do not have: a short growth cycle, weak disease resistance, and low rejection response. There are no reports yet of using *Dipsacus asper* as a plant bioreactor to produce plant secondary metabolites.

[0003] Dipsacus asperoides is a perennial herb belonging to the Dipsacus genus of the Dipsaciaceae family. The dried root or rhizome of Dipsacus asperoides is the traditional Chinese medicine, used to tonify the liver and kidneys, strengthen tendons and bones, regulate blood circulation, and stop metrorrhagia. Dipsacus asperoides has a wide distribution, and can be cultivated in Hubei, Hunan, Jiangxi, Guangxi, Yunnan, Guizhou, Sichuan, and Tibet provinces and autonomous regions. It is highly adaptable to its growing environment, growing along ditches, in grasslands, forest edges, and roadsides. The cultivation period is short, and it can be harvested in the same year or the following spring. It has a high yield, 8283-8861 kg / hm². 2 Dipsacin VI is the main active ingredient in Dipsacus asperoides. The pharmacopoeia requires a content of 2%, but actual studies have found that the content can reach 7.7%.

[0004] Protopanaxadiol is a dammarane-type tetracyclic triterpenoid saponin aglycone, while Dipsacus asperoidin VI is an oleanane-type pentacyclic triterpenoid saponin, both being triterpenoid saponins. Their biosynthetic pathways are identical at the initial stage, both using the MVA pathway to provide the precursor 2,3-oxidosqalene. Subsequently, 2,3-oxidosqalene is converted into different triterpenoid saponins by different oxidosqalene cyclases, cytochrome oxidases, and glycosyltransferases. Studies by Kim et al. have shown that in ginseng plants such as Panax notoginseng, the content of protopanaxadiol-type saponins is only 2.2%-5.8%, and the cultivation cycle is long. In contrast, the content of Dipsacus asperoidin VI in Dipsacus asperoidin can reach 7.7%, indicating that its ability to synthesize the precursor 2,3-oxidosqalene is stronger than that of ginseng plants, and Dipsacus asperoidin can be harvested in the same year or the following spring. Utilizing the powerful triterpenoid saponin synthesis capacity of Dipsacus asperoides, and transforming it into a plant platform for triterpenoid saponin biosynthesis, and then modifying its synthesis pathway through bioengineering to produce high-value triterpenoid saponins such as ginsenosides, is a field worthy of exploration. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method for preparing dammarene diol from tobacco and Dipsacus asperoides. To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of this invention provides a method for preparing dammarene glycol from *Tobacco Benzoinus* and *Dipsacus asper*, comprising the following steps: The target gene was inserted into a transient expression vector to obtain a recombinant target gene transient expression vector plasmid; the target gene is shown in SEQ ID NO.1; The recombinant target gene transient expression vector plasmid was transformed into Escherichia coli DH5α competent cells, positive single colonies were screened, and then transformed into Agrobacterium GV3101 competent cells to obtain GV3101 / recombinant target gene transient expression vector plasmid Agrobacterium. Using leaves from seedlings of Nicotiana benthamiana or Dipsacus asperoides as materials, Agrobacterium tumefaciens was inoculated with GV3101 / recombinant target gene transient expression vector plasmid and cultured. Dammarene diol was then extracted from the cultured plant leaves.

[0006] Furthermore, the transient expression vector is pEAQ-HT.

[0007] Furthermore, the DDS gene from Panax notoginseng was homologously recombined with the transient expression vector pEAQ-HT to obtain the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS; it was transformed into Escherichia coli DH5α competent cells, positive single colonies were screened, and then transformed into Agrobacterium GV3101 competent cells to obtain GV3101 / pEAQ-HT-DDS Agrobacterium.

[0008] Furthermore, the following steps are included: Step (1): Use DDS primers to perform PCR amplification on the DDS gene, and use the amplification product as the target fragment. The primer pair includes upstream primer DDS-1F and downstream primer DDS-1R, with the following sequences: Upstream primer DDS-1F: ctgcccaaattcgcgaccggtatgtggaagctgaaggttg; Downstream primer DDS-1R: tgaaaccagagttaaaggcctcgagttaaattttgagctgctggtgc; Step (2): The transient expression vector pEAQ-HT was double-digested to obtain the linearized transient expression vector pEAQ-HT; Step (3) involves ligating the target fragment with the linearized transient expression vector pEAQ-HT to obtain the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS; then, the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS is transformed into E. coLi DH5α competent cells, positive single colonies are screened, and then transformed into Agrobacterium GV3101 to obtain GV3101 / pEAQ-HT-DDS Agrobacterium, which is the transient expression system.

[0009] Furthermore, using leaves from seedlings of Tobacco Benzoviae or Dipsacus asperoides as materials, GV3101 / pEAQ-HT-DDS Agrobacterium tumefaciens was inoculated and cultured. Dammarene diol was extracted from the plant leaves after 3 days of culture.

[0010] Furthermore, using leaves from *Nicotiana benthamiana* seedlings or *Dipsacus asper* seedlings as materials, *Agrobacterium tumefaciens* GV3101 / pEAQ-HT-DDS bacterial suspension was inoculated and cultured. The specific method is as follows: Leaf samples from *Nicotiana benthamiana* seedlings or *Dipsacus asper* seedlings were used as materials. A *Agrobacterium* culture solution of GV3101 / pEAQ-HT-DDS was permeated under high pressure and vacuum at 0.08 MPa for 3 minutes. The samples were then cultured in an incubator at 25°C in darkness for 24 hours. The incubator conditions were then adjusted to 23°C for 16 hours during the day, 16°C for 8 hours at night, 75% relative humidity, and 5000 Lux light intensity for 3 days. The expression levels of dammarene diol in *Nicotiana benthamiana* and *Dipsacus asper* seedlings were then measured.

[0011] Furthermore, using leaves of *Dipsacus asper* seedlings as material, *Agrobacterium tumefaciens* GV3101 / pEAQ-HT-DDS bacterial suspension was inoculated and cultured. The specific method was as follows: Using leaves from *Dipsacus asper* seedlings as material, Silwet L-77 surfactant was added to GV3101 / pEAQ-HT-DDS *Agrobacterium* bacterial suspension to a final concentration of 0.02% v / v, followed by high-pressure vacuum permeation at a pressure of 0.08 MPa for 3 minutes. After incubation at 25℃ in darkness for 24 hours, the incubator conditions were adjusted to 23℃ for 16 hours during the day, 16℃ for 8 hours at night, 75% relative humidity, and 5000 Lux light intensity for 3 days. The expression level of dammarene diol in *Dipsacus asper* seedlings was then detected.

[0012] A second aspect of the present invention provides a recombinant plasmid for constructing transient expression of the DDS gene in Nicotiana benthamiana and Dipsacus asperoides, wherein the recombinant plasmid is the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS.

[0013] A third aspect of the present invention provides methods for constructing transient expression in *Nicotiana benthamiana* and *Dipsacus asper*. DDSThe genetically engineered bacteria containing the recombinant plasmid.

[0014] Furthermore, the genetically engineered bacteria is Escherichia coli DH5α.

[0015] This invention revealed that the dammarene diol precursor synthesis capacity of ginseng plants is weaker than that of *Dipsacus asper*, which is due to differences in the expression of key enzymes in the tetracyclic triterpenoid secondary metabolic pathway and evolutionary adaptation to different habitats. This difference reflects the long-term evolutionary adaptation of the two genera to different habitats. *Dipsacus asper* enriches saponins through a "multiple precursors, stable transformation" model. This indicates that *Dipsacus asper* possesses a natural advantage in high-yield triterpenoid saponins.

[0016] The Dipsacus asperoides plant material used in this experiment came from the improved variety "Dianxu No. 1" selected and bred by our team. According to public reports from the Yunnan Provincial Department of Agriculture and Rural Affairs and third-party testing, the saponin VI of Dipsacus asperoides reached 7.7%.

[0017] Compared with the prior art, the beneficial effects of this invention are as follows: (1) Existing technologies for obtaining rare saponins and target compounds mostly rely on constructing a stable hairy root system or cultivating transgenic plants for extraction. This process is time-consuming and labor-intensive, and is prone to polluting the ecological environment. This invention uses Agrobacterium-mediated instantaneous transformation technology, which has the advantages of simple operation, low cost, short cycle, and no adverse impact on the ecological environment. (2) Compared with the method of obtaining dammarene diol from ginseng plants, the method of the present invention is more direct and efficient. The content of dapoxetine VI in Dipsacus asperoides can reach 7.7%, which indicates that its precursor 2,3-squalene oxide has a stronger ability to synthesize than that of ginseng plants, and it has a shorter growth cycle and is easier to cultivate; (3) Compared with the currently widely used microbial fermentation synthesis technology for pharmaceutical ingredients, the present invention uses a plant transient expression system to produce pharmaceutical ingredients, which has the advantages of low cost and easy large-scale promotion. In addition, the present invention can not only improve the production efficiency of pharmaceutical proteins and small molecule compounds, shorten the production cycle, and increase the yield of target products, but also provide a more efficient, safe and green production route for the biopharmaceutical field. Attached Figure Description

[0018] Figure 1 Map of the pEAQ-HT-DDS plasmid for transient expression of the recombinant DDS gene; Figure 2 This is a gel electrophoresis image of DDS gene amplification; where M: DNA Marker, there are 9 bands, from bottom to top: 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3000bp, and lanes 1, 2, and 3 are all DDS gene amplification bands, each with a length of 2000-3000bp; Figure 3 Gel electrophoresis diagram of pEAQ-HT linearized recombinant transient expression vector; M: DNA Marker, with 9 bands, from top to bottom 5000bp, 3000bp, 2000bp, 1500bp, etc. Lane 1 is the transient expression vector pEAQ-HT plasmid, and the four lanes 2-5 after enzyme digestion are all pEAQ-HT linearized recombinant transient expression vector plasmids. Figure 4 This is an electrophoresis image of Escherichia coli DH5α competent cells transformed with the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS. M represents the DNA Marker with nine bands, from bottom to top: 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, and 3000bp. Lanes 1 to 8 represent eight positive transformed colonies of the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS, all with a bp value of 2000-3000bp. Figure 5 Electrophoresis image of Agrobacterium GV3101 colonies transformed with the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS; M: DNA Marker, with 9 bands, from bottom to top: 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3000bp; lanes 1 to 8 are 8 selected positive transformed colonies of GV3101 / pEAQ-HT-DDS, all with a length of 2000-3000bp; Figure 6 This is an electrophoresis image of Agrobacterium GV3101 colonies transformed with the transient expression vector pEAQ-HT plasmid; M: DNA Marker, with 9 bands, from bottom to top: 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3000bp; lanes 1 to 8 are 8 selected positive transformed colonies of recombinant GV3101-pEAQ-HT, all with a length of 300-400bp; Figure 7 To detect the expression of the target gene in tobacco by RT-PCR; M: DNA Marker, with 9 bands, from bottom to top: 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3000bp; lanes 1 to 3 are tobacco leaves infected with Agrobacterium GV3101 / pEAQ-HT 3 days later; lane 4 is tobacco leaves infected with Agrobacterium GV3101 / pEAQ-HT-DDS 3 days later. Figure 8To analyze the extracts of tobacco leaves after 3 days of infection with Agrobacterium GV3101 / pEAQ-HT and Agrobacterium GV3101 / pEAQ-HT-DDS by HPLC; where A is dammarene glycol reference standard, B is tobacco infected with Agrobacterium GV3101 / pEAQ-HT, and C is tobacco infected with Agrobacterium GV3101 / pEAQ-HT-DDS. Figure 9 To analyze the extracts of *Dipsacus asper* leaves after 3 days of infection with *Agrobacterium tumefaciens* GV3101 / pEAQ-HT and *Agrobacterium tumefaciens* GV3101 / pEAQ-HT-DDS by HPLC; A is dammarene glycol reference standard, B is *Dipsacus asper* infected with *Agrobacterium tumefaciens* GV3101 / pEAQ-HT, and C is *Dipsacus asper* infected with *Agrobacterium tumefaciens* GV3101 / pEAQ-HT-DDS. Figure 10 Chemical components in tobacco and Dipsacus asperoides leaves were analyzed by LC-MS 3 days after infection with Agrobacterium tumefaciens GV3101 / pEAQ-HT and Agrobacterium tumefaciens GV3101 / pEAQ-HT-DDS. A: Dipsacus asperoides infected with Agrobacterium tumefaciens GV3101 / pEAQ-HT; B: Tobacco infected with Agrobacterium tumefaciens GV3101 / pEAQ-HT; C: Dipsacus asperoides infected with Agrobacterium tumefaciens GV3101 / pEAQ-HT-DDS; D: Tobacco infected with Agrobacterium tumefaciens GV3101 / pEAQ-HT-DDS; E: Dammarene diol reference standard. Figure 11 Characteristic peaks of tobacco and Dipsacus asperoides were detected by LC-MS; A represents tobacco infected with Agrobacterium GV3101 / pEAQ-HT-DDS, and B represents Dipsacus asperoides infected with Agrobacterium GV3101 / pEAQ-HT-DDS. Detailed Implementation

[0019] The present invention will now be described in further detail with reference to the embodiments.

[0020] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.

[0021] The culture medium used in this invention: 1 / 2MS solid medium: 2.27 g / L 1 / 2MS medium powder + 30 g / L sucrose + 10 g / L agar powder; LB liquid medium: 10 g / L tryptone + 5 g / L yeast extract + 10 g / L sodium chloride; LB solid medium: 10 g / L tryptone + 5 g / L yeast extract + 10 g / L sodium chloride + 15 g / L agar powder.

[0022] All samples of Panax notoginseng roots, stems, leaves, and flowers used in this experiment were collected, flash-frozen in liquid nitrogen, and stored in an ultra-low temperature freezer at -80℃.

[0023] Escherichia coli DH5α competent cells: purchased from Shanghai Weidi Biotechnology Co., Ltd., used for screening positive clones and for plasmid preservation and amplification experiments.

[0024] Agrobacterium GV3101 competent cells: purchased from Shanghai Weidi Biotechnology Co., Ltd., all GV3101 cells were selectively labeled with rifampicin resistance.

[0025] pEAQ-HT transient expression vector: a gift from Professor Zhao Yucheng of China Pharmaceutical University.

[0026] The operation steps are as follows: (1) Cultivation of experimental materials After sterilization treatment, *Nicotiana benthamiana* seeds were soaked in 75% v / v alcohol for 1 min and then in 5% v / v sodium hypochlorite for 10 min before being sown on 1 / 2 MS solid medium. No post-sowing management was required, as the medium provided sufficient nutrients. After 10-12 days, the sterile seedlings were transplanted into plug trays containing *Nicotiana benthamiana* nutrient soil (300L, 0-10mm, pH=5.5) and placed in a greenhouse for growth (12h daytime, 25℃, 70% humidity, 10000 lux light; 8h nighttime, 20℃, 70% humidity). Tobacco seedlings at 35-40 days of age (5-6 leaf stage) were used as infection material.

[0027] Soak *Dipsacus asper* seeds sequentially in 300 mg / L gibberellin for 24 hours, in water for 1 hour, in 75% v / v ethanol for 30 seconds, and in 0.1% w / v mercuric chloride for 12 minutes. Sow 1-2 seeds evenly in seedling trays filled with Pinscher potting mix (300L, 0-10mm, pH=5.5), covering with plastic wrap and placing outdoors. Water every 5 days after germination. After 30 days, transfer seedlings to 300mL pots (outer diameter 27cm, inner diameter 23.5cm, height 20cm, bottom diameter 17.5cm), planting 1-2 seedlings per pot. Use 50-60 day old *Dipsacus asper* seedlings as infection material.

[0028] (2) Cloning of the target gene in Panax notoginseng and construction of transient expression vector (2.1) Preparation of the target fragment The roots, stems, leaves, and flowers of Panax notoginseng stored at -80℃ were ground together in liquid nitrogen (mixing ratio 1:1:1:1). RNA was extracted from Panax notoginseng using a difficult-to-extract plant total RNA miniprep kit (purchased from Guangzhou Meiji Biotechnology Co., Ltd.). After the extracted total RNA passed the quality test by 1% w / v agarose gel electrophoresis, it was reverse transcribed into cDNA using a TKARA reverse transcription kit and stored at -20℃ for later use.

[0029] The sequence of Panax notoginseng dammarene diol synthase (DDS) (KC953035.1) was downloaded from NCBI (https: / / www.ncbi.nlm.nih.gov / gene / ). The recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS was designed using SnapGene 3.2.1 software. Figure 1 Primers for amplifying the target gene carrying the homologous arm of the pEAQ-HT transient expression vector were designed, and the primer sequences are shown in Table 1. Gene amplification was performed using 2×Phanta enzyme. After PCR, the target band was determined by 1% w / v agarose gel electrophoresis, and the results are shown below. Figure 2 As can be seen, lanes 1, 2, and 3 are of the same length, and using M as a scale, the lengths are all between 2000-3000 bp. After confirming successful amplification, the target gene was recovered using the EasyPure Quick Gel Extraction Kit. The recovered concentration was measured using a NanoReady ultra-micro UV-Vis spectrophotometer, and finally stored at -20℃ for later use.

[0030] PCR amplification system (50 μL): 2×Phanta enzyme 25μL Upstream primer DDS-1F 2μL (10μm) Downstream primer DDS-1R 2μL (10μm) Panax notoginseng cDNA 3μL ddH2O 18μL PCR amplification conditions: 95℃ for 3 min; 95℃ for 15 s, 56℃ for 15 s, 72℃ for 1 min, for a total of 35 cycles; 72℃ for 5 min, 10℃ for ∞.

[0031] The amplification product obtained by PCR amplification is used as the target fragment; Table 1 Primer name Primer sequence (5'→3') SEQ ID NO. DDS-1F ctgcccaaattcgcgaccggtatgtggaagctgaaggttg 2 DDS-1R tgaaaccagagttaaaggcctcgagttaaattttgagctgctggtgc 3 (2.2) Preparation of linearized transient expression vector pEAQ-HT The transient expression vector pEAQ-HT was selected to have AgeI and XhoI restriction sites. The pEAQ-HT plasmid was double-digested with AgeI and XhoI restriction endonucleases, and the linearized transient expression vector pEAQ-HT was obtained after gel recovery.

[0032] Enzyme digestion system 50 μL: Transient expression vector pEAQ-HT 1μg AgeI 1μL XhoI 1μL Cutsmtaer Buffer 5μL ddH2O to 50 μL The enzyme digestion system was placed in a PCR instrument and reacted at 37°C for 40 min. All PCR products were then subjected to 1% w / v agarose gel electrophoresis. The results are as follows: Figure 3 As shown, lane 1 is the transient expression vector pEAQ-HT plasmid. Compared with the linearized transient expression vector pEAQ-HT plasmids in lanes 2, 3, 4, and 5, there is a significant height difference, indicating successful enzyme digestion. The target band was quickly excised under UV irradiation and recovered using the EasyPure® Quick Gel Extraction Kit EG101-01. The recovered concentration was measured using a NanoReady ultra-micro UV-Vis spectrophotometer, and finally stored at -20°C for later use.

[0033] (2.3) Preparation of recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS Recombination was performed using Exnase® II from Nanjing Novizan Biotechnology Co., Ltd. The amount of each component was calculated according to the recombination instructions based on the concentration of the target fragment and the linearized transient expression vector pEAQ-HT plasmid.

[0034] 20 μL of the connection system: Linearized transient expression vector pEAQ-HT XμL Target fragment YμL 5×CE II Buffer 4μL Exnase II 2μL ddH2O to 20 μL X = 0.02 × number of bases in the linearized transient expression vector pEAQ-HT (10003) / concentration of the linearized transient expression vector pEAQ-HT; Y = 0.04 × number of bases in the target fragment / concentration of the target fragment.

[0035] The ligation system was placed in a PCR instrument at 37℃ and reacted for 30 min. After the reaction, it was immediately placed on ice to obtain the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS.

[0036] (2.4) Transformation of E. coLi DH5α competent cells 5 μL of the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS was obtained and transformed into E. coli DH5α competent cells. The cells were then plated onto LB agar containing 80 mg / L kanamycin and incubated overnight at 37°C. Subsequently, in a clean bench, eight single colonies were randomly selected and added to 20 μL of sterile water, with 1 μL of the bacterial-water mixture used for bacterial-water PCR amplification. Bacterial water PCR amplification system (20 μL): 2×Rapid Taq 10μL DDS-1F 1μL (10μm) DDS-1R 1μL (10μm) 1μL of bacterial water ddH2O 7μL PCR amplification conditions: 95℃ for 3 min, 95℃ for 15 s, 56℃ for 15 s, 72℃ for 1 min, for a total of 30 cycles; 72℃ for 5 min, 10℃ for ∞.

[0037] After the PCR reaction, the size of the colony PCR products was detected by 1% w / v gel electrophoresis. The results are as follows: Figure 4 The lengths of lanes 1-8 were found to be consistent, and using M as a scale, the lengths of all 8 lanes were found to be between 2000-3000 bp. The length of the detected fragment was close to the length of the target fragment DDS 2310 bp, indicating a true positive result, and the assembly was marked as successful.

[0038] In a clean bench, the remaining 19 μL of bacterial-water mixture, from which PCR-identified positive colonies were found, was transferred to 5 mL of LB broth containing 80 mg / L kanamycin. The culture was incubated at 37°C and 220 rpm for 12–16 hours. 4 mL of the bacterial culture was then sent to a sequencing company for sequencing. After sequencing and confirming sequence alignment, 50% v / v glycerol was added to the bacterial culture at a 1:2 volume ratio in preservation tubes. The mixture was thoroughly mixed and stored at -80°C for later use. The plasmid pEAQ-HT-DDS, correctly named by PCR and sequence analysis, was the recombinant DDS gene transient expression vector.

[0039] (2.5) Preparation of GV3101 / pEAQ-HT-DDS Agrobacterium The recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS was extracted and transformed into Agrobacterium GV3101 competent cells. The cells were plated on 80 mg / L kanamycin LB solid medium and incubated at 28°C for 2-3 days, during which time the colony growth was continuously monitored. Eight single colonies were randomly selected and added to 20 μL of sterile water. 1 μL of the bacterial-water mixture was then used for bacterial-water PCR amplification. Bacterial water PCR amplification system (20 μL): 2×Rapid Taq 10μL DDS-1F 1μL (10μm) DDS-1R 1μL (10μm) 1μL of bacterial water ddH2O 7μL PCR amplification conditions: 95℃ for 3 min, 95℃ for 15 s, 56℃ for 15 s, 72℃ for 1 min, for a total of 30 cycles; 72℃ for 5 min, 10℃ for ∞.

[0040] After the PCR reaction, the size of the colony PCR products was detected by 1% w / v gel electrophoresis. The results are as follows: Figure 5 The results showed that lanes 1-8 had the same length, and using M as a scale, the length of all 8 lanes was between 2000-3000 bp. The length of the detected fragment was close to the length of the target fragment DDS 2310 bp, indicating a true positive result, and the transformation was marked as successful.

[0041] In a clean bench, the remaining 19 μL of bacterial-water mixture containing PCR-identified positive colonies was transferred to 5 mL of LB broth containing 50 mg / L kanamycin and incubated at 28 °C and 220 rpm for 24–36 hours. 50% v / v glycerol was added to the bacterial culture at a 1:2 volume ratio and thoroughly mixed before being stored at -80 °C for later use. The *Agrobacterium* GV3101 containing the DDS gene, correctly detected by PCR, was named *Agrobacterium* GV3101 / pEAQ-HT-DDS.

[0042] Simultaneously, the transient expression vector pEAQ-HT plasmid, donated by Professor Zhao Yucheng of China Pharmaceutical University, was transformed into Agrobacterium GV3101 competent cells and plated on LB solid medium containing 80 mg / L kanamycin. The cells were incubated at 28°C for 2-3 days, with continuous monitoring of colony growth. Identification primers for the pEAQ-HT vector were designed using SnapGene 3.2.1. Primer sequences (5'→3'): upstream primer for identification: cttctgcttgacgaggtattg (SEQ ID NO.4), downstream primer for identification: aaccgctcaccaaacatag (SEQ ID NO.5). Eight single colonies were randomly selected and added to 20 μL of sterile water, with 1 μL of the bacterial-water mixture used for bacterial-water PCR identification. After the reaction, the size of the colony PCR products was detected by 1% w / v gel electrophoresis. The results are shown below. Figure 6 Lanes 1-8 were found to be of uniform length, and using M as a scale, the lengths of all eight lanes were between 300-400 bp. The detected fragment length was close to the 303 bp length of the transient expression vector pEAQ-HT, indicating a true positive result and successful transformation. In a clean bench, the remaining 19 μL of the PCR-identified positive bacterial-water mixture was transferred to 5 mL of LB broth containing 80 mg / L kanamycin and incubated at 37°C and 220 rpm for 24-36 hours. 50% v / v glycerol was added to the bacterial culture at a 1:2 volume ratio to obtain GV3101-pEAQ-HT Agrobacterium. After thorough mixing, the culture was stored at -80°C for later use.

[0043] The PCR reaction system used for identification (20 μL) was as follows: 2×Rapid Taq 10μL Identify 1 μL (10 μm) of upstream primer. Identify 1 μL (10 μm) of downstream primer. 1μL of bacterial water ddH2O 7μL.

[0044] The PCR reaction conditions used for identification were: 95℃ for 3 min, 95℃ for 15 s, 56℃ for 15 s, 72℃ for 1 min, for a total of 30 cycles; 72℃ for 5 min, 10℃ for ∞.

[0045] (3) Prepare an inoculation solution and inoculate tobacco and Dipsacus asper leaves. Take 10 μL of Agrobacterium tumefaciens GV3101 / pEAQ-HT-DDS culture and 10 μL of Agrobacterium tumefaciens GV3101 / pEAQ-HT culture, and add them to 5 mL of LB liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampin, respectively. Incubate at 28℃ and 220 rpm for 36 h. Then transfer to 400 mL of LB liquid medium containing 50 mg / L kanamycin and 50 mg / L rifampin, and propagate at 28℃ and 220 rpm for 12-16 h. When OD600 = 0.8~1.0, collect the cells by centrifugation at 4℃ and 5000 rpm for 20 min to obtain Agrobacterium tumefaciens GV3101 / pEAQ-HT-DDS cells and empty-vector Agrobacterium tumefaciens GV3101 / pEAQ-HT cells.

[0046] Prepare a resuspension infection solution by resuspending GV3101 / pEAQ-HT-DDS Agrobacterium cells in 400 mL of Agrobacterium inoculation buffer according to Table 2. At the same time, prepare an empty GV3101 / pEAQ-HT Agrobacterium cell resuspension infection solution by resuspending it in 200 mL of Agrobacterium inoculation buffer according to Table 2. After the prepared infection solutions are allowed to stand in the dark for 3 hours, tobacco and Dipsacus asper leaves are infected by high pressure vacuum permeation method.

[0047] Table 2 Mother liquor concentration Working concentration 100 mL Agrobacterium inoculation buffer <![CDATA[MgCl2]]> 1M 10mM 1mL MES pH 5.6 500mM 10mM 1mL KOH 500mM 10mM 1mL Acetyleugenol 400mM 150mM 37.5μL sterile water / / 96.9mL (3.1) Benedict's tobacco contamination During infection, first place the tobacco seedlings with a soil retaining board upside down in the settled infection solution, then put them in a high-pressure vacuum permeabilizer at a pressure of 0.08 MPa for a total of 3 minutes. After infection, remove the soil retaining board from the tobacco seedlings and put them back into the greenhouse for cultivation. After infection, pay attention to watering frequently.

[0048] (3.2) Infection by Sichuan Dipsacus Add Silwet L-77 surfactant to the remaining infection solution to a final concentration of 0.02% v / v. Surfactants can act as penetrants, making plant cell membranes more sensitive and allowing solutes to enter more easily (tobacco leaves are easily infected using high-pressure vacuum methods, while Dipsacus asper leaves are not easily infected; using Silwet L-77 helps improve infection efficiency).

[0049] Place the seedlings of *Dipsacus asper* upside down with a soil retainer in the settled infection solution, then put them into a high-pressure vacuum permeator at a pressure of 0.08 MPa for 3 minutes. Remove the soil retainer from the infected seedlings and return them to the greenhouse for cultivation. After infection, pay attention to watering frequently.

[0050] (4) Detection of the target gene in tobacco leaves after infection.

[0051] RNA was extracted from tobacco leaves 3 days after infection using a difficult-to-extract plant total RNA miniprep kit. The extracted RNA was reverse transcribed into cDNA using the PrimeScript™ II 1st Strand cDNA Synthesis Kit. Using the reverse-transcribed cDNA as a template, the DDS gene in tobacco was detected using primers DDS-F and DDS-R, respectively.

[0052] DDS-F: atgtggaagctgaaggttgct; (SEQ ID NO.6) DDS-R: ttaaattttgagctgctggtgctttgg; (SEQ ID NO.7) The PCR reaction system used for the detection (50 μL): 2×Phanta enzyme 25μL DDS-F 2μL (10μm) DDS-R 2μL (10μm) 3μL cDNA ddH2O 18μL PCR parameters: 95℃ for 3 min; 95℃ for 15 s, 59℃ for 15 s, 72℃ for 1 min, for a total of 35 cycles; 72℃ for 5 min, 10℃ for ∞.

[0053] Because *Dipsacus asper* contains the β-AS gene, which belongs to the same family as DDS, RT-PCR cannot be used to determine that the amplified gene fragment in *Dipsacus asper* is DDS; however, HPLC and LC-MS methods can be used to detect the *Dipsacus asper* product. Since tobacco does not contain genes of the same family as DDS, this method can be used for identification. Figure 7 As shown in the figure. RT-PCR experiments revealed that, compared with tobacco leaves infected with *Agrobacterium tumefaciens* GV3101 / pEAQ-HT in lanes 1, 2, and 3, tobacco leaves infected with *Agrobacterium tumefaciens* GV3101 / pEAQ-DDS in lane 4 showed a bright band at a length of 2000-3000 bp. The detected fragment length was similar to the target fragment length DDS2310 bp. This indicates that the target gene DDS insertion expression was detected in tobacco.

[0054] (5) HPLC determination of dammarene diol in tobacco and Dipsacus asper leaf extracts Dammarene diol was determined by high performance liquid chromatography in extracts of tobacco and Dipsacus asperoides leaves 3 days after infection.

[0055] The dammarene glycol reference solution was prepared as follows: 0.2 g of dammarene glycol reference standard was accurately weighed, diluted to 2 mL with chromatographic methanol, and sonicated for 2 min to obtain a reference solution with a concentration of 1 mg / mL. It was stored at 4℃ protected from light until use.

[0056] The test samples were prepared as follows: tobacco leaves were dried in an oven at 50℃ for 3 days and leaves of Dipsacus asperoides infected for 3 days were ground into powder and placed in 1.5mL centrifuge tubes. Methanol was added just enough to cover the powder, and the tubes were sonicated for 30 minutes. After cooling to room temperature, the tubes were centrifuged at 10000g for 10 minutes. The supernatant was filtered through a 0.22um microporous membrane, and the filtrate was used as the test sample solution. The solution was stored at 4℃ in the dark for later use.

[0057] The analysis was performed using an Agilent 1290 ultra-high performance liquid chromatograph. Chromatographic conditions: Agilent Extend-C18 column (250 mm × 4.6 mm, 5 μm); column temperature: 30℃; mobile phase for product determination: 0.01% v / v formic acid aqueous solution (A) - acetonitrile (B); gradient elution: 0–10 min 30% A, 10–30 min 10% A; elution time: 30 min; injection volume: 10 μL; detection wavelength: 203 nm.

[0058] Analyzing the components in tobacco and Dipsacus asperoides leaves three days after infection, such as... Figure 8 and Figure 9 As shown, tobacco leaves infected with GV3101 / pEAQ-HT-DDS Agrobacterium ( Figure 8 The peak corresponding to the dammarene glycol reference standard was not observed in sample B). Dammarene glycol was detected in tobacco leaves infected with Agrobacterium GV3101 / pEAQ-HT-DDS. Figure 8 The peak at C) is eluted at 24.280 min, compared with dammarene glycol reference standard ( Figure 8 The retention times of peak A in the samples were consistent. The leaves of *Dipsacus asper* infected with GV3101 / pEAQ-HT were... Figure 9 No peak with the same elution time as the dammarene glycol reference standard was observed in sample B). Dammarene glycol was detected in the leaves of *Agrobacterium tsao-ko* infected with GV3101 / pEAQ-HT-DDS. Figure 9 The peak value of C in the figure is eluted at 23.991 min, which is different from that of dammarene glycol reference standard (C). Figure 9 The retention times of peak A in the samples were consistent. Preliminary speculation suggests that dammarene diol was synthesized in the leaves of tobacco and Dipsacus asper, which were infected with the target gene.

[0059] (6) LC-MS detection of tobacco and Dipsacus asper leaf extracts 3 days after infection To further confirm the substances detected by HPLC, an Agilent 1290 UPLC / 6540 Q-TOF liquid chromatography / mass spectrometry (LC / MS) system was used for detection, and the detection method is as follows: Mass spectrometry conditions: The ion source was in positive ion mode, voltage 3500V; fragmentation voltage: 135V; cone voltage: 65V; radio frequency voltage: 750V; scan range: 50-1700m / z.

[0060] Chromatographic conditions: ZORBAX SB-C18 column (4.6×250mm, 5μm), flow rate 1mL / min, column temperature 30℃, injection volume: 10μL for reference standard, 20μL for test sample. Mobile phase: 0.01% w / v formic acid aqueous solution (A), acetonitrile (B); gradient elution: 0~10min 30% A, 10~30min 10% A. Elution time 30min, detection wavelength 203nm.

[0061] LC-MS analysis was performed on tobacco and Dipsacus asperoides leaves infected with GV3101 / pEAQ-HT-DDS, and on leaves infected with GV3101 / pEAQ-HT three days later. The results are as follows: Figure 10 and Figure 11 As shown in the figure. It can be seen from the figure that the peak elution time of tobacco leaves infected with GV3101 / pEAQ-HT-DDS Agrobacterium ( Figure 10 D), Peak elution time in Dipsacus asperoides leaves ( Figure 10 C) and the peak elution time of standard dammarene glycol ( Figure 10 The results of E) were consistent, and no peak was observed in tobacco leaves infected with GV3101 / pEAQ-HT Agrobacterium. Figure 10 B) No peaks were observed in the leaves of *Dipsacus asper*. Figure 10 A). Extraction of characteristic peaks from tobacco leaves infected with Agrobacterium GV3101 / pEAQ-HT-DDS ( Figure 11 A) Characteristic peaks of *Dipsacus asper* leaves ( Figure 11 B), Dammarene glycol reference standard has a molecular weight of 445, which is 446 in positive ion mode ([M+H)). + ), plus a Na + The molecular weight then becomes 469 ([M+H)). + In LC-MS analysis, when the molecular weight was 469, the following was obtained: Figure 11 A and Figure 11 B. Further speculation suggests that the product generated is dammarene diol. This result indicates that dammarene diol is synthesized in tobacco and Dipsacus asper leaves after transient expression of dammarene diol synthase (DDS) for 3 days, a product that is not present in tobacco and Dipsacus asper leaves.

[0062] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A method for preparing dammarene glycol from *Nicotiana benthamiana* and *Dipsacus asper*, characterized in that, Includes the following steps: The target gene was inserted into a transient expression vector to obtain a recombinant target gene transient expression vector plasmid; the target gene is shown in SEQ ID NO.1; The recombinant target gene transient expression vector plasmid was transformed into Escherichia coli DH5α competent cells, positive single colonies were screened, and then transformed into Agrobacterium GV3101 competent cells to obtain GV3101 / recombinant target gene transient expression vector plasmid Agrobacterium. Using leaves from seedlings of Nicotiana benthamiana or Dipsacus asperoides as materials, Agrobacterium tumefaciens was inoculated with GV3101 / recombinant target gene transient expression vector plasmid and cultured. Dammarene diol was then extracted from the cultured plant leaves.

2. The method for preparing dammarene glycol from *Tobacco Benzoica* and *Dipsacus asper* according to claim 1, characterized in that, The transient expression vector is pEAQ-HT.

3. The method for preparing dammarene glycol from *Tobacco Benzoinus* and *Dipsacus asper* as described in claim 1 or 2, characterized in that: The DDS gene from Panax notoginseng was homologously recombined with the transient expression vector pEAQ-HT to obtain the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS; it was transformed into Escherichia coli DH5α competent cells, positive single colonies were screened, and then transformed into Agrobacterium GV3101 competent cells to obtain GV3101 / pEAQ-HT-DDS Agrobacterium.

4. The method for preparing dammarene glycol from *Tobacco Benzoica* and *Dipsacus asper* according to claim 3, characterized in that, Includes the following steps: Step (1): Use DDS primers to perform PCR amplification on the DDS gene, and use the amplification product as the target fragment. The primer pair includes upstream primer DDS-1F and downstream primer DDS-1R, with the following sequences: Upstream primer DDS-1F: ctgcccaaattcgcgaccggtatgtggaagctgaaggttg; Downstream primer DDS-1R: tgaaaccagagttaaaggcctcgagttaaattttgagctgctggtgc; Step (2): The transient expression vector pEAQ-HT was double-digested to obtain the linearized transient expression vector pEAQ-HT; Step (3): The target fragment and the linearized transient expression vector pEAQ-HT are ligated to obtain the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS; then the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS is transformed into E. coLi DH5α competent cells, positive single colonies are screened, and then transformed into Agrobacterium GV3101 to obtain GV3101 / pEAQ-HT-DDS Agrobacterium.

5. The method for preparing dammarene glycol from *Tobacco Benzoinus* and *Dipsacus asper* according to claim 3, characterized in that: Leaves of Tobacco Benzovia seedlings or Dipsacus asperoides seedlings were used as materials to infect the plants with Agrobacterium tumefaciens GV3101 / pEAQ-HT-DDS bacterial solution and cultured. Dammarene diol was extracted from the plant leaves after 3 days of culture.

6. The method for preparing dammarene glycol from *Tobacco Benzoica* and *Dipsacus asper* according to claim 5, characterized in that, Leaf samples from *Nicotiana benthamiana* seedlings were used as material to infect the samples with *Agrobacterium tumefaciens* GV3101 / pEAQ-HT-DDS bacterial suspension and cultured. The specific method was as follows: Leaf samples from *Nicotiana benthamiana* seedlings were used as material. *Agrobacterium tumefaciens* culture solution (GV3101 / pEAQ-HT-DDS) was permeated under high pressure and vacuum at 0.08 MPa for 3 minutes. The samples were then cultured in an incubator at 25°C in darkness for 24 hours. The incubator conditions were then adjusted to 23°C for 16 hours during the day, 16°C for 8 hours at night, 75% relative humidity, and 5000 Lux light intensity for 3 days. The expression level of dammarene diol in *Nicotiana benthamiana* seedlings was then measured.

7. The method for preparing dammarene glycol from *Tobacco Benzoica* and *Dipsacus asper* according to claim 5, characterized in that, Leaf samples from *Dipsacus asper* seedlings were used as material, and *Agrobacterium tumefaciens* GV3101 / pEAQ-HT-DDS bacterial suspension was inoculated and cultured. The specific method is as follows: Using leaves from *Dipsacus asper* seedlings as material, Silwet L-77 surfactant was added to GV3101 / pEAQ-HT-DDS *Agrobacterium* bacterial suspension to a final concentration of 0.02% v / v, followed by high-pressure vacuum permeation at a pressure of 0.08 MPa for 3 minutes. After incubation at 25°C in darkness for 24 hours, the incubator conditions were adjusted to 23°C for 16 hours during the day, 16°C for 8 hours at night, 75% relative humidity, and 5000 Lux light intensity for 3 days. The expression level of dammarene diol in *Dipsacus asper* seedlings was then detected.

8. A recombinant plasmid for constructing transient expression of the DDS gene in *Nicotiana benthamiana* and *Dipsacus asper*, characterized in that, The recombinant plasmid is the recombinant DDS gene transient expression vector plasmid pEAQ-HT-DDS as described in claim 3.

9. Used to construct transient expression in *Nicotiana benthamiana* and *Dipsacus asper*. DDS Transgenic engineered bacteria, characterized by: The genetically engineered bacteria described herein contain the recombinant plasmid as described in claim 8.

10. The method for constructing transient expression in *Nicotiana benthamiana* and *Dipsacus asper* according to claim 9. DDS Transgenic engineered bacteria, characterized by: The genetically engineered bacteria is Escherichia coli DH5α.

Images