Molecular marker for identifying excellent haplotype of corn ZmTAR4 gene and application of molecular marker

By designing dCAPS molecular markers, superior haplotypes of the maize ZmTAR4 gene were identified using PCR and enzyme digestion techniques, solving the problem of low identification efficiency in existing technologies and achieving efficient screening and breeding progress.

CN121826207APending Publication Date: 2026-04-10SICHUAN AGRI UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-15
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

The lack of high-throughput, low-cost molecular markers in existing technologies for identifying superior haplotypes of the maize ZmTAR4 gene affects the efficiency of maize genetic transformation.

Method used

We developed dCAPS molecular markers based on functional variations of the ZmTAR4 gene, created XbaI restriction sites using mismatched bases in primer design, and identified superior haplotypes of the ZmTAR4 gene by PCR and restriction endonuclease digestion.

Benefits of technology

This enabled rapid and accurate screening of maize germplasm with high callus induction potential, improving breeding selection efficiency and genetic transformation efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121826207A_ABST
    Figure CN121826207A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular marker for identifying an excellent haplotype of a corn ZmTAR4 gene and application of the molecular marker, and belongs to the technical field of plant molecular breeding and genetic detection. Specifically, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, and a G / A polymorphic site exists at the 29bp position of the sequence. The invention further develops a primer pair for detecting the molecular marker, a detection product containing the primer pair is prepared, PCR amplification is carried out on corn genome DNA through the primer pair to obtain an amplification product, the amplification product is subjected to enzyme digestion through restriction enzyme, and the excellent haplotypes of the corn ZmTAR4 gene are distinguished according to the obtained enzyme digestion product. The molecular marker is reasonable in design, simple and convenient to operate and accurate in interpretation, is suitable for corn germplasm resource evaluation and molecular marker-assisted breeding, and has important application value in breeding practice for improving corn genetic transformation efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant molecular breeding and genetic detection, and particularly relates to a molecular marker for identifying an excellent haplotype of a ZmTAR4 gene of corn and application thereof. BACKGROUND

[0002] Corn genetic transformation technology is the core of modern biotechnology breeding, but its efficiency is deeply affected by the genotype of the receptor, mainly manifested as a huge difference in embryogenic callus (EC) induction rate among different materials. Therefore, quickly and accurately identifying and screening corn germplasm with high callus induction potential is the key to breaking through the bottleneck of transformation technology and promoting the breeding process.

[0003] Based on the development of molecular markers co-segregated with functional genes, it is an effective way to realize accurate and efficient molecular breeding of corn genetic transformation traits. Existing studies have shown that the key gene ZmTAR4 of corn encodes a protein with tryptophan amino transferase activity, and its expression level positively regulates the endogenous IAA content in corn young embryos and the EC induction rate. However, at present, there is still a blank in the development of high-throughput, low-cost, and practical molecular markers suitable for conventional breeding laboratories for the above-mentioned key SNP sites with clear functions. SUMMARY

[0004] The purpose of the present application is to provide a molecular marker for identifying an excellent haplotype of a ZmTAR4 gene of corn and application thereof, so as to solve the problems existing in the prior art. The molecular marker described in the present application is perfectly co-segregated with the functional variation of the ZmTAR4 gene, has the advantages of accurate detection and simple operation, and can be used for rapid screening of corn germplasm with high callus induction potential.

[0005] To achieve the above purpose, the present application provides the following solutions:

[0006] In a first aspect, the present application provides a dCAPS molecular marker for identifying an excellent haplotype of a ZmTAR4 gene of corn, the nucleotide sequence of the dCAPS molecular marker is shown in SEQ ID NO. 1, and there is a G / A polymorphic site at the 29th bp of the sequence.

[0007] In a second aspect, the present application further provides a primer pair for identifying the dCAPS molecular marker, the primer pair comprises an upstream primer with a nucleotide sequence shown in SEQ ID NO. 3 and a downstream primer with a nucleotide sequence shown in SEQ ID NO. 4.

[0008] In a third aspect, the present application further provides an application of the primer pair in the preparation of a product for identifying an excellent haplotype of a ZmTAR4 gene of corn.

[0009] In a fourth aspect, the present application further provides a product for identifying the excellent haplotype of the ZmTAR4 gene of Zea mays, wherein the product comprises the primer pair.

[0010] In a fifth aspect, the present application further provides an application of the dCAPS molecular marker, the primer pair or the product in any of the following:

[0011] (1) identifying the haplotype of the ZmTAR4 gene of Zea mays;

[0012] (2) screening the excellent haplotype of the ZmTAR4 gene of Zea mays;

[0013] (3) cultivating a Zea mays variety with high IAA content;

[0014] (4) cultivating a Zea mays variety with high embryogenic callus induction rate;

[0015] (5) screening a Zea mays variety with high IAA content and high embryogenic callus induction rate.

[0016] In a sixth aspect, the present application further provides a method for identifying the excellent haplotype of the ZmTAR4 gene of Zea mays, comprising the following steps:

[0017] PCR amplification is performed on the genomic DNA of the variety to be tested using the primer pair to obtain an amplification product; the amplification product is digested using a restriction enzyme XbaI, and the excellent haplotype of the ZmTAR4 gene of Zea mays is identified according to the digestion product.

[0018] Preferably, if both 245bp and 274bp bands appear after digestion, or only the 245bp band appears, it is determined as HapG type;

[0019] If only the 274bp band appears after digestion, it is determined as HapA type;

[0020] The IAA content of the immature embryo of the HapG haplotype Zea mays variety is significantly higher than that of the HapA haplotype Zea mays variety.

[0021] Preferably, the PCR amplification reaction program is as follows: 94℃ for 5min; 94℃ for 30s, 60℃ for 30s, 72℃ for 30s, 35 cycles; and 72℃ for 5min.

[0022] Preferably, the PCR amplification reaction system is as follows: 2×Taq PCR Master Mix 10μL, 10μM of the forward and reverse primers each 0.8μL, template DNA (50ng / μL) 1μL, and ddH2O up to 20μL.

[0023] In a seventh aspect, the present application also provides a method for screening corn germplasm resources with high IAA content and high embryogenic callus induction rate, using the genomic DNA of a to-be-tested variety as a template, performing PCR amplification using the primer pair, and obtaining an amplification product; performing enzyme digestion on the amplification product using a restriction enzyme XbaI, and identifying the excellent haplotype of the corn ZmTAR4 gene according to the enzyme digestion product;

[0024] If the 245bp and 274bp bands appear simultaneously after enzyme digestion, or only the 245bp band appears, it is determined as HapG type;

[0025] If only the 274bp band appears after enzyme digestion, it is determined as HapA type;

[0026] The corn variety with the haplotype of HapA type is eliminated, and the corn variety with the haplotype of HapG type is selected as a germplasm resource

[0027] The present application discloses the following technical effects:

[0028] 1. Clear function: the molecular marker described in the present application is developed based on a verified functional SNP, is highly co-segregated with a target phenotype (high IAA content and high EC induction rate), and has strong prediction accuracy.

[0029] 2. Strong practicability: the dCAPS technology adopted only needs a conventional PCR instrument, an electrophoresis device and a common endonuclease, has low cost, is simple to operate, and is suitable for large-scale popularization and application.

[0030] 3. High throughput: in combination with a 96-well plate or an automatic system, high-throughput genotype screening of a breeding population or a germplasm resource library can be realized, and the selection efficiency is greatly improved.

[0031] 4. Direct application: the present application directly converts a basic research achievement into a practical tool, and provides a key tool for directional improvement of corn genetic transformation characteristics through molecular marker assisted selection (MAS).

[0032] The present application aims to provide a molecular marker for identifying an excellent haplotype of a corn ZmTAR4 gene, a detection method and application thereof, and identifies an SNP site (chr3:206,034,247, G / A) related to the excellent haplotype of the corn ZmTAR4 gene, wherein the G allele (HapG haplotype) is significantly related to higher gene expression, IAA content and EC induction rate. The molecular marker is reasonable in design, simple in operation, accurate in reading, suitable for corn germplasm resource evaluation and molecular marker assisted breeding, and has important application value for improving the breeding practice of corn genetic transformation efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present application or in the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings described below only show some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from these drawings without any creative effort.

[0034] Figure 1 For identification of ZmTAR4 and candidate gene association analysis; wherein, A is the correlation analysis of IAA content and REC of 50 inbred lines of young embryos and callus, B-C is the significant SNP identified by correlation analysis of IAA content in young embryos (B) and callus cultured for 10d (C), D is the hierarchical clustering tree of weighted co-expression network analysis, E is the correlation analysis of blue module and IAA content, the upper number in the color block is the correlation coefficient, and the number in the lower bracket is the significance p value, F is the expression pattern of genes in samples in the blue module, G is the 20 biological process classifications enriched by genes in the blue module, H is the co-expression network of the core gene ZmTAR4 in the blue module, I is the candidate gene association analysis of ZmTAR4, the significant threshold is the red dotted line, the middle is the gene structure, the exons are blue blocks, and the bottom is the linkage disequilibrium block between gene markers, J is the comparison of IAA content between two haplotypes, **P<0.01;

[0035] Figure 2 For dCAPS molecular marker design principle and result interpretation schematic diagram; wherein, A is a schematic diagram of sequence comparison of SNP site corresponding haplotypes (HapG and HapA), B is a schematic diagram of dCAPS molecular marker detection primer design principle, showing that a mismatch base (green letter) is introduced in the forward primer to create an XbaI enzyme cutting site (TCTAGA), C is an expected electrophoresis result diagram, HapG type material (lanes 4, 5, 6) produces two bands of 245bp and 274bp after incomplete enzyme cutting, and HapA type material (lanes 1, 2, 3) has no 245bp band after enzyme cutting;

[0036] Figure 3 For verification result diagram; wherein, A is an electrophoresis result diagram, Marker: DNA molecular weight standard, Hap(G): known HapG type material, showing two bands of 245bp and 274bp after incomplete enzyme cutting, Hap(A): known HapA type material, no 245bp band after enzyme cutting, B is the embryogenic callus induction rate corresponding to different haplotype materials. DETAILED DESCRIPTION

[0037] The various exemplary embodiments of the present application will now be described in detail below, which should not be considered as limiting the present application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present application.

[0038] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of, for example, a parameter, an individual value or subrange within that range is also specifically disclosed. Each of the smaller ranges is also individually and specifically disclosed. The upper and lower limits of these smaller ranges can independently be included or excluded in the range, and are also endpoints of the range, subject to any specifically excluded endpoint. All ranges disclosed herein are also individually and specifically disclosed.

[0039] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in detail the methods and / or materials which are related to the present application. In the case of conflict between the present specification and any document incorporated herein by reference, the present specification will control.

[0040] Many modifications and variations of the present application described herein can be made without departing from the spirit or scope of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. Various embodiments of the application are purely exemplary and are presented for purposes of illustration only.

[0041] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having" or the like are open-ended terms that are intended to mean including, but not limited to.

[0042] The corresponding nucleotide sequence of SEQ ID NO. 1 is as follows:

[0043] TCGTCAAAATTGATTGATTTTTCGTCGG G AAAAGAAACATCAACAGACCAGCTTACGTTC T TTTAATTTGCGTGCTGGATACATGTAACCGGAAATACGTGCA C ATACAAGTCGCTGTAAACCAATCATCGGCGTTCCTTGCAGGGCTGGATCAATTAGC G CCGGTCTCTAACCTTGCGGGTCGGATTTGTTAGTTCATGACGAGAAAC A AAG T TA T ACCACGTTGTTGAA TATCGAACGGTGATGGAGT A TTAGAGTTGCTCGCAGGAAAAAC;

[0044] The corresponding nucleotide sequence of SEQ ID NO. 2 is as follows:

[0045] TCGTCAAAATTGATTGATTTTTCGTCGG A AAAAGAAACATCAACAGACCAGCTTACGTTC C TTTAATTTGCGTGCTGGATACATGTAACCGGAAATACGTGCA G ATACAAGTCGCTGTAAACCAATCATCGGCGTTCCTTGCAGGGCTGGATCAATTAGC A CCGGTCTCTAACCTTGCGGGTCGGATTTGTTAGTTCATGACGAGAAAC G AAG C TA C ACCACGTTGTTGAA C ATCGAACGGTGATGGAGT G TTAGAGTTGCTCGCAGGAAAAAC;

[0046] Among them, the underlined positions in SEQ ID NO. 1 and SEQ ID NO. 2 are difference SNP sites, and the first underlined position in the sequence is the difference SNP site selected for subsequent experiments of the application. The dCAPS molecular marker is a marker technology based on single base mutation by introducing mismatched bases in the primer, thereby creating or destroying the restriction enzyme cutting site in the PCR product, thereby realizing the detection of the target site. Due to the introduction of mismatched bases in the primer, the XbaI enzyme cutting site, i.e. TCTAGA, exists in the ZmTAR4 gene excellent haplotype material HapG, which can be cut by XbaI enzyme, while the non-excellent haplotype material HapA does not have the XbaI enzyme cutting site and cannot be cut by XbaI enzyme. Therefore, the first underlined position in SEQ ID NO. 1 and SEQ ID NO. 2 is selected as the difference SNP site for subsequent research of the application.

[0047] Example 1 Development of dCAPS molecular marker for identifying excellent haplotype of ZmTAR4 gene of maize

[0048] 1. Phenotype association analysis and whole genome association analysis

[0049] Fifty inbred lines were randomly selected from 330 maize natural variant populations. The IAA content in their immature embryos and callus induced for 10 days was measured, and correlation analysis was performed between IAA content and embryogenic callus induction rate (REC). The results showed a highly significant positive correlation between IAA content and REC (IAA_0d in immature embryos: r=0.681; IAA_10d in callus: r=0.742; p<0.001). Figure 1 (IAA), confirming that IAA content can be used as a reliable indicator for screening materials with high induction rate.

[0050] Based on this, IAA content was determined in the entire population (n=330) of immature embryos, and GWAS analysis was performed using a mixed linear model (MLM) based on 1,004,950 SNP markers covering the entire genome. In the immature embryo stage (IAA_0d), 83 significantly associated SNP loci were identified (p<2.17E-05), which could explain 3.31%–13.42% of the phenotypic variation. The loci with the strongest association signals were concentrated on chromosome 3. Figure 1 (Chinese BC).

[0051] 2. Weighted Gene Co-expression Network Analysis (WGCNA) to Identify Candidate Gene Modules

[0052] Transcriptome data from the integrated population during callus induction were analyzed. Weighted co-expression network analysis (WGCNA) was performed on 837 genes located within all significantly associated SNP linkage disequilibrium (LD) regions and differentially expressed during induction. Five characteristic modules were obtained, among which the "blue" module (containing 154 genes) showed a highly significant negative correlation with IAA_0d content (module-trait correlation coefficient r = -0.69, p = 5e-08). Figure 1 DF). GO enrichment analysis showed that the genes in this module were significantly enriched in auxin-related biological processes such as "auxin-activated signaling pathways" and "cellular responses to auxin stimulation". Figure 1 Network analysis revealed that the gene Zm00001d043651, encoding tryptophan aminotransferase (homologically related to Arabidopsis thaliana AtTAA1), is located at the core node of this module, thus identifying it as a key candidate gene and naming it ZmTAR4. Figure 1 (H).

[0053] 3. Candidate gene association analysis to identify major-effect SNPs in promoter regions

[0054] To further refine the localization, 75 inbred lines were randomly selected from the population, and the coding region and upstream 2000 bp promoter region of the ZmTAR4 gene were resequencing. Association analysis between intragenic variation and phenotype was performed using TASSEL 5.0 software (GLM+PCA model, p≤0.01). The results showed that a SNP (S3_206034247, G / A) located 301 bp upstream of the start codon ATG was highly significantly associated with the IAA_0d content in immature embryos. Figure 1 The difference between the sequence information shown in SEQ ID NO.1 and the sequence information shown in SEQ ID NO.2 is that the bases at position 29 are G and A, respectively. Figure 2 (Middle A). Based on this locus, the materials were divided into two haplotypes: HapG type (43 copies) carrying the G allele and HapA type (32 copies) carrying the A allele. Phenotypic comparison confirmed that the IAA content in the immature embryos of HapG type materials was significantly higher than that of HapA type materials (p<0.01). Figure 1 (J), which directly reveals that the SNP site in this promoter region is a key natural variation that regulates ZmTAR4 expression and IAA synthesis.

[0055] Thus, the present invention obtained a dCAPS molecular marker closely linked to the identification of superior haplotypes of the maize ZmTAR4 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0056] 4. Design of dCAPS molecular marker-specific primers

[0057] Primer design principles such as Figure 2 As shown in Figure B. Primers were designed using the dCAPS Finder 2.0 online software for the identified key functional SNP site in the ZmTAR4 promoter region (S3_206034247, G / A, sequence shown in SEQ ID NO.1 or SEQ ID NO.2). By introducing two base mismatches into the forward primer, an XbaI restriction site (TCTAGA) was formed in the PCR product when DNA carrying the G allele was used as a template. The primer sequences are as follows:

[0058] dCAPS-F: 5'-TCGTCAAAATTGATTGATTTTTCGTCTA-3' (SEQ ID NO. 3);

[0059] dCAPS-R: 5'-GTTTTTCCTGCGAGCAACTCTA-3' (SEQ ID NO. 4).

[0060] The dCAPS molecular marker and specific primer pair designed above for identifying superior haplotypes of the maize ZmTAR4 gene were expected to amplify a 274 bp fragment in maize genomic DNA. When the superior haplotype HapG was completely digested with the restriction endonuclease XbaI, a 245 bp fragment was produced (the other 29 bp band was too small to be visible during electrophoresis). Incomplete digestion produced two fragments, 245 bp and 274 bp. The non-superior haplotype HapA, after digestion with the restriction endonuclease XbaI, did not produce a 245 bp fragment, only a 274 bp fragment. Figure 2 (C)

[0061] Example 2: Validation of dCAPS molecular markers for identifying superior haplotypes of the maize ZmTAR4 gene

[0062] Materials: Ten maize inbred lines with ZmTAR4 haplotypes identified by sequencing were selected.

[0063] PCR reaction: Genomic DNA was extracted from each material. A 20 μL reaction mixture was used: 10 μL 2×Taq PCR Master Mix, 0.8 μL each of 10 μM forward and reverse primers, 1 μL template DNA (50 ng / μL), and the remainder was made up with ddH2O. PCR program: 94℃ for 5 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min.

[0064] Enzyme digestion reaction: Take 8 μL of PCR product, add 1 μL of XbaI endonuclease (10 U / μL) and 1 μL of 10× Buffer, and digest in a water bath at 37℃ for 15 minutes.

[0065] Electrophoresis detection: The enzyme digestion products were electrophoresed in a 3% agarose gel, stained with ethidium bromide, and observed and photographed under a UV gel imaging system.

[0066] Result: As Figure 3 As shown, the enzyme digestion products of all HapG type materials exhibited clear bands at approximately 245bp and 274bp, perfectly consistent with expectations; while the enzyme digestion products of all HapA type materials showed no 245bp band, retaining only the 274bp band. Furthermore, embryogenic callus induction rate (REC) was measured for the two haplotypes identified above. The results showed that the REC of the HapG haplotype materials was significantly higher than that of the HapA haplotype materials. These results demonstrate that the dCAPS molecular marker developed in this invention can accurately and stably distinguish the two key haplotypes of the ZmTAR4 gene, and that the HapG haplotype materials exhibit a higher REC, which is of positive significance for screening superior maize varietal resources.

[0067] The dCAPS marker developed in this invention is based on key SNPs with well-defined functions and can accurately and stably distinguish between the two haplotypes (HapG and HapA) of the ZmTAR4 gene. This molecular marker is simple to operate, requiring only routine PCR and enzyme digestion, and is inexpensive. It is highly suitable for high-throughput genotyping in maize breeding populations or germplasm banks to rapidly identify individuals carrying the superior allele (HapG).

[0068] In practical breeding, this molecular marker can be used to perform whole-population testing on target populations (such as F2 segregating populations, backcross populations, or varietal resources). By screening and aggregating HapG alleles, it is possible to assist in the breeding of new maize materials with higher endogenous auxin potential and higher embryogenic callus induction rate, thus providing an efficient molecular tool for breeding genetically transformation-friendly superior inbred lines.

[0069] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A dCAPS molecular marker for identifying superior haplotypes of the maize ZmTAR4 gene, characterized in that, The nucleotide sequence of the dCAPS molecular marker is shown in SEQ ID NO.1, and a G / A polymorphism site exists at position 29 bp of the sequence.

2. A primer pair for identifying the dCAPS molecular marker of claim 1, characterized in that, The primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

4.

3. The use of the primer pair according to claim 2 in the preparation of products for identifying superior haplotypes of the maize ZmTAR4 gene.

4. A product for identifying superior haplotypes of the ZmTAR4 gene in maize, characterized in that, The product includes the primer pair as described in claim 2.

5. The use of the dCAPS molecular marker of claim 1, the primer pair of claim 2, or the product of claim 4 in any of the following: (1) Identify the haplotype of the maize ZmTAR4 gene; (2) Screening for superior haplotypes of the maize ZmTAR4 gene; (3) Develop maize varieties with high IAA content; (4) Develop maize varieties with high embryogenic callus induction rate; (5) Screen maize varieties with high IAA content and high embryogenic callus induction rate.

6. A method for identifying superior haplotypes of the maize ZmTAR4 gene, characterized in that, Includes the following steps: Using the genomic DNA of the variety to be tested as a template, PCR amplification was performed using the primer pair described in claim 2 to obtain the amplification product; the amplification product was digested with the restriction endonuclease XbaI, and the superior haplotype of the maize ZmTAR4 gene was identified based on the digestion product.

7. The method according to claim 6, characterized in that, If both 245bp and 274bp bands appear after enzyme digestion, or only a 245bp band appears, it is determined to be of the HapG type. If only a 274bp band appears after enzyme digestion, it is identified as HapA type; The IAA content in the embryos of the HapG haplotype maize variety was significantly higher than that in the embryos of the HapA haplotype maize variety.

8. The method according to claim 6, characterized in that, The PCR amplification reaction program was as follows: 94℃ for 5 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min.

9. The method according to claim 6, characterized in that, The PCR amplification reaction system consisted of: 10 μL of 2×Taq PCRMaster Mix, 0.8 μL each of 10 μM forward and reverse primers, 1 μL of template DNA, and ddH2O to a final volume of 20 μL.

10. A method for screening maize germplasm resources with high IAA content and high embryogenic callus induction rate, characterized in that, Using the genomic DNA of the variety to be tested as a template, PCR amplification was performed using the primer pair described in claim 2 to obtain the amplification product; the amplification product was digested with restriction endonuclease XbaI, and the superior haplotype of the maize ZmTAR4 gene was identified based on the digestion product. If both 245bp and 274bp bands appear after enzyme digestion, or only a 245bp band appears, it is determined to be of the HapG type. If only a 274bp band appears after enzyme digestion, it is identified as HapA type; Maize varieties with the HapA haplotype were phased out, and maize varieties with the HapG haplotype were selected as germplasm resources.