Gloeostereum incarnatum strain and cultivation method thereof

By optimizing the cultivation method of the elm ear fungus strain Gloeostereum incarnatum DL-G.inc001, the problems of complex genetic background and yield fluctuation of the elm ear fungus strain were solved, and efficient and stable elm ear fungus production was achieved, which is suitable for large-scale application.

CN121852207APending Publication Date: 2026-04-14NORTHEAST FORESTRY UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-14
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing *Auricularia auricula-judae* strains have complex genetic backgrounds, severe agronomical trait segregation, large fluctuations in yield and quality, long growth cycles, and low bioconversion rates, making it difficult to achieve large-scale, intensive production.

Method used

The *Gloeostereum incarnatum* strain DL-G.inc001 and its associated cultivation methods were adopted, including liquid inoculum preparation, solid culture substrate formulation, and fruiting management, controlling conditions such as temperature, humidity, and light to optimize the cultivation process.

Benefits of technology

The strain exhibits genetic stability, high yield, high quality, strong resistance to adverse conditions, short cultivation cycle, high output, rich active ingredients, and good marketability, making it suitable for large-scale production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852207A_ABST
    Figure CN121852207A_ABST
Patent Text Reader

Abstract

The invention discloses a Gloeostereum incarnatum strain and a cultivation method thereof, and relates to the technical field of microorganisms, and the preservation number of the Gloeostereum incarnatum strain is CCTCC NO: M 20251500. The strain hypha is high in growth speed and vigorous in growth vigor; the cultivation period is short; the method has the advantages that the black fungus is neat in fruiting, complete in flower shape and stacked in a tile-covering shape, the yield is high, and 869.83 g of fresh black fungus can be produced by each kilogram of dry material. The content of protein in every 100 g of the dried agaric reaches 19.42 g, the content of crude polysaccharide reaches 7.45 g, the total amount of total hydrolyzed amino acid reaches 14.68 g, and the dried agaric also contains rich trace elements. And the taste is very crisp with obvious colloidal smooth feeling. Generally speaking, the strain has the advantages of excellent agronomic shape, high content of active ingredients and strong stress resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more specifically to a strain of *Auricularia auricula-judae* and its cultivation method. Background Technology

[0002] Elm Ear ( Gloeostereum incarnate *Elm Ear Fungus* (also known as *Elm Ear Fungus*), belonging to the Basidiomycetes phylum and the Gynaceae family, is a rare edible and medicinal fungus. It gets its name from its ear-shaped fruiting body, which mainly grows wild on the dead branches of broad-leaved trees such as elm. The fruiting body is gelatinous and crisp, with a unique taste, and is rich in various bioactive components, possessing extremely high nutritional and health value. Studies have shown that the crude polysaccharide content in the fruiting body of *Elm Ear Fungus* can reach over 6% of its dry weight, which is the key material basis for its core pharmacological functions such as enhancing immunity and anti-tumor activity. Simultaneously, it is rich in protein, generally between 15% and 25% by dry weight, and is rich in various essential amino acids, making it a high-quality source of plant protein. In addition, it also contains dietary fiber, various trace elements (sodium, potassium, calcium, iron, etc.), and vitamins (vitamin B1, B2, etc.), constituting its enormous development potential as a raw material for high-end functional foods and health products.

[0003] However, the huge market value and industrial development of elm ear fungus have long been constrained by fundamental bottlenecks, the core of which lies in the lack of stable production strains with excellent traits and efficient domestication and cultivation methods.

[0004] Currently, the strains used in production and research are mostly derived from simple isolation and propagation of wild resources. These wild strains have complex genetic backgrounds and have not undergone systematic artificial targeted breeding, resulting in a wide range of fatal defects, such as severe segregation of agronomic traits during cultivation, huge fluctuations in yield and quality, poor strain resistance (susceptibility to contamination by other fungi), excessively long growth cycles, and low bioconversion rates (biological efficiency), leading to extremely low cultivation success rates and economic benefits. Although some studies have attempted to explore the artificial cultivation of elm ear fungus, they mostly follow the traditional models of fungi such as black fungus and shiitake mushrooms, lacking in-depth research on the specific biological characteristics of elm ear fungus. In particular, a mature and reliable technical system has not yet been formed for key aspects such as the optimal mycelial growth nutrient substrate formula, precise environmental stimulation conditions for primordia differentiation (such as temperature difference, light, and humidity), and fruiting management, resulting in low success rates in artificial cultivation, poor product marketability, and difficulty in achieving large-scale, intensive production.

[0005] Therefore, the industry urgently needs a genetically stable, high-yielding, high-quality, and stress-resistant superior elm ear fungus strain, and to develop a highly compatible and quantifiable cultivation technology system in order to completely break through the industry's bottleneck. Summary of the Invention

[0006] This invention provides a strain of *Auricularia auricula-judae* and its cultivation method.

[0007] To solve the above-mentioned technical problems, this application adopts the following technical solution: A strain of *Auricularia auricula-judae*, wherein the strain is... Gloeostereum incarnate DL-G.inc001, with accession number CCTCC NO: M 20251500, was deposited on July 1, 2025 at the China Center for Type Culture Collection, located at Wuhan University, Wuhan, China.

[0008] Another object of the present invention is to provide the application of the above-mentioned *Auricularia auricula-judae* strain DL-G.inc001 in the preparation of food or pharmaceuticals.

[0009] Another object of the present invention is to provide a method for cultivating the above-mentioned *Auricularia auricula-judae* strain, comprising the following steps: S1 Preparation of liquid seed: Activated *Ulmus pumila* strain on PDA medium... Gloeostereum incarnate DL-G.inc001 was inoculated into liquid fermentation medium at a temperature of 25±2℃ and cultured for 8-10 days to obtain liquid seed culture. S2 Preparation of Cultivation Spawn: Inoculate the liquid spawn into the solid cultivation substrate at a rate of 15 mL / bag to 20 mL / bag, seal the bag, and place it in a cultivation room at a constant temperature of 25℃-27℃ in the dark. After 30-35 days of cultivation, when the mycelium has fully colonized the bag, proceed with the fruiting management. S3 Fruiting Management: After the mycelium has filled the bag for a week, open the bag with a sterilization tool and make a slit. Place it in the dark at 25℃-27℃ for 2-3 days, then transfer it to the fruiting room. Control the temperature at 18℃-22℃ and the humidity at 70%-85%. Spray water in a mist and provide 200Lx-300Lx diffused light to induce primordia formation. When the ear diameter exceeds 3 cm, increase the amount of water sprayed, control the temperature at 14-20℃, and maintain the relative humidity at 85%-95%. At the same time, strengthen ventilation. When the ear edge becomes lighter in color and thinner, and appears wavy, stop spraying water and harvest after one day.

[0010] Preferably, the liquid fermentation medium described in S1 is prepared as follows: 20 g of glucose, 5 g of tryptone, 5 g of yeast extract, 4.5 g of potassium dihydrogen phosphate, 2 g of magnesium sulfate heptahydrate and 1000 mL of water, with a natural pH, are mixed evenly, dispensed, and sterilized at 121°C for 20 min.

[0011] Preferably, the solid cultivation substrate described in S2 is prepared by mixing 78 parts of hardwood sawdust, 18 parts of wheat bran, 2 parts of corn flour, 1 part of quicklime, and 1 part of gypsum with water to obtain a solid cultivation substrate with a moisture content of 60%. The substrate is then placed into a cultivation bag, sealed, and sterilized at 121°C for 3 hours.

[0012] The present invention has the following beneficial effects: The present invention provides a strain of *Eurya spp.* and its cultivation method. This strain has the advantages of excellent agronomic traits, high content of active ingredients, and strong resistance to adverse conditions.

[0013] Gloeostereum incarnate DL-G.inc001 mycelium grows rapidly and vigorously; the cultivation cycle is short, approximately 85 days; the fruiting bodies are uniform, with complete, imbricate growth, and high yield, producing 869.83 g of fresh fruiting bodies per kilogram of dried substrate. It is also high in active ingredients, with 19.42 g of protein, 7.45 g of crude polysaccharides, and 14.68 g of total hydrolyzed amino acids per 100 g of dried fruiting body, as well as abundant trace elements. The texture is very crisp, with a distinct gelatinous, smooth feel. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0015] Figure 1 Image of wild elm ear fungus collected in Embodiment 1 of the present invention (Liangshui National Nature Reserve, Heilongjiang Province, September 2023); Figure 2 Image of wild elm ear fungus collected in Embodiment 1 of the present invention (Liangshui National Nature Reserve, Heilongjiang Province, September 2023); Figure 3 Image of wild elm ear fungus collected in Embodiment 1 of the present invention (Liangshui National Nature Reserve, Heilongjiang Province, September 2023); Figure 4 Figure 1 shows a pure culture of the strain from Example 1 of this invention (November 2023). Figure 5 This is a diagram illustrating the morphological characteristics of the sub-entity in Embodiment 2 of the present invention; Figure 6 The *Ulmus pumila* strain of this invention Gloeostereum incarnate Phylogenetic tree of DL-G.inc001 mycelium and fruiting bodies; Figure 7 This is a diagram showing the mushroom cultivation and growth status in Example 3 of the present invention; Figure 8 This is a diagram showing the mushroom cultivation status in Example 3 of the present invention. Detailed Implementation

[0016] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0017] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0018] Example 1 Wild elm fruiting bodies collected on September 28, 2023, from Liangshui National Nature Reserve, Yichun City, Heilongjiang Province (see attached image). Figure 1 -Appendix Figure 3 For strain isolation and domestication cultivation: After removing impurities from the surface of fresh wild elm ear fruiting bodies, place them in a clean bench and immerse them in 75% (v / v) alcohol for 2 minutes. Remove them, rinse with sterile water, and use tweezers to pick out the internal tissue of the fruiting bodies. Inoculate them with PDA medium and incubate them in the dark at 25℃ for 3-5 days. Select mycelia with white hyphae and good growth and inoculate them with new PDA medium (see Appendix). Figure 4 ); Through a successive generational propagation strategy, a stable *Auricularia auricula-judae* strain was selected. A substrate with a moisture content of 60% was prepared by mixing 78 parts hardwood sawdust, 18 parts wheat bran, 2 parts corn flour, 1 part quicklime, and 1 part gypsum with water in the specified mass ratio. This substrate was then used to fill mushroom bags, and mushrooms were cultivated. After fruiting, the best-performing fruiting bodies were selected to isolate the spawn. Through 12 cycles of cultivation and fruiting selection, a stable *Auricularia auricula-judae* strain was finally obtained. Gloeostereum incarnate DL-G.inc001 was named "Donglin Yuer No. 1".

[0019] Example 2 (1) Morphological identification: The fruiting body is 3.2cm-8.6cm long, 2.6cm-5.8cm wide, and 0.3cm-1.0cm thick. It is solitary or imbricate, nearly round and auriculate. When fresh, it is gelatinous; the back of the fruiting body is light pink, and the ventral side is light brown. When dried, the fruiting body becomes harder and brittle, light brown or dark brown, and covered with fine hairs (see appendix). Figure 5 ).

[0020] (2) Molecular biological identification: Extracted using the MightyPrep reagent for DNA kit Gloeostereum incarnateDNA from DL-G.inc001 mycelia and fruiting bodies was collected, and the target gene fragment was amplified using universal primers ITS1 and ITS4 (ITS1: 5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO.3; ITS4: 5'-TCCTCCGCTTATTGATATGC-3', SEQ ID NO.4). The PCR system consisted of 50 μL: 25 μL Premix Taq (TaKaRa Taq™ Version 2.0 plus dye), 3 μL DNA template, 12 μL ITS, 42 μL ITS, and 18 μL ddH2O. The PCR program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 1 min, 57℃ annealing for 1 min, 72℃ extension for 1.5 min, 35 cycles; 72℃ extension for 10 min, and storage at 4℃. After 1% agarose gel electrophoresis, the samples were analyzed and sequenced at Ribo Biotechnology. The results are as follows: Hyphal sequence - AAGGGATTTTGATGTATTTGCAGTGGGTTGTAGCTGGCTCCAACACGGAGCATGTGCACGCCTCTTGCCTCTACTACTTTTCCACTTGTGAACCTTTGTAGACTACGAATGAACTACTCGCCTGCGAATGGCGGAAAGAGAGGGTTGATCTTAACTGGTCATTTCTCTTGCTAGTTCGTAGTCTATGTCATATTTACCCTTGATCGAATGTCAATGAATGTCTTTTACTGGTCTTTGAACCTTTAAATTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCACCAGTTTTTACGAATTGGCTGATGGCTTGGATGTGGGAGTTGCGGGCTTCTTTGAAGTCGGCTCTTCTTAAATGCATTAGTGGAGACTTGCAATCGTCGCCTTGGTGTGATAATTATCTGCGCCTTGGTGTATGGTGGCTAATTAAATGTCTTTGCTTCTAACAGTCCATTGACTTGGACAACACTTTATGACTTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA, SEQ ID NO.1.

[0021] Sub-entity sequence -, SEQ ID NO.2.

[0022] Two sequences were submitted to GeneBank, and BLAST (www.ncbi.nlm.nih.gov / BLAST) was used for homology search. Similarity analysis was performed with sequences from various strains in the database to determine the similarity between the target strain and *Eurys edulis* (a type of fungus). Gloeosterium incarnate The sequence identity of each strain of *Ulmus* reached 98%-100%. Species of the *Ulmus* genus were downloaded from the GeneBank database. Auricularia heimuer For outgroups, a phylogenetic tree was constructed using the maximum likelihood method with MEGA7 software (see appendix). Figure 6 Using the default parameters, Bootstrap performs 1000 checks. Combining morphological and molecular biological identification results, this invention Gloeostereum incarnate DL-G.inc001 is a new strain of *Auricularia auricula-judae* (Ulmus pumila). Gloeostereum incarnate The strain was deposited on July 1, 2025, at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20251500, depositary address: Wuhan University, Wuhan, China. Classification and nomenclature: Gloeostereum incarnate DL-G.inc001. Example 3 (1) The cultivation method of *Auricularia auricula-judae* strain includes the following steps: Preserved elm ears Gloeostereum incarnate Take out the DL-G.inc001 strain, pick out a soybean-sized amount of the strain and inoculate it into the center of the PDA plate medium. Incubate at 25±2℃ in the dark until the mycelium has covered the plate.

[0023] The elm fungus strain that grew on the plate Gloeostereum incarnate DL-G.inc001 was inoculated into liquid culture medium (20 g glucose, 5 g tryptone, 5 g yeast extract, 4.5 g potassium dihydrogen phosphate, 2 g magnesium sulfate heptahydrate and 1000 mL water, pH natural, mixed evenly and dispensed, sterilized at 121℃ for 20 min), and cultured at 25±2℃ in the dark for 8-10 days to obtain the liquid culture. According to the mass ratio, 78 parts of hardwood sawdust, 18 parts of wheat bran, 2 parts of corn flour, 1 part of quicklime, and 1 part of gypsum are mixed with water to obtain a spawn culture medium with a moisture content of 60%. The spawn culture medium is placed in the cultivation bags, sealed, and sterilized at 121℃ for 3 hours. After cooling to room temperature, the liquid spawn is inoculated into the cultivation bags at an inoculation amount of 200 mL - 300 mL / 100 kg of culture medium. The bags are then sealed and placed in a cultivation room at a constant temperature of 25℃-27℃ in the dark. After 30-35 days of cultivation, the mycelium has fully colonized the bags, and fruiting management can begin.

[0024] After the mycelium has fully colonized the bag for a week, open it with a scalpel. Before opening, disinfect the scalpel with alcohol and then flame it with the outer flame of an alcohol lamp. After cooling to room temperature, make a "V" or "+" shaped cut on the bag. Place it in the dark at 25℃-27℃ for 2-3 days, then transfer it to the fruiting room. Control the temperature at 18℃-22℃ and the humidity at 70%-85%, spray water in a mist, and provide 200 Lx-300 Lx of diffused light. After 5-10 days, white or light yellow bumps will appear at the cuts, forming primordia. After primordia formation, maintain the temperature at 18℃-22℃ and the humidity at 80%-90%. If the humidity is insufficient, spray water directly onto the primordia. After spraying water, ventilate promptly and provide 500 Lx-800 Lx of diffused light to promote primordia differentiation. When the ear diameter exceeds 3 cm, increase the water spraying volume, control the temperature at 14℃~20℃, maintain the relative humidity at 85%~95%, and ventilate 3-5 times / day, 30-60 minutes each time. Stop spraying water when the ear edges lighten in color, become thinner, and exhibit a wavy appearance. Harvest after one day. It takes 15-20 days from primordia formation to fruiting body maturity. The entire cultivation process takes approximately 85 days. (Elm ear) Gloeostereum incarnate See the attached document for the mushroom production status of DL-G.inc001 cultivation. Figure 7 and attached Figure 8 .

[0025] According to statistics, the strains of *Elm Ear* Gloeostereum incarnate DL-G.inc001 yields 869.83g of fresh ear fungus per kilogram of dried material. Mature fruiting bodies are imbricate and overlapping, with smooth edges. Fresh ear fungus has a dense layer of hairs on the back, is soft, and is light pink or light orange-yellow; the ventral surface is uneven and densely covered with translucent small warts. Dried ear fungus is amber or dark yellow on the back and light yellow to ochre yellow on the ventral surface, with a hard and brittle texture. When ear fungus emerges laterally during long-stick cultivation in greenhouses, the fresh ear fungus is 3.2-13.6 cm long, 2.5-7.8 cm wide, and 0.4-2.3 cm thick, with a dry-to-wet ratio of 1:12.

[0026] Nutritional composition analysis of mature dried fruiting bodies revealed that per 100g, the following components were present: protein 19.42g, crude polysaccharide 7.45g, total hydrolyzed amino acids 14.68g, potassium 7.00g, calcium 0.21g, sodium 0.04g, magnesium 0.23g, zinc 4.23mg, iron 12.46mg, phosphorus 0.66g, copper 0.85mg, and selenium 0.016μg. The texture is very crisp, accompanied by a distinctly gelatinous and smooth feel.

[0027] Furthermore, statistics showed that the contamination rate of the elm ear mycelium cultivation spawn was only 1.13%, and the contaminating fungus was a common edible fungus contaminant, *Penicillium spp.*, caused by damage to the cultivation bag. No specific diseases or pests were observed during the fruiting period, indicating that the elm ear of this invention has strong resistance to contamination.

[0028] This embodiment refers to the dry-to-wet ratio of *Ulmus pumila* strain. Gloeostereum incarnate The ratio of the dry weight to the wet weight after soaking of the fruiting body of DL-G.inc001 was used. The wet weight test method involved soaking the dried fruiting bodies in water at room temperature for 4 hours, draining the water, blotting the surface moisture with absorbent paper, and weighing them, referring to the "NY / T 3729-2020 Guidelines for Testing the Distinctiveness (Distinguishing), Uniformity and Stability of Plant Varieties". Crude protein was detected according to "GB 5009.5-2016 National Food Safety Standard - Determination of Protein in Food". Crude polysaccharides were detected using the phenol-sulfuric acid method. Total hydrolyzed amino acids were detected using the ninhydrin colorimetric method. Metal ions (potassium, calcium, sodium, magnesium, zinc, iron, phosphorus, copper, selenium) were detected using the pressure vessel digestion method.

[0029] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0030] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain of *Auricularia auricula-judae*, characterized in that, The *Elaeagnus angustifolia* strain is Gloeostereum incarnatum DL-G.inc001, with accession number CCTCC NO: M 20251500, was deposited on July 1, 2025 at the China Center for Type Culture Collection, located at Wuhan University, Wuhan, China.

2. The use of the *Ulmus pumila* strain DL-G.inc001 as described in claim 1 in the preparation of food or pharmaceuticals.

3. The cultivation method of the *Ulmus pumila* strain according to claim 1, characterized in that, Includes the following steps: S1 Preparation of liquid seed: Activated *Ulmus pumila* strain on PDA medium... Gloeostereum incarnatum DL-G.inc001 was inoculated into liquid fermentation medium at a temperature of 25±2℃ and cultured for 8-10 days to obtain liquid seed culture. S2 Preparation of Cultivation Spawn: Inoculate the liquid spawn into the solid cultivation substrate at a rate of 15 mL / bag to 20 mL / bag, seal the bag, and place it in a cultivation room at a constant temperature of 25℃-27℃ in the dark. After 30-35 days of cultivation, when the mycelium has fully colonized the bag, proceed with the fruiting management. S3 Fruiting Management: After the mycelium has filled the bag for a week, open the bag with a sterilization tool and make a slit. Place it in the dark at 25℃-27℃ for 2-3 days, then transfer it to the fruiting room. Control the temperature at 18℃-22℃ and the humidity at 70%-85%. Spray water in a mist and provide 200Lx-300Lx diffused light to induce primordia formation. When the ear diameter exceeds 3 cm, increase the amount of water sprayed, control the temperature at 14-20℃, and maintain the relative humidity at 85%-95%. At the same time, strengthen ventilation. When the ear edge becomes lighter in color and thinner, and appears wavy, stop spraying water and harvest after one day.

4. The cultivation method according to claim 3, characterized in that, The liquid fermentation medium described in S1 is prepared as follows: 20 g glucose, 5 g tryptone, 5 g yeast extract, 4.5 g potassium dihydrogen phosphate, 2 g magnesium sulfate heptahydrate and 1000 mL water, pH natural, mixed evenly and dispensed, sterilized at 121℃ for 20 min.

5. The cultivation method according to claim 3, characterized in that, The preparation method of the solid cultivation substrate described in S2 is as follows: 78 parts of hardwood sawdust, 18 parts of wheat bran, 2 parts of corn flour, 1 part of quicklime, and 1 part of gypsum are mixed with water to obtain a solid cultivation substrate with a water content of 60%. The substrate is then placed into cultivation bags, sealed, and sterilized at 121°C for 3 hours.