Tomato leaf miner NPC1b gene and application thereof in prevention and treatment of tomato leaf miner
By editing the NPC1b gene of the tomato leafminer using CRISPR/Cas9 technology to inhibit its cholesterol absorption, the problems of drug resistance and environmental issues caused by chemical control were solved, and a biological control effect against the tomato leafminer was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-26
- Publication Date
- 2026-04-14
AI Technical Summary
Current technologies rely on chemical control of tomato leafminer, which leads to pesticide resistance and poses safety and environmental impacts. There is a lack of effective biological control methods.
The NPC1b gene of the tomato leafminer was edited using CRISPR/Cas9 technology to inhibit its cholesterol absorption. By cloning the NPC1b gene and designing specific sgRNA for microinjection into eggs, its growth and development were significantly inhibited.
It significantly inhibits the growth of tomato leafminer, prevents larvae from developing normally, and significantly reduces their feeding area and body weight, providing an effective strategy for biological control.
Smart Images

Figure CN121852391A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural biotechnology, specifically to the tomato leafminer. NPC1b Genes and their application in controlling tomato leafminer. Background Technology
[0002] Tomato leafminer Tuta absoluta Belonging to the Lepidoptera order and the family Diplodocidae, the tomato leafminer has strong invasive capabilities and seriously damages various Solanaceae crops. Currently, the control of tomato leafminers mainly relies on chemical control. However, long-term use of pesticides may lead to pesticide resistance in pests, and the safety and environmental impact of chemical pesticides are also issues that cannot be ignored.
[0003] Cholesterol is an essential nutrient for insects, serving two important functions: first, it is a major component of the cell membrane, playing a crucial role in cell membrane stability; second, it is a precursor to sterol hormones (such as ecdysone). Because insects lack the key enzymes for sterol synthesis, they cannot synthesize sterols and must obtain them from their food to meet their growth, development, and reproductive needs. NPC1b ( Niemann Pick type C genes The α gene is a key gene responsible for the absorption and distribution of dietary cholesterol, and plays an important role in insect energy metabolism and growth and development.
[0004] Lepidoptera insects generally include and depend on NPC1b Genes absorb cholesterol in lepidopteran insects. NPC1b The protein possesses a relatively conserved cholesterol-binding region (NPC1b_NTD), but the cholesterol-binding region sequence varies; and it occurs in 5 species within the suborder Thyrocodontia of the entire class Insecta. NPC1 ( Niemann Pick type C genes Loss phenomenon.
[0005] CRISPR / Cas9 technology is an RNA-guided genome-targeting editing technology capable of precise editing of genome sequences. The RNA-guided Cas9 nuclease can cleave and modify specific genomic sites in various cell types, including animals. The CRISPR / Cas9 system is widely used in various fields due to its simplicity, cost-effectiveness, and high speed and efficiency. This technology is increasingly popular in functional genomics research, and has been applied in recent years in Aedes aegypti mosquitoes, Bombyx mori silkworms, and Drosophila melanogaster fruit flies. Summary of the Invention
[0006] The purpose of this invention is to provide a method for dealing with tomato leafminers. NPC1b Gene.
[0007] Another object of the present invention is to provide the effect of the above-mentioned gene in the absorption of sterols in the diet of the tomato leafminer moth.
[0008] According to a specific embodiment of the present invention, the tomato leafminer was cloned for the first time. NPC1b The gene, whose full-length cDNA nucleotide sequence is shown in SEQ ID No:1:
[0009] Tomato leafminer NPC1b The amino acid sequence encoded by the gene is shown in SEQ ID NO:2:
[0010] The present invention also provides a product containing the above-mentioned tomato leafminer. NPC1b Recombinant gene expression vectors.
[0011] The present invention also provides the above-mentioned tomato leafminer. NPC1b The application of genes in the control of tomato leafminer.
[0012] According to the application of the present invention, wherein the tomato leafminer is suppressed. NPC1b Gene expression levels can help control tomato leafminer.
[0013] The method for controlling tomato leafminer according to the present invention includes suppressing the tomato leafminer. NPC1b The steps of gene expression levels, wherein the tomato leafminer NPC1b The gene encodes a protein with the amino acid sequence shown in SEQ ID NO:2.
[0014] According to the method for controlling tomato leafminer of the present invention, the tomato leafminer NPC1b The nucleotide sequence of the gene is shown in SEQ ID NO:1.
[0015] The method for controlling tomato leafminer according to the present invention includes synthesizing the tomato leafminer. NPC1b The steps include injecting the sgRNA of the gene into the egg of the tomato leafminer moth.
[0016] This invention clones from the tomato leafminer moth. NPC1b ( Niemann Pick type C genes The cDNA of the gene was injected, and sgRNA was injected into microeggs, thereby significantly inhibiting the growth of the tomato leafminer. The tomato leafminer remained in the first instar until death, and the larvae could not grow normally to the second instar. The leaf area consumed by the leafminer was significantly lower than that of the control, and the body weight was significantly lower than that of the control. The results of this invention clarify that NPC1b The influence of genes on the absorption of dietary sterols mediated by the tomato leafminer moth on its growth and development suggests that targeting genes related to sterol absorption or metabolism to hinder the insect's acquisition or conversion of sterols could prevent the insect from completing its growth and development. This strategy has significant application value as a pest control approach. Attached Figure Description
[0017] Figure 1 The spatiotemporal expression profiles of the NPC1b gene in different developmental stages and tissues of the tomato leafminer are shown. Figure 2 This shows the effect of knocking out the NPC1b gene on the growth and development phenotype of the tomato leafminer. Figure 3The effect of knocking out the NPC1b gene on the hatching rate and larval survival of the tomato leafminer moth eggs was shown. Figure 4 The effect of knocking out the NPC1b gene on the feeding amount and insect weight of the tomato leafminer; Figure 5 Displays target site mutation detection. Detailed Implementation Example 1: Cloning of the full-length cDNA sequence of the NPC1b gene of the tomato leafminer.
[0018] Four tomato leafminer larvae were placed in 1.5 mL centrifuge tubes, frozen in liquid nitrogen, and then ground into powder using a grinder. RNA was extracted and stored at -80℃ for later use. cDNA was synthesized from the extracted RNA using the Yisheng transcription kit. Primers were designed using the cDNA as a template for PCR amplification. The designed primers are shown in Table 1. Table 1 Cloning NPC1b Primer sequences for the full-length cDNA of the gene .
[0019] Using the sequences in Table 1, PCR amplification was performed to obtain... NPC1b The full-length cDNA sequence of the gene is 3741. The resulting gene has a nucleotide sequence as shown in SEQ ID No:1 and encodes a 1246 amino acid sequence as shown in SEQ ID No:2. Example 2: Spatiotemporal expression profile analysis of the NPC1b gene in the tomato leafminer 2.1 Different Developmental Stages
[0020] Newly emerged male and female tomato leafminer moths were simultaneously placed in rearing cages and allowed to mate freely for one day. Fresh egg samples were collected from the tomato plants. The remaining eggs from the same batch were then reared on the tomato plants until the 1st, 2nd, 3rd, and 4th instars, and into the mid-stage of mature larvae, with samples collected promptly at each stage. Real-time quantitative fluorescence data analysis was then performed, such as... Figure 1 The expression level in the egg stage is slightly higher than that in the first instar larvae. The expression level increases from the first to the fourth instar, reaching a peak in the fourth instar. The expression level in mature larvae is extremely low. 2.2 Different tissue sites
[0021] Fourth-instar larvae of the tomato leafminer were collected and dissected and their tissues separated under a microscope in pre-cooled 0.01M PBS buffer (pH 7.0-7.2) to obtain samples of the head, midgut, fat body, and epidermis. The obtained tissues were washed with sterile, enzyme-free water and then placed in RNA tissue preservation solution and stored at 4°C for later use. The results showed that the NPC1b gene was significantly highly expressed in the midgut, consistent with its function in intestinal digestion and absorption, and mediating the absorption of dietary sterols. Example 3: Effects of NPC1b gene knockout on the growth and development of tomato leafminer 3.1 Design and Synthesis of sgRNA and Cas9
[0022] Based on the CDS sequence obtained from cloning and genomic data analysis, the intron and exon regions of the NPC1b gene were identified. The tomato leafminer NPC1b genome lacks introns. Off-target screening was then performed on the CHOPCHOP website (https: / / chopchop.cbu.uib.no / ), selecting high-scoring primers and screening for primers with ≥4 incorrect base combinations. The target site was chosen to be as close as possible to the signal peptide region. The final optimized sgRNA was: sgRNA-1: 5'AAGTGTGTGATCCTGAATCGTGG3', PAM sequence is TGG; sgRNA-2: 5'CCGACGGGAACAGATCCCTTCGT3', PAM sequence is GCC.
[0023] In addition, a pair of 538bp detection primers were designed in the ORF region to detect the knockout efficiency.
[0024] F: 5'AAGATTTCATGGTGCAGTCG3', R:5' TATTCTCTGCAAGTAACCCTGT3'. Simultaneously, recombinant Cas9 protein (type SpCas9, purity ≥90%, concentration 4.21 mg / mL, free from nuclease contamination) was procured. sgRNA and Cas9 protein were mixed at a molar ratio of 1:1, and enzyme-free water was added to bring the volume to 10 uL. 3.2 Preparation of sgRNA-Cas9 mixture and detection of injection effect
[0025] Take 1 μL each of sgRNA-1 and sgRNA-2 solutions, 1 μL of recombinant Cas9 protein solution (1 mg / mL), add enzyme-free water to a total volume of 10 μL, and centrifuge for 2 min to form the sgRNA-Cas9 complex. Microinject 200 fresh tomato leafminer eggs (repeated twice), with a hatching rate of 41.20%. Randomly select 60 surviving larvae for the above-designed... NPC1bGene knockout validation primers were used for PCR amplification and sequencing. 23 larvae showed small fragment deletions, resulting in an editing efficiency of 38.33%. Only the sgRNA-1 target site showed a small base deletion, while the sgRNA-2 target site was not successfully knocked out. This indicates that sgRNA-1 is an effective sgRNA, while sgRNA-2 is an ineffective sgRNA. The knockout detection results are shown in the image below. Figure 5 As shown. 3.3 Effects of NPC1b gene knockout on the growth and development of the tomato leafminer
[0026] like Figure 2 As shown, the phenotypes of the mutant (M) and wild-type (W) larvae were observed and photographed within 6 days after hatching. It can be seen that knocking out the NPC1b gene significantly inhibits growth, and the larvae remain in the 1st instar state with little change and cannot grow to the 2nd instar. 3.4 Effects of NPC1b gene knockout on hatching rate and survival rate of tomato leafminer
[0027] like Figure 3 As shown, the difference in larval hatching rates after injection of sgRNA and DEPC was statistically observed. The hatching rates of sgRNA and DEPC were 41.20% and 58.35%, respectively, which were not significantly different. The number of larvae that were knocked out of the NPC1b gene and CK was counted within 7 days after hatching. The survival rate began to decrease significantly on the 8th day (the 3rd day after hatching) through the survival number line graph. 3.5 Effects of NPC1b gene knockout on feed intake and insect weight of tomato leafminer
[0028] like Figure 4 The image shows a comparison of the leaf area consumed by the NPC1b-knockout tomato leafminer and the wild-type tomato leafminer. NPC1b knockout significantly reduces the tomato leafminer's feeding ability, presumably due to impaired sterol absorption leading to growth retardation and decreased feeding demand and capacity. Comparing the larval weights of NPC1b-knockout and wild-type larvae when survival rates began to decline significantly on day 8 (day 3 after hatching), the larval weights of NPC1b-knockout larvae were significantly lower than those of wild-type larvae.
[0029] The above embodiments are only used to understand the technical solutions of this application and do not limit the scope of protection of this application.
Claims
1. Tomato leafminer NPC1b Genes, characterized by, The protein encodes the amino acid sequence shown in SEQ ID NO:
2.
2. The tomato leafminer according to claim 1 NPC1b Genes, characterized by, The tomato leafminer NPC1b The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
3. A method for inhibiting the development of tomato leafminer larvae, characterized in that, The method includes silencing the tomato leafminer. NPC1b The genetic steps, wherein the tomato leafminer NPC1b The gene encodes a protein with the amino acid sequence shown in SEQ ID NO:
2.
4. The method for inhibiting the development of tomato leafminer larvae according to claim 3, characterized in that, Tomato leafminer silenced using the sgRNA-Cas9 protein method NPC1b The gene, wherein the sequence of the sgRNA is: 5'AAGTGTGTGATCCTGAATCGTGG3'.
5. A method for suppressing the feeding amount of the tomato leafminer, characterized in that, The method includes silencing the tomato leafminer. NPC1b The genetic steps, wherein the tomato leafminer NPC1b The gene encodes a protein with the amino acid sequence shown in SEQ ID NO:
2.
6. The method for suppressing the feeding amount of tomato leafminer according to claim 6, characterized in that, Tomato leafminer silenced using the sgRNA-Cas9 protein method NPC1b The gene, wherein the sequence of the sgRNA is: 5'AAGTGTGTGATCCTGAATCGTGG3'.