Nucleic acid detection method, reagent and kit

Abstract

The invention provides a method, a reagent and a kit capable of simultaneously and efficiently detecting rs10490924 and rs800292 alleles of nucleic acid in a sample. The method comprises the following detection procedures: simultaneously amplifying and detecting a nucleic acid region containing rs10490924 and rs800292 in the same system, in the detection step, a first nucleic acid probe and a second nucleic acid probe which respectively hybridize to regions including a G allele and a T allele of rs10490924, and a third nucleic acid probe and a fourth nucleic acid probe which respectively hybridize to regions including an A allele and a G allele of rs800292 are used, said first nucleic acid probe and the second nucleic acid probe having the following characteristics (1)-(3): (1) the probe length is 8-29 mer; (2) the number of the artificial nucleic acids is 1-12; and (3) one end region has a fluorophore, and the other end region has a quencher.

Description

TECHNICAL FIELD

[0001] The present application relates to a method for detecting a single nucleotide polymorphism associated with age-related macular degeneration, and a reagent and a kit for detecting the same. BACKGROUND

[0002] Age-related macular degeneration (hereinafter referred to as AMD) is a neurodegenerative disease in which the macula of the retina in the center of the fundus is denatured and blood vessels are newly formed, resulting in symptoms such as a decrease in visual acuity, a central scotoma, metamorphopsia, and the like, due to factors such as aging, smoking, and heredity. The number of patients with AMD is increasing year by year. As a representative treatment method for AMD, for example, the administration of a VEGF inhibitor is known, but the VEGF inhibitor is expensive and needs to be administered continuously, and thus the economic and physical burden on the patient is large. In addition, it is also known that excessive administration of the agent can cause retinal atrophy, resulting in a decrease in visual acuity.

[0003] It has been reported that a plurality of single nucleotide polymorphisms (SNPs) of genes are involved in the onset of AMD. A plurality of SNPs are disclosed in Patent Literature 1 and Patent Literature 2 as markers for evaluating the susceptibility to AMD. As SNPs that are common in AMD patients in Japan, the SNP of the ARMS2 gene (rs10490924) and the SNP of the CFH gene (rs800292) are known (Non-Patent Literature 1), and reagents for detecting each of the SNPs in nucleic acids purified from a sample are also commercially available.

[0004] PRIOR ART DOCUMENTS

[0005] PATENT LITERATURE

[0006] Patent Literature 1: Japanese Patent Application Laid-Open No. 2008-545438

[0007] Patent Literature 2: Japanese Patent Application Laid-Open No. 2011-135838

[0008] NON-PATENT LITERATURE

[0009] Non-Patent Literature 1: A. Goto, et al., J. Ocul. Biol. Dis. Inform., (2009) Vol. 2, pp. 164-175 SUMMARY

[0010] As mentioned above, reagents are available for the individual detection of SNPs associated with AMD. Compared to using the individual test results of each SNP, combining the detection of multiple SNPs that are more strongly associated with AMD disease holds promise for achieving a more sensitive and accurate assessment of AMD susceptibility. However, to date, a testing system capable of simultaneously and stably detecting multiple SNPs associated with AMD has not yet been established.

[0011] The purpose of this invention is to provide a method, reagent, and kit for the simultaneous and efficient detection of the alleles of rs10490924 and rs800292, nucleic acids in a sample, which are susceptibility markers for AMD, which are common in Asians.

[0012] The present invention provides the following solution.

[0013] [1] A method for detecting single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292 in nucleic acids of a sample, comprising: a detection step of simultaneously amplifying and detecting nucleic acid regions containing each SNP in the same system.

[0014] In the above detection process, the first and second nucleic acid probes, which have the following characteristics (1) to (3), hybridize with the regions containing the G allele and T allele of rs10490924, respectively, and the third and fourth nucleic acid probes, which hybridize with the regions containing the A allele and G allele of rs800292, respectively, are used.

[0015] (1) The probe length is 8–29 mer;

[0016] (2) The number of artificial nucleic acids is 1 to 12; and

[0017] (3) One end region has a fluorescent group and the other end region has a quenching group.

[0018] [2] According to the method described in [1], in the above detection step, multiplex PCR is performed using a first primer set and a second primer set, wherein the first primer set is used to amplify the ARMS2 gene or a fragment containing s10490924, and the second primer set is used to amplify the complement factor H (CFH) gene or a fragment containing rs800292.

[0019] [3] According to the method described in [1] or [2], wherein the artificial nucleic acid is locked nucleic acid (LNA).

[0020] [4] According to the method described in [3], wherein, in the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe and the fourth nucleic acid probe, at least one of the bases adjacent to the binding site of the SNP of the target is an LNA.

[0021] [5] The method according to any one of [1] to [4], wherein the above-mentioned sample is a blood sample, saliva, oral mucosal swab, tissue sample or other body fluid sample.

[0022] [6] The method according to any one of [1] to [5], wherein the sample is saliva or oral mucosal swab, excluding the nucleic acid purification step, and includes the step of amplifying and detecting multiple SNPs containing rs10490924 and rs800292.

[0023] [7] A reagent or kit for detecting single nucleotide polymorphisms (SNPs) of rs800292 and rs10490924, comprising:

[0024] The first primer set is used to amplify the ARMS2 gene or its fragment containing rs10490924;

[0025] The second primer set is used to amplify the CFH gene or a fragment containing rs800292; and

[0026] The first and second nucleic acid probes, which have the following characteristics (1) to (3), hybridize with regions containing the G allele and T allele of rs10490924, respectively, and the third and fourth nucleic acid probes, which hybridize with regions containing the A allele and G allele of rs800292, respectively.

[0027] (1) The probe length is 8–29 mer;

[0028] (2) The number of artificial nucleic acids is 1 to 12; and

[0029] (3) One end region has a fluorescent group and the other end region has a quenching group.

[0030] [8] The reagent or kit according to [7], wherein a first primer set, a second primer set, a first nucleic acid probe, a second nucleic acid probe, a third nucleic acid probe and a fourth nucleic acid probe are contained in the same container, suitable for multiplex PCR.

[0031] [9] The reagent or kit according to [7] or [8], wherein the artificial nucleic acid is LNA.

[0032]

[10] The reagent or kit according to any one of [7] to [9] is used to detect the SNPs rs800292 and rs10490924 of nucleic acids in a sample.

[0033]

[11] According to the reagent or kit described in

[10] , wherein the above-mentioned sample is a blood sample, saliva, oral mucosal swab, tissue sample or other body fluid sample.

[0034]

[12] The reagent or kit according to any one of [9] to

[11] , wherein, in the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe and the fourth nucleic acid probe, at least one of the bases adjacent to the binding site of the SNP of the target is an LNA.

[0035] This specification contains the disclosure of Japanese Patent Application No. 2023-149783, which forms the basis of the priority claim of this application.

[0036] According to the present invention, a method and reagents can be provided for simultaneously and efficiently detecting the alleles of rs10490924 and rs800292 of nucleic acids in a sample. Attached Figure Description

[0037] Figure 1 This is a table showing the relationship between the base length and LNA number of the first nucleic acid probe of the present invention and its usability.

[0038] Figure 2 This is a table showing the relationship between the base length and LNA number of the second nucleic acid probe of the present invention and its usability.

[0039] Figure 3 This is a table showing the relationship between the base length and LNA number of the third nucleic acid probe of the present invention and its usability.

[0040] Figure 4 This is a table showing the relationship between the base length and LNA number of the fourth nucleic acid probe of the present invention and its usability.

[0041] Figure 5-1 This is a graph showing the SNP detection results of the purified DNA fragment in Example 1. The numbers in the graph represent Cq values.

[0042] Figure 5-2 This is a continuation of Figure 5-1.

[0043] Figure 6 This is a graph showing the SNP detection results of the saliva sample from Example 2 based on multiplex PCR. The numbers in the graph represent Cq values.

[0044] Figure 7 This is a graph showing the SNP detection results of the saliva sample in Example 2 based on a commercially available SNP detection reagent. The numbers in the graph represent Cq values. Detailed Implementation

[0045] 1. Definition

[0046] The terms used in this specification are defined as follows: Unless otherwise specified, "%" indicating concentration refers to "weight %". Unless otherwise specified, "subject" refers to humans. "Sample" includes all samples containing nucleic acids suitable for genomic analysis. The term "nucleic acid" as used in this specification generally refers to terms including deoxyribonucleic acid (DNA) and ribonucleic acid (RNA); unless otherwise specified, it refers to DNA.

[0047] In this specification, "reagent" refers to a form consisting of a single component, such as a single composition contained in a single container. In this specification, "kit" refers to a form consisting of multiple components, such as multiple compositions contained in multiple containers. Hereinafter, unless specifically required to be described separately, "reagent" and "kit" will also be referred to as "reagent, etc."

[0048] In this specification, a single nucleotide polymorphism (SNP) refers to a mutation that differs by only one base among individuals of the same species, with a major allele present in most individuals and a minor allele present in a minority of individuals. Since human chromosomes are typically diploid, each SNP has two alleles. Therefore, individuals with major / major or minor / minor homozygotes and individuals with major / minor heterozygotes exist.

[0049] The rs number refers to the globally recognized SNP ID assigned by the NCBI (National Center for Biotechnology Information) in the United States to identify variants in the human genome.

[0050] In this specification, "rs10190924" refers to the SNP located at position 122454932 on human chromosome 10 (reference genome GRCh38.p14). rs10190924 is located at position 280 of the base sequence of the human AMD susceptibility locus 2 (ARMS2 gene) (Sequence No. 2 (NCBI reference sequence: NG_011725.1, Gene ID: 387715)), which corresponds to the amino acid substitution (A69S) at position 69 of the amino acid sequence of age-related macular degeneration susceptibility protein 2 (Sequence No. 5).

[0051] In this specification, "rs800292" refers to the SNP located at position 196673103 on human chromosome 1 (reference genome GRCh38.p14). rs800292 is located at position 21226 of the gene encoding human complement factor H (CFH) (NCBI reference sequence: NG_007259.1, GeneID: 3075). The base sequence from positions 20226 to 22225 of the CFH gene is represented by sequence number 4. The amino acid sequence of the CFH protein (UniProtKB / Swiss-Prot: P08603.4) is represented by sequence number 6. The SNP of rs800292 corresponds to the amino acid substitution (I62V) at position 62 of the amino acid sequence in sequence number 6.

[0052] 2. Detection methods for AMD-related SNPs

[0053] 2-1. Overview

[0054] The first embodiment of the present invention is a method for detecting single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292. The method of this embodiment is characterized in that it is a method for detecting single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292 in nucleic acids in a sample, comprising: a detection step, wherein nucleic acid regions containing each SNP are simultaneously amplified and detected in the same system; wherein the detection step uses a first nucleic acid probe and a second nucleic acid probe having the following characteristics (1) to (3) respectively hybridizing with regions containing the G allele and the T allele of rs10490924, and a third nucleic acid probe and a fourth nucleic acid probe respectively hybridizing with regions containing the A allele and the G allele of rs800292.

[0055] (1) The probe length is 8–29 mer;

[0056] (2) The number of artificial nucleic acids is 1 to 12; and

[0057] (3) One end region has a fluorescent group and the other end region has a quenching group.

[0058] The method described in this embodiment can more easily, rapidly, and accurately analyze the correlation between a subject and AMD by simultaneously amplifying and detecting two SNPs associated with AMD within the same system. The correlation with AMD referred to here is not limited; examples include the subject's risk of developing AMD and AMD treatment resistance.

[0059] 2-2. Sample

[0060] In this embodiment, the sample used as the test subject is preferably a sample taken from a human subject outside the body. Examples of "samples" include blood (whole blood, blood cell components, etc.), saliva, oral mucosal swabs, tissue samples, and other bodily fluid samples. In particular, blood samples (whole blood, blood cell components), saliva, and oral mucosal swabs, which readily contain the genomic nucleic acid of the target, are preferred. When using a blood sample, it is preferable to separate the blood sample into blood cell components and plasma components by centrifugation or the like, and then purify the nucleic acid after washing and lysing the blood cell components. Nucleic acid purification from blood cell components can be performed using commercially available kits such as the QIAamp DNA Blood Mini Kit (manufactured by QIAGEN), NucleoSpin Blood (manufactured by Takara Bio), and Blood Genomic DNA Isolation Mini Kit (manufactured by Norgen). When using saliva or oral mucosal swabs, lysis and nucleic acid purification can be performed in the same way as blood samples. However, since saliva and oral mucosal swabs contain lower types and amounts of components other than the target nucleic acid compared to blood cells, especially lower amounts of nucleases, they can be used for amplification and detection processes without undergoing lysis and purification.

[0061] 2-3. Multiplex PCR

[0062] This method requires the simultaneous amplification of two regions on the genome. The target region can be amplified using any of the following nucleic acid amplification methods: PCR, LAMP, SDA, etc. More specifically, multiplex PCR is used. The components required for multiplex PCR are described below.

[0063] 2-3-1. Primers

[0064] In this embodiment, a primer set for amplifying the region containing rs10490924 (hereinafter referred to as primer set 1) and a primer set for amplifying the region containing rs800292 (hereinafter referred to as primer set 2) are used simultaneously within the same system. Primer set 1 is preferably a primer set for amplifying the ARMS2 gene (serial number 1 or 2) or a fragment containing rs10490924. Primer set 2 is preferably a primer set for amplifying the CFH gene or a fragment containing rs800292 (e.g., serial number 3 or 4). The base sequences of the G allele (serial number 1) and T allele (serial number 2) of the ARMS2 gene, and the A allele (serial number 3) and G allele (serial number 4) of the CFH gene fragment are shown in Table 1. It should be noted that serial numbers 3 and 4 represent the fragment from position 20226 to position 22225 of the CFH gene. The base sequences listed in Table 1 also include intron sequences. Additionally, Table 2 shows the amino acid sequences of age-related macular degeneration susceptibility protein 2 (Sequence No. 5) and CFH (Sequence No. 6).

[0065] [Table 1]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071] [Table 2]

[0072]

[0073] The primer set for amplifying the ARMS2 gene or a fragment thereof is not particularly limited as long as it has a sequence capable of amplifying the region containing rs10490924; for example, it is preferably designed to amplify a region of about 40 to 1000 base pairs in length. For example, the following primer set can be used.

[0074] Forward primer: AAGCAGAGAGCAAACTGTC (Serial No. 7)

[0075] Reverse primer: GGCTGGTTAAAATGCAAGCTG (Serial No. 8)

[0076] The primer set for amplifying the CFH gene or its fragments is not particularly limited as long as it contains a sequence that amplifies the region containing rs800292, but it is preferably designed to amplify a region of approximately 40 to 1000 base pairs. For example, the following primer set can be used.

[0077] Forward primer: GCAATGAACTTCCTCCAAG (serial number 9)

[0078] Reverse primer: GGATTAAGAGCAACCCATTC (serial number 10)

[0079] As long as the primer set described above does not inhibit nucleic acid amplification or interfere with the labeling of the nucleic acid probe described later, it can bind to the labeling substance. In addition, it can also contain artificial nucleic acid.

[0080] 2-3-2. Nucleic acid probes

[0081] In this embodiment, at least four nucleic acid probes are used: an ARMS2 G allele detection probe (also referred to as "first nucleic acid probe" in this specification), an ARMS2 T allele detection probe (also referred to as "second nucleic acid probe" in this specification), a CFH A allele detection probe (also referred to as "third nucleic acid probe" in this specification), and a CFH G allele detection probe (also referred to as "fourth nucleic acid probe" in this specification). Each nucleic acid probe has the following characteristics.

[0082] (1) The probe length is 8–29 mer;

[0083] (2) The number of artificial nucleic acids is 1 to 12; and

[0084] (3) One end region has a fluorescent group and the other end region has a quenching group.

[0085] The inventors have discovered that by using nucleic acid probes with characteristics (1) to (3) in multiplex PCR, SNPs can be detected with high sensitivity and alleles can be identified with high precision. If the probe length is too short, the sensitivity decreases; if it is too long, alleles cannot be identified with high precision. In addition, whether there is too little or too much artificial nucleic acid (specifically, artificial nucleic acid with higher stability than usual), SNP detection and identification cannot be performed with high precision.

[0086] Each nucleic acid probe preferably has a binding site for the target SNP near its center. Therefore, in a preferred embodiment, the nucleic acid probe has a 3-14 mer nucleic acid sequence on each side of the SNP binding site. The nucleic acid probe has a fluorescent group at one end and a quenching group at the other end. Examples of fluorescent groups include FAM, FITC, Hex, VIC, Yakima Yellow, ROX, Texas Red, TEX615, Cy5, and Alexa Fluor 647. The quenching group uses a fluorescent dye that emits fluorescence at a wavelength that interferes with the fluorescence wavelength emitted by the fluorescent group. Thus, when the fluorescent group and the quenching group are close together, the signal of the fluorescent group is maintained in a state of interference. For example, when the fluorescent groups are ROX, Texas Red, TEX615, Cy5, or Alexa Fluor 647, BHQ2, IBRQ, SY-21, etc., can be used; when the fluorescent groups are FAM, FITC, Hex, VIC, or Yakima Yellow, BHQ1, TAMRA, IBFQ, TQ2, etc., can be used. There are no particular limitations on the types of fluorescent groups and quenchers, as long as the above relationship holds, and any known types can be used. However, when using four probes as in this embodiment, to avoid interference between the fluorescence signals of each fluorescent group and the fluorescence signals of other fluorescent groups, and to avoid overlapping fluorescence wavelengths, it is necessary to select fluorescent dyes. The quencher group bound to the nucleic acid probe does not need to be only one in the terminal region; additional quenchers can be bound outside the terminal region.

[0087] For probes with fluorescent or quenching groups at each end region, when placed in a PCR reaction system, they are decomposed by the endonuclease activity of DNA polymerase during nucleic acid amplification. This increases the distance between the fluorescent and quenching groups already bound to the probe, making the fluorescent signal from the fluorescent group detectable. In this field, such probes are also known as TaqMan (registered trademark) probes.

[0088] In this embodiment, the length of the nucleic acid probe is 8–29 mer, preferably 12–25 mer, and more preferably 14–20 mer.

[0089] The nucleic acid probes used in this embodiment consist of 1 to 12, preferably 2 to 10, and more preferably 3 to 7 artificial nucleic acids. The artificial nucleic acids are preferably those with higher stability (e.g., stronger nuclease resistance) and higher affinity for the target nucleic acid compared to conventional nucleic acids. Examples of such artificial nucleic acids include locked nucleic acids (LNA), 2'-fluorinated nucleic acids, 2'-ethoxyethyl (MOE) nucleic acids, 2'-OMe nucleic acids, and peptide nucleic acids. LNA is preferred as the artificial nucleic acid.

[0090] In the aforementioned nucleic acid probes, at least one base adjacent to the SNP binding site is preferably an LNA. Furthermore, the SNP binding site is preferably an LNA. Other artificial nucleic acids (preferably LNAs) are preferably arranged at certain intervals.

[0091] Figures 1-4 This diagram shows the detection results of each target nucleic acid under various conditions of altered probe length and LNA number during multiplex PCR using four nucleic acid probes on samples containing four template DNA fragments: the G and T alleles of the ARMS gene, and the A and G alleles of the CFH gene. Conditions marked with "0" indicate conditions that allow for the identification of the target allele.

[0092] Figure 1 The conditions for the probe (first nucleic acid probe) used to detect the ARMS2 G allele and the detection results of the ARMS2 G allele are shown. Figure 1 Therefore, the probe for detecting the ARMS2 G allele is preferably 8–21 mere in length and contains 1–10 LNAs. The first nucleic acid probe can be, for example, a nucleic acid probe with the following sequence.

[0093] CAGCTGCTAAAA (Serial Number 11)

[0094] CCAGCTGCTAAAATC (Serial Number 12)

[0095] TCCCAGCTGCTAAAATCC (Serial Number 13)

[0096] As the first nucleic acid probe, a nucleic acid probe with a sequence number 11, wherein 4 to 9 bases are LNA, can be used. The first nucleic acid probe can be, for example, the following structure.

[0097] CAG+C+T+G+CTAAAA

[0098] CAG+C+T+G+C+TAAAA

[0099] CAG+C+T+G+C+T+AAAA

[0100] CAG+C+T+G+C+T+A+AAA

[0101] CA+G+C+T+G+C+T+A+AAA

[0102] C+A+G+C+T+G+C+T+A+AAA

[0103] The "+" above indicates the LNA portion.

[0104] As the first nucleic acid probe, a nucleic acid probe with a sequence number 12, wherein 3 to 7 bases are LNA, can be used. The first nucleic acid probe can be, for example, the following structure.

[0105] CCAGCT+G+CTAAAA+TC

[0106] CCAGC+T+G+CTAAAA+TC

[0107] CCA+GC+T+G+CTAAAA+TC

[0108] CCA+GC+T+G+CTAA+AA+TC

[0109] CCA+GC+T+G+C+TAA+AA+TC

[0110] The "+" above indicates the LNA portion.

[0111] As the first nucleic acid probe, a nucleic acid probe with a sequence number 13, wherein 1 to 3 bases are LNA, can be used. The first nucleic acid probe can be, for example, the following structure.

[0112] TCCCAGCT+GCTAAAATCC

[0113] TCCC+AGCT+GCTAAAA+TCC

[0114] TCCCAGCT+GCTA+AAATCC

[0115] The "+" above indicates the LNA portion.

[0116] Figure 2 This describes the conditions of the probe (second nucleic acid probe) used for ARMS2 T allele detection and the detection results of the ARMS2 T allele. Based on... Figure 2 Therefore, the probe for detecting the ARMS2 T allele is preferably 10–22 mere in length and contains 1–12 LNAs. The second nucleic acid probe can be, for example, a nucleic acid probe with the following sequence.

[0117] CAGCTTCTAAAA (Serial Number 14)

[0118] CCAGCTTCTAAAATC (Serial Number 15)

[0119] TCCCAGCTTCTAAAATCC (Serial Number 16)

[0120] As a second nucleic acid probe, a nucleic acid probe with a sequence numbered 14, wherein 6 to 12 bases are LNA, can be used. The second nucleic acid probe can be, for example, the following structure.

[0121] CAG+C+T+T+C+T+AAAA

[0122] CA+GC+T+T+C+T+AA+AA

[0123] +CA+GC+T+T+C+T+AA+AA

[0124] +CA+G+C+T+T+C+T+AA+AA

[0125] +CA+G+C+T+T+C+T+A+A+AA

[0126] +C+A+G+C+T+T+C+T+A+A+AA

[0127] +C+A+G+C+T+T+C+T+A+A+A+A

[0128] The "+" above indicates the LNA portion.

[0129] As a second nucleic acid probe, a nucleic acid probe with a sequence numbered 15, wherein 4 to 9 bases are LNA, can be used. The second nucleic acid probe can, for example, have the following structure.

[0130] CCAG+CT+T+CTAAAA+TC

[0131] CCAG+C+T+T+CTAAAA+TC

[0132] CCAG+C+T+T+CTAA+AA+TC

[0133] CCA+G+C+T+T+CTAA+AA+TC

[0134] CCA+G+C+T+T+C+TAA+AA+TC

[0135] CC+AG+C+T+T+C+T+AA+AAT+C

[0136] The "+" above indicates the LNA portion.

[0137] As a second nucleic acid probe, a nucleic acid probe with a sequence number 16, wherein 1 to 5 bases are LNA, can be used. The second nucleic acid probe can be, for example, the following structure.

[0138] TCCCAGCT+TCTAAAATCC

[0139] TCCCAGCT+T+CTAAAATCC

[0140] TCCCAGC+T+T+CTAAAATCC

[0141] TCCCAGC+T+T+CTAAA+ATCC

[0142] TCC+CAGC+T+T+CTAAA+ATCC

[0143] The "+" above indicates the LNA portion.

[0144] Figure 3 The conditions for the probe (third nucleic acid probe) used for CFH A allele detection and the results of CFH A allele detection are shown. According to... Figure 3 Therefore, the probe for CFHA allele detection is preferably 12–25 mere in length and contains 3–12 LNAs. The third nucleic acid probe can be, for example, a nucleic acid probe with the following sequence.

[0145] ATTATTATATTTCCA (Serial Number 17)

[0146] ACCATTATTATATTTCCA (Serial Number 18)

[0147] CATACCATTATTATATTTCCAAGAG (Serial Number 19)

[0148] As a third nucleic acid probe, a nucleic acid probe with a sequence numbered 17, wherein 10 to 12 of these bases are LNAs, can be used. The third nucleic acid probe can, for example, have the following structure.

[0149] AT+T+A+T+T+A+T+A+T+T+TCCA

[0150] AT+T+A+T+T+A+T+A+T+T+T+CCA

[0151] A+T+T+A+T+T+A+T+A+T+T+T+CCA

[0152] The "+" above indicates the LNA portion.

[0153] As a third nucleic acid probe, a nucleic acid probe with a sequence numbered 18, wherein 6 to 10 bases are LNA, can be used. The third nucleic acid probe can, for example, have the following structure.

[0154] ACCA+TTAT+T+A+T+ATT+TCCA

[0155] ACCA+TT+AT+T+A+T+ATT+TCCA

[0156] ACCA+TT+AT+T+A+T+ATT+TC+CA

[0157] ACCAT+T+A+T+T+A+T+A+T+TTCCA

[0158] ACCAT+T+A+T+T+A+T+A+T+T+TCCA

[0159] The "+" above indicates the LNA portion.

[0160] As a third nucleic acid probe, a nucleic acid probe with a sequence numbered 19, wherein 3 to 4 bases are LNA, can be used. For example, the third nucleic acid probe can have the following structure.

[0161] CATACCATTA+TTA+TATT+TCCAAGAG

[0162] CATACCATTAT+T+A+T+ATT+TCCAAGAG

[0163] The "+" above indicates the LNA portion.

[0164] Figure 4 The conditions for the probe (4th nucleic acid probe) used for CFH G allele detection and the results of CFH G allele detection are shown. According to... Figure 4 It can be seen that the probe used for CFH G allele detection is 11–29 mer in length and has 1–12 LNAs. The fourth nucleic acid probe can be, for example, a nucleic acid probe with the following sequence.

[0165] ATTATTACATTTCCA (Serial Number 20)

[0166] CCATTATTACATTTCCAAG (Serial Number 21)

[0167] CATACCATTATTACATTTCCAAGAG (Serial Number 22)

[0168] As the fourth nucleic acid probe, a nucleic acid probe with a sequence numbered 20, wherein 7 to 12 bases are LNA, can be used. The fourth nucleic acid probe can be, for example, the following structure.

[0169] ATTA+T+T+A+C+A+T+TTCCA

[0170] ATT+A+T+T+A+C+A+T+TTCCA

[0171] ATT+A+T+T+A+C+A+T+T+TCCA

[0172] ATT+A+T+T+A+C+A+T+T+T+CCA

[0173] AT+T+A+T+T+A+C+A+T+T+T+CCA

[0174] A+T+T+A+T+T+A+C+A+T+T+T+CCA

[0175] The "+" above indicates the LNA portion.

[0176] As the fourth nucleic acid probe, a nucleic acid probe with a sequence number 21, wherein 4 to 9 bases are LNA, can be used. The fourth nucleic acid probe can be, for example, the following structure.

[0177] CCAT+TATTA+C+ATTTCCA+AG

[0178] CCAT+TATT+A+C+ATTTCCA+AG

[0179] CCA+T+TATT+A+C+ATTTCCA+AG

[0180] CCA+T+TATT+A+C+ATTT+CCA+AG

[0181] CCA+T+TA+TT+A+C+ATTT+CCA+AG

[0182] CCA+T+TA+TT+A+C+AT+TT+CCA+AG

[0183] The "+" above indicates the LNA portion.

[0184] As the fourth nucleic acid probe, a nucleic acid probe with a sequence number 22, wherein 1 to 5 bases are LNA, can be used. The fourth nucleic acid probe can be, for example, the following structure.

[0185] CATACCATTATTA+CATTTCCAAGAG

[0186] CATACCATTATTA+CATT+TCCAAGAG

[0187] CATACCA+TTATTA+CATT+TCCAAGAG

[0188] C+ATACCA+TTATTA+CATT+TCCAAGAG

[0189] C+ATAACCA+TTAT+TA+CATT+TCCAAGAG

[0190] The "+" above indicates the LNA portion.

[0191] 2-3-3. Other ingredients

[0192] In addition to the primers and nucleic acid probes mentioned above, multiplex PCR systems also include components commonly used in PCR. Specifically, these may include DNA polymerase, deoxyribonucleoside triphosphates (dNTPs), divalent metal ions (e.g., magnesium ions), and pH buffers. Depending on the requirements, KCl, EDTA, DTT, DMSO, betaine, reverse transcriptase, and UNG may also be included.

[0193] 2-4. Process

[0194] The method of this embodiment includes the detection steps described above, and may also include a sample pretreatment step before the detection steps. Additionally, it may include an evaluation step that assesses the correlation between the object and AMD based on the detection results. The steps are summarized below.

[0195] 2-4-1. Pretreatment process

[0196] The method of this embodiment may include a sample pretreatment step. In the case of samples such as blood or tissue, since they contain many components other than nucleic acids, such as proteins and lipids, it is preferable to extract and purify nucleic acids from the sample as pretreatment. The method for nucleic acid extraction is not particularly limited, and any known method can be used. For example, the phenol-chloroform method, centrifugal column method, alkaline extraction method, ion exchange column method, and magnetic bead method are known.

[0197] If the sample is saliva or oral mucosal swab, the above extraction and purification steps can be omitted. In this case, as pretreatment, dilution can be performed using a buffer solution (e.g., Tris-EDTA buffer).

[0198] 2-4-2. Amplification and Detection Procedures

[0199] The nucleic acids in the pretreated sample are amplified and detected using the primer set and nucleic acid probes described above. Multiplex PCR is preferred for amplification and detection. In multiplex PCR, the following components are present in a single system to detect the G and T alleles of rs10490924 and the A and G alleles of rs800292.

[0200] - Sample (the sample after pretreatment if necessary)

[0201] - The primer sets mentioned above (primer set 1 and primer set 2)

[0202] - The above four types of nucleic acid probes (nucleic acid probe 1, nucleic acid probe 2, nucleic acid probe 3, and nucleic acid probe 4)

[0203] - DNA polymerase (when the nucleic acid of the target being detected is RNA, it is a DNA polymerase with reverse transcription activity)

[0204] - dNTPs (dATP, dTTP or dUTP, dGTP and dCTP)

[0205] - Divalent metal ions (e.g., magnesium ions)

[0206] - pH buffer (e.g., Tris-EDTA buffer)

[0207] - Others, such as KCl, UNG (when using dUTP)

[0208] There are no particular limitations on the instruments used in multiplex PCR; any well-known real-time PCR thermal cycler can be used. For example, the CronoSTAR96 (Clontech), LightCycler 96 (Roche Diagnostics), CFX Opus 96 (BIO-RAD), and QuantStudio 5 (Thermo Fisher Scientific) real-time PCR systems can be used. The temperature settings of the thermal cycler can be appropriately set according to conventional methods within the range of denaturation temperature 90–99°C and annealing temperature 50–70°C. The number of cycles can be appropriately set to approximately 30–50 cycles. Multiplex PCR can determine the presence or absence of the G and T alleles of rs10490924 and the A and G alleles of rs800292 in a sample.

[0209] 2-4-3. Evaluate auxiliary processes

[0210] The detection results of the G and T alleles of rs10490924 and the A and G alleles of rs800292 obtained in the above amplification and detection process can be used to help evaluate the correlation between the subject and AMD. For example, the correlation between the subject and AMD can help evaluate the subject's risk of developing AMD and the subject's resistance to AMD treatment.

[0211] 2-4-4. Other processes

[0212] When the target nucleic acid in the sample is DNA, the pretreated sample can be amplified and detected. When the nucleic acid is RNA, a reverse transcription reaction is required before amplification and detection. The form of the reverse transcription reaction is not particularly limited. Generally, complementary cDNA can be obtained by reacting RNA at a temperature of approximately 37–72°C for about 10 minutes before the amplification and detection cycle using a reverse transcriptase (e.g., M-MLV reverse transcriptase, AMV reverse transcriptase, etc.) or a DNA polymerase with reverse transcription activity (e.g., Tth polymerase) in the same system as the amplification and detection cycle.

[0213] To prevent carry-over contamination of PCR products, uracil DNA glycosylase (UNG) can be added to the amplification-detection system described above. In this case, dNTPs with dUTPs replaced by dTTPs are used as dNTPs, and the UNG reaction is performed before the amplification-detection cycle (or before the reverse transcription reaction). The UNG reaction can be performed at a temperature of approximately 37°C for a few minutes to 10 minutes. The UNG reaction can decompose PCR products contaminated with the sample due to carry-over contamination before the amplification-detection process. UNG is subsequently inactivated by heating to its denaturation temperature, thus preventing the decomposition of newly generated target PCR products.

[0214] The method of this embodiment provides optimal conditions for the simultaneous detection of two SNPs. Therefore, according to the method of this embodiment, two important SNPs that are useful indicators in the prevention or treatment of AMD in a subject can be easily detected in a single test tube.

[0215] 3. Reagents or kits for detecting AMD-related SNPs

[0216] The second embodiment of the present invention is a reagent or kit for detecting single nucleotide polymorphisms (SNPs) of rs800292 and rs10490924. The reagent or kit of this embodiment is characterized by comprising: a first primer set for amplifying the ARMS2 gene or a fragment thereof containing rs10490924; a first primer set for amplifying the CFH gene or a fragment thereof containing rs800292; and a first nucleic acid probe and a second nucleic acid probe having the following characteristics (1) to (3) respectively hybridizing to regions containing the G allele and the T allele of rs10490924, and a third nucleic acid probe and a fourth nucleic acid probe respectively hybridizing to regions containing the A allele and the G allele of rs800292.

[0217] (1) The probe length is 8–29 mer;

[0218] (2) The number of artificial nucleic acids is 1 to 12; and

[0219] (3) One end region has a fluorescent group and the other end region has a quenching group.

[0220] The reagents or kits (reagents, etc.) used in this embodiment are preferably those for multiplex PCR, which can simultaneously amplify and detect rs800292 and rs10490924 in the same system. In the reagents, etc. used in this embodiment, the first primer set, the second primer set, the first nucleic acid probe, the second nucleic acid probe, the third nucleic acid probe, and the fourth nucleic acid probe can be stored in multiple containers, but it is preferable to store them in the same container. By storing the primer set and nucleic acid probe as a single composition in the same container, the cumbersome steps of quantifying and mixing each primer set and nucleic acid probe can be eliminated.

[0221] The reagents in this embodiment include a primer set (first primer set) for amplifying the region containing rs10490924 and a primer set (second primer set) for amplifying the region containing rs800292. The first primer set is preferably a primer set for amplifying the ARMS2 gene (serial number 1 or 2) or a fragment containing rs10490924. The second primer set is preferably a primer set for amplifying the CFH gene or a fragment containing rs800292 (serial number 3 or 4).

[0222] There are no special restrictions on the first primer set; for example, the following primer sets can be used.

[0223] Forward primer: AAGCAGAGAGCAAACTGTC (Serial No. 7)

[0224] Reverse primer: GGCTGGTTAAAATGCAAGCTG (Serial No. 8)

[0225] There are no special restrictions on the second primer set; for example, the following primer sets can be used.

[0226] Forward primer: GCAATGAACTTCCTCCAAG (serial number 9)

[0227] Reverse primer: GGATTAAGAGCAACCCATTC (serial number 10)

[0228] The reagents in this embodiment include at least four nucleic acid probes: an ARMS2 G allele detection probe (first nucleic acid probe), an ARMS2 T allele detection probe (second nucleic acid probe), a CFH A allele detection probe (third nucleic acid probe), and a CFH G allele detection probe (fourth nucleic acid probe). Each nucleic acid probe has the following characteristics.

[0229] (1) The probe length is 8–29 mer;

[0230] (2) The number of artificial nucleic acids is 1 to 12; and

[0231] (3) One end region has a fluorescent group and the other end region has a quenching group.

[0232] Each nucleic acid probe preferably has a binding site for the target SNP near its center. Therefore, in a preferred embodiment, the nucleic acid probe has a 3-14 mer nucleic acid sequence on each side of the SNP binding site. The nucleic acid probe has a fluorescent group at one end and a quenching group at the other end. Examples of fluorescent groups include FAM, FITC, Hex, VIC, Yakima Yellow, ROX, Texas Red, TEX615, Cy5, and Alexa Fluor 647. The quenching group uses a fluorescent dye that emits fluorescence at a wavelength that interferes with the fluorescence wavelength emitted from the fluorescent group. For example, when the fluorescent group is ROX, Texas Red, TEX615, Cy5, or Alexa Fluor 647, BHQ2, IBRQ, and SY-21 can be used; when the fluorescent group is FAM, FITC, Hex, VIC, or Yakima Yellow, BHQ1, TAMRA, IBFQ, and TQ2 can be used. There are no particular restrictions on the types of fluorescent groups and quenching groups, provided that the above relationship holds true; any known types can be used.

[0233] In the reagents and the like of this embodiment, the length of the nucleic acid probe is 8 to 29 mer, preferably 12 to 25 mer, and more preferably 14 to 20 mer.

[0234] In this embodiment, 1 to 12, preferably 2 to 10, and more preferably 3 to 7, of the constituent nucleic acids of the nucleic acid probe are artificial nucleic acids. Examples of such artificial nucleic acids include locked nucleic acids (LNA), 2'-fluorinated nucleic acids, 2'-ethoxyethyl (MOE) nucleic acids, 2'-OMe nucleic acids, and peptide nucleic acids. LNA is the preferred artificial nucleic acid.

[0235] In the aforementioned nucleic acid probes, at least one base adjacent to the SNP binding site is preferably an LNA. Furthermore, the SNP binding site is preferably an LNA. Other artificial nucleic acids (preferably LNAs) are preferably arranged at certain intervals.

[0236] The reagents of this embodiment are used to detect the SNPs rs800292 and rs10490924 of nucleic acids in the sample. The kit of this embodiment may contain a reagent for pretreating the sample before nucleic acid amplification. The sample is not particularly limited as long as it contains nucleic acids, but samples taken from a human subject in vitro (biological samples) are preferred. Biological samples are not particularly limited; examples include blood samples (whole blood, blood cell components, etc.), saliva, oral mucosal swabs, tissue samples, and other bodily fluid samples. When using blood samples, it is preferable to purify the nucleic acid using conventional methods. On the other hand, when using saliva or oral mucosal swabs, they can be used for amplification and detection without undergoing a lysis and purification process.

[0237] The reagents used in this embodiment may include other components required for multiplex PCR. Examples of such other components include DNA polymerase, deoxyribonucleoside triphosphates (dNTPs), divalent metal ions (e.g., magnesium ions), pH buffers, KCl, EDTA, DTT, DMSO, betaine, reverse transcriptase, UNG, etc.

[0238] Unless otherwise specified or contradictory, the components contained in the reagents and other materials of this embodiment have the same composition as those described in Section "2-3. Multiplex PCR". The reagents and other materials of this embodiment can be used in the method of the first embodiment of the present invention.

[0239] Example

[0240] The present invention will be described in more detail below through embodiments, but the present invention is not limited to these embodiments.

[0241] <Example 1: Study on SNP Detection System Using Purified DNA Fragments I>

[0242] (1) Preparation of template DNA

[0243] The template DNA fragments shown in Table 3 were chemically synthesized. Template DNA solutions were prepared by mixing the various template DNAs, with 1000 copies / μL each of the ARMS2 and CFH genes. Table 4 shows the genotypes contained in each template DNA solution (samples 1–9).

[0244] [Table 3]

[0245]

[0246] [Table 4]

[0247]

[0248] (2) Preparation of primer-probe mixture

[0249] The two primer sets and four nucleic acid probes shown in Table 5 were chemically synthesized, and then prepared into 50 μM solutions using 0.5×TE buffer. They were then mixed according to the combinations shown in Table 6 to prepare the primer-probe mixture.

[0250] [Table 5]

[0251]

[0252] [Table 6]

[0253]

[0254] (3) Multiplex PCR

[0255] The PCR reaction solution was prepared by adding 6 μL of a premix containing commercially available Taq-derived DNA polymerase, 5 μL of the primer-probe mixture described above, 5 μL of template DNA solutions for samples 1–9, and 9 μL of water (nuclease-free). A blank solution was also prepared by adding water (nuclease-free) instead of the template DNA solution. The final concentration of template DNA was 5000 copies / test, the final concentration of primers was 200 nM, and the final concentration of probes was 100 nM. The PCR reaction solution was placed in a LightCycler 96 (Roche Diagnostics) and heated at 95°C for 1 minute, followed by 45 cycles of 5 seconds at 95°C and 30 seconds at 58°C.

[0256] The amplification results of the DNA from each template are shown in Figures 5-1 and 5-2. This confirms that all genotypes can be detected with high precision.

[0257] <Example 2: Study on SNP Detection System Using Purified DNA Fragments II>

[0258] (1) Preparation of template DNA

[0259] The template DNA solution was prepared using the same method as in Example 1.

[0260] (2) Preparation of primer-probe mixture

[0261] The two sets of primers and four nucleic acid probes shown in Table 7 were chemically synthesized, and then prepared into 50 μM solutions using 0.5×TE buffer. They were then mixed according to the combinations shown in Table 6 to prepare the primer-probe mixture.

[0262] [Table 7]

[0263]

[0264] (3) Multiplex PCR

[0265] The PCR reaction solution was prepared by mixing 25 μL of Multiplex PCR Mix 2, 0.25 μL of Multiplex PCR Mix 1, 10 μL of the primer-probe mixture, 5 μL of template DNA solutions for samples 1–9, and 9.75 μL of water (nuclease-free). A blank solution was also prepared by adding water (nuclease-free) instead of the template DNA solution. The final concentration of template DNA was 5000 copies / test, the final concentration of primers was 200 nM, and the final concentration of probes was 100 nM. The PCR reaction solution was placed in a CronoSTAR96 (Clontech) and heated at 95°C for 1 minute, followed by 45 cycles of 5 seconds at 95°C and 30 seconds at 58°C.

[0266] The DNA of each template was amplified, and the results were the same as in Example 1, confirming that all genotypes could be detected with high precision.

[0267] <Example 3: Study on SNP detection system using saliva samples I>

[0268] (1) Sample preparation

[0269] Three saliva samples were collected from individuals for SNP testing. The genotypes of the SNPs in each sample were determined beforehand by sequencing. The saliva samples were diluted and heated.

[0270] (2) Preparation of primer-probe mixture

[0271] The primer-probe mixture was prepared in the same manner as in Example 1.

[0272] (3) Multiplex PCR

[0273] To prepare the PCR reaction solution, mix 6 μL of a premix containing commercially available Taq-derived DNA polymerase, 5 μL of the primer-probe mixture described above, 5 μL of pretreated saliva sample, and 9 μL of water (nuclease-free). A blank solution is also prepared by adding water (nuclease-free) instead of the saliva sample. The final primer concentration is 200 nM, and the final probe concentration is 100 nM. The PCR reaction solution is placed in a LightCycler 96 reactor and heated at 95°C for 1 minute, followed by 45 cycles of 5 seconds at 95°C and 30 seconds at 58°C.

[0274] (4) SNP detection based on commercially available SNP detection reagents

[0275] SNP detection of saliva samples was performed using TaqMan SNP Genotyping Assays (manufactured by Roche Diagnostics) corresponding to rs10490924 and rs800292, following the instructions. The structures of the probes used for each SNP detection are shown in Table 8.

[0276] [Table 8]

[0277]

[0278] The PCR reaction solution was prepared by mixing 12.5 μL of 2×TaqMan Genotyping premix, 5 μL of TaqMan SNP GenotypingAssays corresponding to each SNP, 5 μL of pretreated saliva sample from (1), and 6.25 μL of water (without nuclease). A blank solution was also prepared by adding water (without nuclease) instead of the saliva sample. The PCR reaction solution was not a multiplex PCR, but a single-tube single SNP detection system. The PCR reaction solution was placed in a LightCycler96 and heated at 95°C for 10 minutes. The reaction was then cycled 45 times at 95°C for 15 seconds and at 60°C for 1 minute.

[0279] exist Figure 6 The results of multiplex PCR (3) are shown in the figure. Figure 7 The results of PCR (4) are shown in Figure 1. In the multiplex PCR (3) performed according to the method of the present invention, it was confirmed that the genotypes of the saliva samples from specimens 1-3 could be accurately determined. On the other hand, in SNP detection using commercially available products, a G signal was detected in the sample with the ARMS2 / CFH genotype TT / AA. Furthermore, the overall Cq value was higher compared to the method of the present invention, suggesting lower sensitivity. In summary, it was confirmed that the method of the present invention can also be used for the determination of clinical specimens, and can simultaneously detect two SNPs highly correlated with AMD. In addition, it showed higher sensitivity and accuracy than existing products.

[0280] <Example 4: Study on SNP Detection System Using Saliva Specimens II>

[0281] (1) Sample preparation

[0282] Three saliva samples were collected from individuals for SNP testing. The genotypes of the SNPs in each sample were determined beforehand by sequencing. The saliva samples were diluted and heated.

[0283] (2) Preparation of primer-probe mixture

[0284] The primer-probe mixture was prepared in the same manner as in Example 2.

[0285] (3) Multiplex PCR

[0286] To prepare the PCR reaction solution, mix 25 μL of Multiplex PCR Mix 2, 10.25 μL of Multiplex PCR Mix 1, 10 μL of the primer-probe mixture, 5 μL of pretreated saliva sample, and 9.75 μL of water (nuclease-free) from a multiplex PCR detection kit (Takara Bio). A blank solution was also prepared by adding water (nuclease-free) instead of saliva sample. The final primer concentration was 200 nM, and the final probe concentration was 100 nM. The PCR reaction solution was placed in a LightCycler 96 thermometer and heated at 95°C for 1 minute, followed by 45 cycles of 5 seconds at 95°C and 30 seconds at 58°C.

[0287] Similar to the results of multiplex PCR shown in Example 2 (3), it can be confirmed that the saliva samples of the three cases 1-3 can accurately determine each genotype.

[0288] All publications, patents and patent applications referenced in this specification are incorporated herein by reference.

Claims

1. A method for detecting single nucleotide polymorphisms (SNPs) of rs10490924 and rs800292 in nucleic acids of a sample, comprising: The detection process involves simultaneously amplifying and detecting nucleic acid regions containing each SNP within the same system. The detection process uses a first nucleic acid probe and a second nucleic acid probe, which have the following characteristics (1) to (3), respectively hybridize with regions containing the G allele and the T allele of rs10490924, and a third nucleic acid probe and a fourth nucleic acid probe, which respectively hybridize with regions containing the A allele and the G allele of rs800292. (1) The probe length is 8–29 mer. (2) The number of artificial nucleic acids is 1 to 12, and (3) One end region has a fluorescent group and the other end region has a quenching group.

2. The method according to claim 1, wherein, In the detection process, multiplex PCR is performed using primer sets 1 and 2. The first primer set is used to amplify the ARMS2 gene or its fragment containing s10490924, and the second primer set is used to amplify the complement factor H, i.e., the CFH gene or its fragment containing rs800292.

3. The method according to claim 1, wherein, The artificial nucleic acid is locked nucleic acid (LNA).

4. The method according to claim 3, wherein, In the first, second, third, and fourth nucleic acid probes, at least one of the bases adjacent to the binding site of the SNP of the target being detected is an LNA.

5. The method according to claim 1, wherein, The sample may be a blood sample, saliva, oral mucosal swab, tissue sample, or other body fluid sample.

6. The method according to claim 1, wherein, The sample is saliva or oral mucosal swab, excluding nucleic acid purification process, but includes the process of amplifying and detecting multiple SNPs containing rs10490924 and rs800292.

7. A reagent or kit for detecting single nucleotide polymorphisms (SNPs) of rs800292 and rs10490924, comprising: The first primer set is used to amplify the ARMS2 gene or its fragment containing rs10490924; The second primer set is used to amplify the CFH gene or a fragment containing rs800292; and The first and second nucleic acid probes, which have the following characteristics (1) to (3), hybridize with regions containing the G allele and T allele of rs10490924, respectively, and the third and fourth nucleic acid probes, which hybridize with regions containing the A allele and G allele of rs800292, respectively. (1) The probe length is 8–29 mer. (2) The number of artificial nucleic acids is 1 to 12, and (3) One end region has a fluorescent group and the other end region has a quenching group.

8. The reagent or kit according to claim 7, wherein, The same container contains primer set 1, primer set 2, nucleic acid probe 1, nucleic acid probe 2, nucleic acid probe 3, and nucleic acid probe 4 for multiplex PCR.

9. The reagent or kit according to claim 7, wherein, The artificial nucleic acid is LNA.

10. The reagent or kit according to claim 7, used for detecting SNPs rs800292 and rs10490924 of nucleic acids in a sample.

11. The reagent or kit according to claim 10, wherein, The sample may be a blood sample, saliva, oral mucosal swab, tissue sample, or other body fluid sample.

12. The reagent or kit according to claim 9, wherein, In the first, second, third, and fourth nucleic acid probes, at least one of the bases adjacent to the binding site of the SNP of the target being detected is an LNA.

Images