RNA sequence microRNA-OsmiR5810 for regulating and controlling rice grain weight, deletion editor enOgeuIscB-del and application of RNA sequence microRNA-OsmiR5810 and deletion editor enOgeuIscB-del

Abstract

The invention relates to the technical field of agriculture, in particular to an RNA sequence microRNA-OsmiR5810 for regulating and controlling the grain weight of rice grains, a deletion editor enOgeuIscB-del and application of the RNA sequence microRNA-OsmiR5810 and the deletion editor enOgeuIscB-del. The RNA sequence microRNA-OsmiR5810 for regulating and controlling the grain weight of the rice grains, provided by the invention, is obtained by carrying out RNA extraction and gene cloning on the 12th chromosome of the rice south peduncle 9108 at the position of 7333285-7333425, and the RNA sequence microRNA-OsmiR5810 is in negative regulation and control in the process of regulating and controlling the grain weight of the rice grains; the nucleotide sequence of the RNA sequence comprises: (1) a nucleotide sequence as shown in SEQ ID NO. 1; or (2) a complementary sequence of the nucleotide sequence as shown in SEQ ID NO.1; or (3) a sequence which is at least 90% homologous with the nucleotide sequence as shown in SEQ ID NO.1 and retains the grain weight regulation activity. The microRNA-OsmiRNA5810 for regulating and controlling the grain weight of the rice grains is identified, the regulation and control mode is negative regulation and control, and a new material is provided for high-yield rice breeding.

Description

Technical Field

[0001] This invention relates to the field of agricultural technology, specifically to an RNA sequence microRNA-OsmiR5810 that regulates rice grain weight, a deletion editor enOgeuIscB-del, and their applications. Background Technology

[0002] IscB nuclease is a novel gene-editing tool enzyme guided by ωRNA. Compared to gene-editing tools such as CRISPR / Cas, IscB has only 496 amino acids, offering advantages such as small size and ease of delivery. However, its genome editing efficiency is relatively low, and it has not yet been applied to crop improvement. In recent years, several research teams both domestically and internationally have optimized and upgraded IscB and ωRNA using methods such as arginine scanning or amino acid substitution at key sites, as well as ωRNA truncation optimization. The optimized variants show a significant improvement in editing efficiency compared to the wild type.

[0003] With rice being a major global food crop, increasing grain weight is directly related to food security and agricultural economic benefits, and its importance is reflected in multiple dimensions: grain weight, as one of the core components of rice yield, together with the number of panicles per unit area and the number of grains per panicle, determines the final yield potential, and is of strategic significance in alleviating the food supply pressure brought about by population growth. microRNAs (miRNAs), due to their naturally occurring fine-tuning gene expression characteristics, have become a breakthrough direction for grain weight enhancement technology. These approximately 21nt non-coding RNAs can precisely regulate developmental pathways at the post-transcriptional level by binding to target gene mRNAs with sequence specificity. Crucially, the regulatory effect of miRNAs is dose-dependent, allowing for gradient regulation of expression levels without completely blocking gene function, effectively avoiding the physiological dysfunction and developmental disorders caused by traditional gene deletion technologies. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides an RNA sequence microRNA-OsmiR5810 that regulates rice grain weight, a deletion editor enOgeuIscB-del, and their applications. This invention identifies a microRNA-OsmiRNA5810 that regulates rice grain weight through negative regulation, providing new material for high-yield rice breeding.

[0005] Therefore, the present invention provides the following technical solution:

[0006] In a first aspect, the present invention provides an RNA sequence microRNA-OsmiR5810 for regulating rice grain weight in an optional embodiment. The RNA sequence microRNA-OsmiR5810 was obtained by RNA extraction and gene cloning from chromosome 12 of rice species Nangeng 9108, located at positions 7333285-7333425. It exhibits negative regulation in regulating rice grain weight.

[0007] The nucleotide sequence of the RNA sequence includes:

[0008] (1) The nucleotide sequence as shown in SEQ ID NO.1; or,

[0009] (2) The complementary sequence of the nucleotide sequence shown in SEQ ID NO.1; or,

[0010] (3) A sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID NO.1 and retains the grain weight regulation activity.

[0011] Preferably, the precursor sequence of the RNA sequence microRNA-OsmiR5810 is shown in SEQ ID NO.2.

[0012] Secondly, in an optional embodiment, the present invention provides a deletion editor, enOgeuIscB-del, that matches the aforementioned RNA sequence microRNA-OsmiR5810, which regulates rice grain weight. The gene sequence of the deletion editor enOgeuIscB-del includes at least:

[0013] (1) The nucleotide sequence as shown in SEQ ID NO.3; or,

[0014] (2) A nucleotide sequence that replaces one or more nucleotide sequences in the nucleotide sequence shown in SEQ ID NO.3 and is capable of rice genome splicing; or,

[0015] (3) A nucleotide sequence in which one or more nucleotide sequences are added to the nucleotide sequence shown in SEQ ID NO.3, and which is capable of rice genome splicing; or,

[0016] (4) A nucleotide sequence that is missing one or more nucleotide sequences in the nucleotide sequence shown in SEQ ID NO.3 and is capable of rice genome splicing.

[0017] Preferably, the gene sequence of the deletion editor enOgeuIscB-del is shown in SEQ ID NO.3.

[0018] Thirdly, in an optional embodiment, the present invention provides an expression carrier, including the aforementioned deletion editor enOgeuIscB-del.

[0019] Fourthly, in an optional embodiment, the present invention provides an expression box including the aforementioned deletion editor enOgeuIscB-del.

[0020] Preferably, it also includes an ωRNA sequence and expression frame adapted to the deletion editor enOgeuIscB-del. The nucleotide sequence of the ωRNA is shown in SEQ ID NO.4.

[0021] Fifthly, in an optional embodiment, the present invention provides a method for increasing rice grain weight, comprising the following steps:

[0022] Using the above-mentioned deletion editor enOgeuIscB-del, the above-mentioned expression vector or the above-mentioned expression cassette, the OsmiR5810 precursor region on chromosome 12 of rice Nangeng 9108 was targeted for deletion. The target deletion fragment was 266 bp, resulting in a rice mutant gene with high grain weight.

[0023] The target deletion fragment includes the DNA sequence corresponding to the microRNA-OsmiR5810 RNA sequence that regulates rice grain weight.

[0024] The nucleotide sequence of the target deletion fragment is shown in SEQ ID NO.6.

[0025] Preferably, the method includes:

[0026] (1) Using Nangeng 9108 as a template, the target deletion sequence PUC57-AMP-OsmiRNA5810 was synthesized;

[0027] (2) Based on the PUC57-AMP-OsmiRNA5810 gene sequence, synthesize primers;

[0028] (3) Using PUC57-AMP-OsmiRNA5810 as a template, PCR amplification was performed using the primers, and the PCR product was recovered and named OsmiRNA5810-del.

[0029] (4) The obtained plant expression vector pHUC422-enOgeuIscB-del was linearized using BsaI enzyme and then ligated with the PCR product OsmiRNA5810-del to obtain the enOgeuIscB-del targeting vector pHUC422-enOgeuIscB-del-OsmiRNA5810.

[0030] (5) The enOgeuIscB-del targeting vector pHUC422-enOgeuIscB-del-OsmiRNA5810 was transferred into Nangeng 9108 rice for cultivation.

[0031] The nucleotide sequence of SEQ ID NO.1 is shown below:

[0032] ACGGAACCCTAATGGCGATGGCAT.

[0033] The nucleotide sequence of SEQ ID NO.2 is shown below:

[0034] GTGCTTCATAAATGCTTTTCTCCACTTAGGGTTCCGTTAGCAACCCTCCATTAAGTACTATAGGATGAACAGTGCATTTATCGGTGTGGGATGGACGGAACCCTAATGGCGATGGCATTTATGGGACA.

[0035] The nucleotide sequence of SEQ ID NO.3 is shown below:

[0036]

[0037] The nucleotide sequence of SEQ ID NO.4 is shown below:

[0038] GGCTCTTCCAACtTGAAAAGGTTGAAAGAGCACAGGCTGAGACATTCGTAAGGCCGAAAGGCCGGACGCACCCTGGGATTTCCCCAGTCCCCGGAACTGCATAGCGGATGTCAGtTGATGAAAATCAGATAAGCCAGGGGGAACAATCACCTCTCTGGAAACAGAGAGAGTTTTTTTT.

[0039] The nucleotide sequence of SEQ ID NO.5 is shown below:

[0040] TGCAGACAAACACCCAAATCGGCTCTTCCAACTTGAAAAGGTTGAAAGAGCACAGGCTGAGACATTCGTAAGGCCGAAAGGCCGGACGCACCCTGGGATTTCCCCAGTCCCCGGAACTGCATAGCGGATGTCAGTTGATGAAAATCAGATAAGCCAGGGGGAACAATCACCTCTCTGGAAACA GAGAGAGTTTTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACAACAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCATATTAGCCCTTCCCTTGGCC.

[0041] The nucleotide sequence of SEQ ID NO.6 is shown below:

[0042] GACAAACACCCAAATCCAAGAAATGCTATCAATGAGTGCAAGTTCCATAAAATGTCATCGTACAAGCGATTTTGTCCCATAAATGCCATCGCCATTAGGGTTCCGTCCATCCCACACCGATAAATGCACTGTT CATCCTATAGTACTTAATGGAGGGTTGCTAACGGAACCCTAAGTGGAGAAAAGCATTTATGAAGCACAGCAGCGAATACTACAACGGGAAGAAAATATTACAAGTGCACGGTTCTTGAAGGGAAGGGCTAATA.

[0043] Compared with the prior art, the present invention has one of the following beneficial effects:

[0044] 1. This invention identifies a microRNA-OsmiRNA5810 that regulates rice grain weight through negative regulation, providing new material for high-yield rice breeding.

[0045] 2. This invention, by deleting OsmiRNA5810 using the deletion editor enOgeuIscB-del, resulted in a 12.15%-15.87% increase in the thousand-grain weight of rice mutants. Based on the novel function of rice OsmiRNA5810, this invention has developed a new type of material with increased thousand-grain weight, providing a genetic basis for breeding rice varieties with increased grain weight. Attached Figure Description

[0046] Figure 1 The image shows the detection electrophoresis diagrams of OsmiRNA5810 mutant and Nangeng 9108 in Example 2 of this invention. In the image, lane 1 is the DNA marker (100bp-8000bp), lane 2 is the wild type, and lanes 3, 4, and 5 are the OsmiRNA5810 deletion fragments.

[0047] Figure 2 This is a schematic diagram of the editing results of OsmiRNA5810 mutant and Nangeng9108 in Example 2 of the present invention;

[0048] Figure 3 The results show the thousand-grain weight statistics of OsmiRNA5810 mutant and Nangeng 9108 in Example 2 of this invention. Detailed Implementation

[0049] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0050] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0051] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0052] Example 1

[0053] 1. Assembly of the enOgeuIscB-del vector

[0054] The deletion editor in this application is named enOgeuIscB-del.

[0055] The inventors of this application screened existing OgeuIscB variants from human intestinal epithelial cells to obtain enOgeuIscB with high activity in plants, carrying the M102R / F137K / V159K / N281R / Q324R / Y327K / H368R / L393K mutations, and obtained the rice codon-optimized enOgeuIscB sequence.

[0056] An 18-amino acid bpNLS nuclear insertion signal was added upstream of the enOgeuIscB sequence, and a GSSG linker sequence and an 18-amino acid bpNLS nuclear insertion signal were added downstream. The sequence was then synthesized at Suzhou Genewise Biotechnology Co., Ltd. (the sequence of the synthesized deletion editor is shown in SEQ ID NO.3). The resulting sequence was then ligated into the PUC57-AMP vector to form the PUC57-AMP-enOgeuIscB vector, which was then loaded into Escherichia coli XL-blue strain.

[0057] Primers were synthesized based on the enOgeuIscB gene sequence and the T vector sequence:

[0058] enOgeuIscB for T HR FP: 5'-TTACGCCAAGCTGCCCTTGCTGCAGGCCACCATGAAACGCACCGCCGATGGCT-3'.

[0059] enOgeuIscB for T HR RP:

[0060] 5'-GCGAATTGAAGCTGCCCTTGGAGCTCTTATCACACCTTCCTTTTTCTTCTTCGG-3'.

[0061] Using PUC57-AMP-enOgeuIscB as a template, PCR amplification was performed using enOgeuIscB for T HR FP and enOgeuIscB for T HR RP, and the PCR products were recovered. The recovered PCR products and the T vector fragment digested with EcoRI were combined according to the principle of homologous recombination to construct the enOgeuIscB-del gene, named T-enOgeuIscB-del.

[0062] 2. Construction of the enOgeuIscB-del targeting vector

[0063] Plasmids were extracted from *E. coli* XL-blue containing the T-enOgeuIscB-del vector using the Axygen plasmid extraction kit. The *enOgeuIscB-del* gene fragment was recovered by PstI / SacI digestion. Simultaneously, the intermediate vector pHUC400 was linearized using PstI / SacI, and the pHUC400 fragment was recovered. The *enOgeuIscB-del* gene fragment and the pHUC400 fragment were ligated using Quick ligase to obtain the plant intermediate vector pHUC400-enOgeuIscB-del.

[0064] Plasmids were extracted from *E. coli* XL-blue containing the plant intermediate vector pHUC400-enOgeuIscB-del using the Axygen plasmid extraction kit. The plasmids were digested with HindIII, and the pHUC400-enOgeuIscB-del digested vector was recovered. Simultaneously, the laboratory expression vector pHUC422-ωRNA was linearized using HindIII, and the ωRNA fragment was recovered. The pHUC400-enOgeuIscB-del digested vector and the ωRNA fragment were ligated using Quick ligase to obtain the plant expression vector pHUC422-enOgeuIscB-del.

[0065] Using Nangeng 9108 as a template, a large fragment deletion of OsmiRNA5810 was performed, with a deletion fragment of 266bp. The specific protocol is as follows:

[0066] (1) Obtain nucleotide sequences containing 200 bp extensions before and after the target precursor RNA from the NCBI website, and search for suitable TAM sites near the start and end positions of the target gene coding sequence;

[0067] (2) Based on the above-mentioned enOgeuIscB-del gene vector, using Nangeng 9108 as a template, the deletion target sequence PUC57-AMP-OsmiRNA5810 (sequence shown as SEQ ID NO.5) was synthesized.

[0068] Primers were synthesized based on the PUC57-AMP-OsmiRNA5810 gene sequence:

[0069] OsmiRNA5810 del FP: 5'-TGCAGACAAACACCCAAATCGG-3'.

[0070] OsmiRNA5810 del RP: 5'-GGCCAAGGGAAGGGCTAATATG-3'.

[0071] Using PUC57-AMP-OsmiRNA5810 as a template, PCR amplification was performed using OsmiRNA5810 del FP and OsmiRNA5810 del RP. The PCR product was recovered and named OsmiRNA5810-del.

[0072] The obtained plant expression vector pHUC422-enOgeuIscB-del was linearized using BsaI enzyme and then ligated with the PCR product OsmiRNA5810-del to obtain the enOgeuIscB-del targeting vector pHUC422-enOgeuIscB-del-OsmiRNA5810.

[0073] The targeting vector deleted a 266bp fragment in the region containing OsmiRNA5810, and the deleted sequence is shown in SEQ ID NO.6.

[0074] Example 2

[0075] 1. The above-mentioned constructs were transferred into Nangeng 9108 rice. The specific method is as follows:

[0076] (1) After the seeds of the japonica rice variety Nanjing 9108 were dehulled, surface disinfected with ethanol and sterilized, the embryos were separated and placed on callus induction medium for culture (about 7-10 days) to obtain secondary callus tissue.

[0077] (2) Transfer the secondary callus obtained in step (1) to fresh callus induction medium for pre-culture (about 15-20 days).

[0078] (3) Immerse the pre-cultured callus tissue from step (2) in the Agrobacterium suspension carrying the targeting vector for about 15 minutes.

[0079] (4) Transfer the callus treated with Agrobacterium in step (3) to a culture dish containing three layers of sterile filter paper, wherein 2.5 mL to 3.5 mL of Agrobacterium suspension culture medium has been added to the filter paper, and co-culture at a predetermined temperature (21°C to 23°C) for about 48 hours.

[0080] (5) Transfer the callus tissue after co-culture in step (4) to the pre-screening medium for culture (about 5-7 days).

[0081] (6) Transfer the callus tissue after screening and culture in step (5) to a screening medium containing screening agent and culture for a predetermined time to screen and obtain resistant callus tissue;

[0082] (7) Transfer the resistant callus obtained in step (6) to a differentiation and regeneration medium to promote its differentiation and formation of regenerated seedlings;

[0083] (8) Transfer the regenerated seedlings obtained in step (7) to a rooting medium to induce and form complete plants with roots.

[0084] (9) Transplant the seedlings that have been identified as positive in step (8) to the field to continue growing.

[0085] In the method described above: the seeds used in step (1) are mature rice seeds; the callus induction medium used in steps (1) and (2) are the induction mediums listed in Table 1; the contact operation between the callus and Agrobacterium in step (3) is completed by immersing the callus in the Agrobacterium suspension carrying the target carrier; the Agrobacterium suspension medium used in step (4) is the Agrobacterium suspension medium listed in Table 1; the pre-screening medium used in step (5) is the pre-screening medium listed in Table 1; the screening medium used in step (6) is the screening medium listed in Table 1; the differentiation and regeneration medium used in step (8) is the differentiation and regeneration medium listed in Table 1; and the rooting medium used in step (8) is the rooting medium listed in Table 1.

[0086]

[0087] T0 generation sampling, DNA extraction, the specific method is as follows:

[0088] Sample disruption: Take an appropriate amount of sample into a 2mL centrifuge tube, add steel balls, and use a homogenizer to disrupt the rice cells.

[0089] CTAB lysis: Add 700 μL of 2×CTAB extraction buffer, vortex to mix, and incubate at 65°C for 45 minutes (inverting and mixing periodically during incubation).

[0090] Chloroform extraction: Add 700 μL of chloroform, mix thoroughly by inverting, and centrifuge at 12000 r / min for 15 minutes.

[0091] DNA precipitation: Pipette the supernatant into a clean tube containing 1.4 mL of anhydrous ethanol and let stand at -20°C for 2 hours.

[0092] Precipitation collection: Centrifuge at 12000 r / min for 15 minutes and carefully discard the supernatant.

[0093] Ethanol washing: Add 700 μL of 70% ethanol, gently invert to wash the precipitate, centrifuge at 12000 r / min for 10 minutes, and discard the supernatant. Repeat the washing once.

[0094] Drying and dissolving: Incubate at 12000 rpm for 30 seconds, then aspirate any remaining liquid. Briefly dry the precipitate at 65°C, then dissolve the DNA in an appropriate amount of ddH2O.

[0095] Concentration determination: DNA concentration was determined using an ultra-micro spectrophotometer.

[0096] The specific method for amplifying and identifying DNA samples is as follows:

[0097] To assess the editing effect in T0 generation plants, successfully extracted DNA was used as a template to amplify the target region using a high-fidelity enzyme. Primers are as follows:

[0098] OsmiRNA5810-del check FP: 5'-TATTTCATATAAGGACTCAACA-3'.

[0099] OsmiRNA5810-del check RP: 5'-AAACTTGAACATAGGAATGGAC-3'.

[0100] Agarose gel electrophoresis analysis showed that the wild-type band was 614 bp in length, while the mutant band was approximately 348 bp in size, consistent with the expected 266 bp deletion pattern (see [link to relevant documentation]). Figure 1 Further Sanger sequencing confirmed that a precise 266bp deletion did indeed occur in the target region of the mutant plant (see [link]). Figure 2 This process successfully yielded positive edited plants. After propagating these positive plants to the T2 generation, the thousand-grain weight was calculated to analyze the impact of editing on agronomic traits.

[0101] The method for determining the thousand-grain weight of T2 generation rice plants is as follows:

[0102] To rule out the potential influence of T-DNA insertion itself on the phenotype, this study selected three independent T2 generation lines for thousand-grain weight statistics. The specific steps were as follows: seeds harvested from the T0 generation were dried in a 40℃ oven for 2 days. Plump grains were selected from each independent line and the wild-type control, Nanjing 9108, and weighed. Five biological replicates were set up for the thousand-grain weight statistics. Data are expressed as mean ± standard deviation, and significance was tested using one-way ANOVA (see [link to ANOVA]). Figure 3 ),pass Figure 3 It can be seen that the thousand-grain weight of the three mutant materials is significantly increased compared with the wild type.

[0103] Although the principles of the present invention have been described in detail above with reference to preferred embodiments, those skilled in the art should understand that the above embodiments are merely illustrative explanations of the implementation of the present invention and are not intended to limit the scope of the present invention. The details in the embodiments do not constitute a limitation on the scope of the present invention. Any obvious changes, such as equivalent transformations or simple substitutions, based on the technical solutions of the present invention without departing from the spirit and scope of the present invention fall within the protection scope of the present invention.

Claims

1. A microRNA-OsmiR5810 RNA sequence for regulating rice grain weight, characterized in that, The RNA sequence microRNA-OsmiR5810 was obtained by RNA extraction and gene cloning from chromosome 12 of rice Nangeng 9108, located at positions 7333285-7333425. It has a negative regulatory effect on the regulation of rice grain weight. The nucleotide sequence of the RNA sequence includes: (1) The nucleotide sequence as shown in SEQ ID NO.1; or, (2) The complementary sequence of the nucleotide sequence shown in SEQ ID NO.1; or, (3) A sequence that is at least 90% homologous to the nucleotide sequence shown in SEQ ID NO.1 and retains the grain weight regulation activity.

2. The microRNA-OsmiR5810 for regulating rice grain weight according to claim 1, characterized in that, The precursor sequence of the RNA sequence microRNA-OsmiR5810 is shown in SEQ ID NO.

2.

3. A deletion editor, enOgeuIscB-del, matching the microRNA-OsmiR5810 RNA sequence for regulating rice grain weight as described in claim 1, characterized in that... The gene sequence of the deletion editor enOgeuIscB-del includes at least: (1) The nucleotide sequence as shown in SEQ ID NO.3; or, (2) A nucleotide sequence that replaces one or more nucleotide sequences in the nucleotide sequence shown in SEQ ID NO.3 and is capable of rice genome splicing; or, (3) A nucleotide sequence in which one or more nucleotide sequences are added to the nucleotide sequence shown in SEQ ID NO.3, and which is capable of rice genome splicing; or, (4) A nucleotide sequence that is missing one or more nucleotide sequences in the nucleotide sequence shown in SEQ ID NO.3 and is capable of rice genome splicing.

4. The deletion editor enOgeuIscB-del according to claim 3, characterized in that, The gene sequence of the deletion editor enOgeuIscB-del is shown in SEQ ID NO.

3.

5. An expression carrier, characterized in that, Includes the deletion editor enOgeuIscB-del as described in claim 3.

6. An expression box, characterized in that, Includes the deletion editor enOgeuIscB-del as described in claim 3.

7. The expression box according to claim 6, characterized in that, It also includes ωRNA sequences and expression frames adapted to the deletion editor enOgeuIscB-del.

8. The expression box according to claim 7, characterized in that, The nucleotide sequence of the ωRNA sequence is shown in SEQ ID NO.

4.

9. A method for increasing rice grain weight, characterized in that, Includes the following steps: Using the deletion editor enOgeuIscB-del described in claim 3, the expression vector described in claim 5, or the expression cassette described in claim 6, the OsmiR5810 precursor region on chromosome 12 of rice Nangeng 9108 was targeted for deletion of 266 bp, resulting in a rice mutant gene with high grain weight. The target deletion fragment includes the DNA sequence corresponding to the microRNA-OsmiR5810 RNA sequence that regulates rice grain weight as described in claim 1. The nucleotide sequence of the target deletion fragment is shown in SEQ ID NO.

6.

10. The method for increasing rice grain weight according to claim 9, characterized in that, The method includes: (1) Using Nangeng 9108 as a template, the target deletion sequence PUC57-AMP-OsmiRNA5810 was synthesized; (2) Based on the PUC57-AMP-OsmiRNA5810 gene sequence, synthesize primers; (3) Using PUC57-AMP-OsmiRNA5810 as a template, PCR amplification was performed using the primers, and the PCR product was recovered and named OsmiRNA5810-del. (4) The obtained plant expression vector pHUC422-enOgeuIscB-del was linearized using BsaI enzyme and then ligated with the PCR product OsmiRNA5810-del to obtain the enOgeuIscB-del targeting vector pHUC422-enOgeuIscB-del-OsmiRNA5810. (5) The enOgeuIscB-del targeting vector pHUC422-enOgeuIscB-del-OsmiRNA5810 was transferred into Nangeng 9108 rice for cultivation.

Images