Gene SbAIF1 for enhancing broad-spectrum disease resistance of sorghum and application of gene SbAIF1

Abstract

The invention belongs to the technical field of biology, and particularly relates to a gene SbAIF1 for enhancing broad-spectrum disease resistance of sorghum and application of the gene SbAIF1. It is proved for the first time that the SbAIF1 gene is over-expressed in sorghum, the broad-spectrum disease resistance of sorghum is enhanced by increasing the jasmonic acid content in sorghum, a new thought is provided for cultivating disease-resistant transgenic plants, and the SbAIF1 gene has important production significance and life significance for crop breeding and production application.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a gene SbAIF1 that enhances the broad-spectrum disease resistance of sorghum and its application. Background Technology

[0002] Plant diseases are a global phenomenon caused by pathogenic microorganisms such as fungi, bacteria, and viruses infecting crops. They not only severely damage plant health and reduce crop yields, but also pose a continuous threat to global food security and ecological stability. Influenced by factors such as intensive agricultural production, climate change, and large-scale monoculture, the frequency and severity of plant diseases are constantly increasing, and the types of crops and geographical areas affected are continuously expanding. Plant diseases have become a core biological stressor restricting sustainable agricultural production. In-depth analysis of the molecular mechanisms of plant-pathogen interactions, exploration and utilization of natural plant resistance, and the breeding and promotion of new disease-resistant varieties are of irreplaceable importance for ensuring stable and increased crop yields, reducing reliance on chemical pesticides, and promoting green and sustainable agricultural development.

[0003] Sorghum grows rapidly, yields a considerable amount, and can adapt to poor soils and various adverse environments. Therefore, analyzing its stress-resistance-related genes and elucidating its molecular mechanisms is of great significance for the creation of new sorghum varieties and agricultural development. With the rapid development of molecular biology techniques, efficiently expressing stress-resistance genes in target crops to enhance their stress resistance, yield, and quality has become a core research direction. However, research on stress-resistance-related genes in sorghum is still relatively scarce, and the progress of using molecular breeding techniques to cultivate new sorghum varieties is also relatively lagging. Summary of the Invention

[0004] To address the shortcomings of the existing technologies, the purpose of this invention is to provide a gene SbAIF1 that enhances the broad-spectrum disease resistance of sorghum and its applications.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention provides the application of substances that upregulate, enhance, or increase the expression of protein-coding genes, or substances that upregulate, enhance, or increase the activity or content of proteins, in enhancing plant disease resistance. The protein is any one of the following: (a1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; (a2) The protein described in (a1) is obtained by substituting and / or deleting and / or adding amino acids to obtain a protein that has more than 80% identity with and has the same function as the protein shown in (a1). (a3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of (a1) or (a2); The plant in question is sorghum.

[0007] In some embodiments, the enhancement of plant disease resistance refers to enhancing the plant's ability to resist pathogen infection; the pathogens include *Anthracnose sorghum* and *Alternaria sorghum*.

[0008] A second aspect of the present invention provides the application of substances that upregulate, enhance, or increase the expression of protein-coding genes, or substances that upregulate, enhance, or increase the activity or content of proteins, in increasing the jasmonic acid content in plant plants. The protein is any one of the following: (a1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; (a2) The protein described in (a1) is obtained by substituting and / or deleting and / or adding amino acids to obtain a protein that has more than 80% identity with and has the same function as the protein shown in (a1). (a3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of (a1) or (a2); The plant in question is sorghum.

[0009] In the above-mentioned proteins, the protein tag (protein tag) A protein tag (TAG) is a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0010] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet. For example, in advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gapexistence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained.

[0011] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0012] The gene encoding the SbAIF1 protein is the SbAIF1 gene, and the nucleotide sequence of the SbAIF1 gene is shown in SEQ ID NO:2.

[0013] In the above applications, the substance that upregulates, enhances, or increases the expression of the protein-coding gene, or the substance that upregulates, enhances, or increases the activity or content of the protein, is any one of the following: (b1) A nucleic acid molecule encoding the protein shown in SEQ ID NO:1 with the amino acid sequence; (b2) An expression cassette containing the nucleic acid molecule described in (b1); (b3) A recombinant vector containing the nucleic acid molecule described in (b1), or a recombinant vector containing the expression cassette described in (b2); (b4) Recombinant microorganisms containing the nucleic acid molecule described in (b1), or recombinant microorganisms containing the expression cassette described in (b2), or recombinant microorganisms containing the recombinant vector described in (b3); (b5) A transgenic plant cell line containing the nucleic acid molecule described in (b1), or a transgenic plant cell line containing the expression cassette described in (b2), or a transgenic plant cell line containing the recombinant vector described in (b3); (b6) A transgenic plant tissue containing the nucleic acid molecule described in (b1), or a transgenic plant tissue containing the expression cassette described in (b2), or a transgenic plant tissue containing the recombinant vector described in (b3); (b7) A transgenic plant organ containing the nucleic acid molecule described in (b1), or a transgenic plant organ containing the expression cassette described in (b2), or a transgenic plant organ containing the recombinant vector described in (b3).

[0014] (b1) In the nucleic acid molecule described, those skilled in the art can easily mutate the nucleotide sequence encoding the protein SbAIF1 of the present invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 80% or more identity with the nucleotide sequence of the protein TaST1 isolated in the present invention, as long as they encode and function as protein SbAIF1, are all derived from the nucleotide sequence of the present invention.

[0015] The aforementioned 80% or higher identity can be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0016] In this document, the vectors used are well-known to those skilled in the art and generally refer to vectors capable of delivering exogenous DNA or target genes into host cells for amplification and / or expression. These vectors can be cloning vectors or expression vectors. Vectors can be introduced into host cells through transformation, transduction, or transfection, allowing the genetic material elements they carry to be amplified and / or expressed within the host cells. Those skilled in the art can select appropriate vectors based on the purpose of genetic engineering and the properties of the recipient cells. The vectors include, but are not limited to: plasmids, phages (such as λ phage or M13 phage), cosmids (i.e., Cosmids), phagemids, shuttle vectors (such as yeast expression vectors), Ti plasmids, artificial chromosomes (such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), P1 artificial chromosomes (PAC), or Ti plasmid artificial chromosomes (TAC)), and viral vectors (such as baculovirus vectors, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, poxviruses, papillomaviruses, papillomaviruses (such as SV40), and herpesviruses (such as herpes simplex virus)). A vector may contain multiple elements controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, the vector may also contain a replication initiation site.

[0017] In the aforementioned biological materials, the expression cassette described in (b3) refers to DNA capable of expressing the gene in a host cell. This DNA may include not only promoters that initiate gene transcription but also terminators that terminate gene transcription. Furthermore, the expression cassette may also include enhancer sequences. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; wound-inducible promoters from tomatoes, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically induced promoters from tobacco, pathogenesis-related (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both can be induced by jasmonic acid methyl ester); heat shock promoters; tetracycline-inducible promoters; seed-specific promoters, such as millet seed-specific promoter pF128; and promoters specific to seed storage proteins (e.g., promoters of beta-conglycin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBOJ 4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited here are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, for example: Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627.

[0018] In (b4) above, "recombinant vector" generally refers to a recombinant DNA molecule constructed by ligating a foreign target gene to a vector in vitro. It can be constructed in any suitable manner, as long as the constructed recombinant vector can carry the foreign target gene into the recipient cell and provide the foreign target gene with the ability to replicate, integrate, amplify, and / or express in the recipient cell. The recombinant vector can be constructed using plant expression vectors to create a recombinant expression vector containing the gene expression cassette. The plant expression vector can be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, pMDC85, or pCAMBIA1391-Xb. When constructing a recombinant expression vector using SbAIF1, any enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin gene Ubiqutin promoter (pUbi), etc., which can be used alone or in combination with other plant promoters. Furthermore, when constructing a plant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. As a specific embodiment, this application uses the pCAMBIA2300-GFP-BWM vector as the expression vector.

[0019] In the above application, (b1) the nucleic acid molecular target gene is the encoding gene of the protein shown in SEQ ID NO:1.

[0020] In the above text, the nucleotide sequence encoding the gene is the sequence shown in SEQ ID NO:3.

[0021] A third aspect of the present invention provides a method for cultivating disease-resistant plant plants, comprising upregulating or enhancing or increasing the expression of protein-coding genes in the target plant, and / or increasing the activity and / or content of proteins to obtain disease-resistant plant plants. The protein is any one of the following: (a1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; (a2) The protein described in (a1) is obtained by substituting and / or deleting and / or adding amino acids to obtain a protein that has more than 80% identity with and has the same function as the protein shown in (a1). (a3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of (a1) or (a2); The plant is sorghum; the disease resistance refers to the enhanced ability of the plant to resist infection by pathogens; the pathogens include sorghum anthracnose and sorghum algae.

[0022] A fourth aspect of the present invention provides a method for increasing the jasmonic acid content in plant plants, comprising upregulating or enhancing or increasing the expression of protein-coding genes in the target plant, and / or increasing the activity and / or content of the protein. The protein is any one of the following: (a1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; (a2) The protein described in (a1) is obtained by substituting and / or deleting and / or adding amino acids to obtain a protein that has more than 80% identity with and has the same function as the protein shown in (a1). (a3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of (a1) or (a2); The plant in question is sorghum.

[0023] A fifth aspect of the present invention provides a method for cultivating transgenic plant plants, comprising upregulating or enhancing or increasing the expression of protein-coding genes in the target plant, and / or increasing the activity and / or content of the protein. The protein is any one of the following: (a1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; (a2) The protein described in (a1) is obtained by substituting and / or deleting and / or adding amino acids to obtain a protein that has more than 80% identity with and has the same function as the protein shown in (a1). (a3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of (a1) or (a2); The plant in question is sorghum.

[0024] A sixth aspect of the present invention provides the application of the above-described method in plant breeding.

[0025] In some implementations, breeding methods include hybridization, backcrossing, self-pollination, or asexual reproduction.

[0026] A seventh aspect of the present invention provides a sorghum variety with broad-spectrum disease resistance, wherein the sorghum genome incorporates an exogenous nucleic acid molecule, the exogenous nucleic acid molecule containing the coding sequence of the SbAIF1 gene, the coding sequence of the SbAIF1 gene being shown in SEQ ID NO:3.

[0027] Compared with the prior art, the technical solution of the present invention has the following beneficial effects: This invention is the first to demonstrate that overexpression of the SbAIF1 gene in sorghum enhances the broad-spectrum disease resistance of sorghum by increasing the jasmonic acid content in the sorghum, providing a new approach for breeding disease-resistant transgenic plants. It has important production and life significance for crop breeding and production applications. Attached Figure Description

[0028] Figure 1 This is a diagram showing the results of DNA verification in an embodiment of the present invention; Figure 2 This is a graph showing the gene expression levels of sorghum plants overexpressing the SbAIF1 gene in an embodiment of the present invention. Figure 3 The images show the phenotypic diagrams of the sorghum gene SbAIF1 overexpression lines and wild-type under different pathogen infections in embodiments of the present invention; wherein, A is the phenotypic diagram of sorghum anthracnose infection, B is the leaf area statistics of anthracnose infection, C is the anthracnose biomass statistics, D is the phenotypic diagram of sorghum Alternaria infection, E is the leaf area statistics of Alternaria infection, and F is the Alternaria biomass statistics. Figure 4 This invention presents the expression levels and jasmonic acid content of genes related to the jasmonic acid pathway in wild-type sorghum and SbAIF1 overexpressing lines under pathogen infection in this embodiment of the invention; where A is the transcriptome Kyoto Encyclopedia of Genes and Genomes (KEGG), B is the heatmap analysis of genes related to the jasmonic acid (JA) signaling pathway, and C is the statistical analysis of JA content. Detailed Implementation

[0029] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0030] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, and / or combinations thereof.

[0031] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0032] Example 1: Construction of sorghum overexpression lines The sorghum overexpression vector used was pCAMBIA2300-GFP-BWM, constructed according to the patent application number 2024118518112. Homologous recombination was used for vector recombination, and transformation was performed by Agrobacterium-mediated transformation of immature sorghum embryos. In the sorghum overexpression experiment, to facilitate subsequent screening, sorghum seedlings grown from infected wild-type Wheatland sorghum immature embryos were typically designated as generation T0. Seeds obtained from generation T0 were designated as generation T1 seeds. Genotype segregation occurred in generation T1 seeds, and homozygous positive seedlings were selected at generation T2. ​​Different gene expression levels were then measured to obtain overexpression lines with varying gene expression levels.

[0033] (I) Constructing a Reorganization Vehicle (1) Gene amplification and homologous recombination A homologous fragment of pCAMBIA2300-GFP-BWM was introduced into the sorghum SbAIF1 gene by introducing primers at the start site (ATG) and 3' end. The full-length CDS sequence of the gene was obtained by PCR amplification. The primer sequences used for gene amplification were as follows: SbAIF1 F: GATCAATTCGAGCTCGGTACACTAGTATGGACATCAGCTGTTCGA; SbAIF1 R: GTTCTTTCCTTTACTCATCGCCCCTGCTTTCTTCCTG.

[0034] The amplification products were recovered by gel extraction, and their concentrations were determined. The vector was digested with the Spe1 restriction enzyme and then recovered by gel extraction. Homologous recombination was performed using a homologous recombinase from Novizan Biotechnology Co., Ltd., and the target gene was ligated into the overexpression vector pCAMBIA2300-GFP-BWM. The ligation system is shown in Table 1.

[0035] Table 1 Connection System

[0036] The above reaction solution is placed in a PCR instrument at 37°C for 30 min, then cooled to 4°C or immediately placed on ice to obtain the recombinant vector, which can be used for the transformation of Escherichia coli.

[0037] (2) Preparation of competent Escherichia coli cells E. coli ( E. coliDH5α bacteria were streaked onto LB agar plates using an inoculation loop and incubated overnight at 37°C. Fresh single colonies were picked and inoculated into 5 mL of LB liquid medium, and incubated overnight at 37°C with shaking at 250 rpm. The culture was then diluted 100-fold and inoculated into 50 mL of LB liquid medium, and incubated at 37°C with shaking at 250 rpm for 3–5 h until the bacteria reached the logarithmic growth phase. The bacterial culture was transferred to 50 mL centrifuge tubes and placed on ice for 10 min. The tubes were then centrifuged at 4°C, 4000 rpm for 10 min, and the supernatant was discarded. The cells were resuspended in 50 mL of 0.1 M CaCl2 (pre-chilled at 24°C), centrifuged at 4°C, 4000 rpm for 10 min, and the supernatant was discarded. 25 mL of 0.1 M CaCl2 (pre-chilled at 24°C) was added to the pellet, and the pellet was resuspended. The pellet was then centrifuged at 4°C, 4000 rpm for 10 min, and the supernatant was discarded. 2.5 mL of 0.1 M CaCl2 was added to each tube. Resuspend the precipitate in MCaCl2 (containing 15% glycerol); aliquot into 1.5 mL EP centrifuge tubes, 50 μL / tube; store in [location unclear]. Store in a 70℃ refrigerator for later use.

[0038] (3) Transformation of recombinant vectors Thaw competent E. coli cells on ice; add the ligation product to the competent cells, add approximately 10 μL of recombinant vector to 50 μL of competent cells, gently swirl to mix, and incubate on ice for 30 min; heat shock in a 42 ℃ water bath for 90 s without shaking, then immediately return to ice to cool for 2 min; add 600 μL of LB medium, incubate at 37 ℃ with shaking at 150 rpm for 60–90 min; centrifuge at 4000 rpm for 5 min at room temperature, aspirate a portion of the LB medium, leaving approximately 200 μL; mix the remaining liquid and precipitate, and evenly spread on LB medium plates containing 50 mg / mL Kan resistance; incubate upside down at 37 ℃ for 12–16 h until colonies appear.

[0039] (4) Screening and sequencing of positive colonies Single colonies were picked and placed in 1.5 mL centrifuge tubes containing 0.6 mL of LB (Kan resistant) and incubated at 37°C with shaking at 220 rpm for approximately 6 h; primers SbAIF1 were then used to incubate the colonies. PCR amplification was performed using F / R. 1 μL of bacterial culture was used as a template, and the annealing temperature was 50℃. Figure 1 As shown, the PCR product of a positive clone should be around 700 bp; if the clone is a false positive (vector self-ligation), there will be no PCR product; pick 3 positive colonies and send them to the company for sequencing. The sequencing primer 2300-R sequence is: ACAACGTGCACAACAGAA. Select the correctly sequenced strains for subsequent experiments.

[0040] (5) Plasmid extraction Pick a single colony of *E. coli* containing the vector plasmid and incubate overnight at 37 °C with shaking at 200 rpm in LB liquid medium containing Kan resistance. Transfer the bacterial culture to a 2 mL centrifuge tube, centrifuge at 12000 rpm for 1 min, discard the supernatant, and collect the bacterial pellet. Aspirate the supernatant with a pipette, add 250 μL of Solution I (containing RNase A) to the tube, and shake thoroughly. Add 250 μL of freshly prepared Solution II, seal the tube tightly, and gently invert 2-3 times to mix thoroughly, avoiding vigorous shaking. Add 350 μL of Solution III, mix thoroughly, incubate at room temperature for 2 min, and centrifuge at 12000 rpm for 5 min. Equilibrate the column by adding 400 μL of equilibration buffer BL to the adsorption column (place the adsorption column in the collection tube), centrifuge at 12000 rpm for 1 min, discard the filtrate in the collection tube, and return the adsorption column to the collection tube. Carefully transfer the supernatant to the adsorption column, incubate for 2 min, and centrifuge at 12000 rpm. Centrifuge for 1 min, discard the filtrate in the collection tube; add 600 μL of Buffer WB2, centrifuge at 12000 rpm for 0.5 min at room temperature, discard the filtrate in the collection tube, and repeat the above steps once; centrifuge at 12000 rpm for 2 min, discard the waste liquid; dry the precipitate at room temperature for 2 min, and dissolve the precipitate in 50 μL of ddH2O. Store at 20℃.

[0041] (6) Preparation of Agrobacterium competent cells Agrobacterium AGL1 was streaked onto LB agar plates containing 100 μg / mL Rif and cultured at 28 °C for 36–48 h until colonies appeared. A single colony was picked and inoculated into 5 mL of LB liquid medium containing 100 μg / mL Rif and cultured at 28 °C with shaking at 250 rpm for 16–24 h. 0.5 mL of the bacterial culture was then transferred to 50 mL of LB liquid medium containing 50 μg / mL Rif and cultured at 28 °C with shaking at 250 rpm until the logarithmic growth phase (OD600 = approximately 0.5), about 8–16 h. The bacterial culture was then transferred to 50 mL centrifuge tubes, incubated on ice for 30 min, and centrifuged at 5000 rpm for 10 min to pellet the cells. 10 mL of pre-chilled 0.15 M NaCl was added to gently resuspend the cells, and the tubes were centrifuged at 4 °C with centrifugation at 5000 rpm for 5 min. The supernatant was discarded, and the above steps were repeated once. The cells were resuspended in 1 mL of pre-chilled CaCl2 containing 15% glycerol and aliquoted into 1.5 mL aliquots. In mL centrifuge tubes, 50 μL / tube, flash-freeze in liquid nitrogen, and store. 70℃, ready for use.

[0042] (7) Agrobacterium transformation and positive colony screening Pick AGL1 competent cells, frozen at 70°C, were thawed on ice; 2 μL of the plasmid to be transformed was added at 50°C. In 100 μL of competent cells, gently mix and incubate on ice for 30 min; place the centrifuge tube in a 28 ℃ metal bath for 5 min, then in liquid nitrogen for 3 min; add 800 mL of LB medium, mix well, and incubate at 28 ℃ with shaking at 180 rpm for 3 h; centrifuge at 5000 rpm for 1 min at room temperature to pellet the cells; aspirate excess medium, retaining approximately 200 μL and spread on LB agar plates (containing 100 mg / L Rif and 50 mg / L Kan; incubate at 28 ℃ upside down for 2-3 days until positive colonies appear). The screening method for positive colonies is the same as described above for Escherichia coli, yielding the positive colony pCAMBIA2300-SbAIF1-GFP-BWM. The pCAMBIA2300-SbAIF1-GFP-BWM positive Agrobacterium obtained through the above experiments is stored in [location missing]. 80℃ ultra-low temperature freezer for standby.

[0043] (II) Agrobacterium-mediated transformation of sorghum (1) Preparation of different culture media: Plant inoculation medium: 4.3 g / L MS salt, 68.5 g / L sucrose, 36 g / L glucose, 0.5 g / L 2-morpholinoethanesulfonic acid (MES), 1.5 mL / L 2,4-D solution, and 10 mL / L vitamin B5 mixed solution. Adjust the pH to 5.2, filter and sterilize, and add 1 mL / L acetylsylgenone stock solution before use.

[0044] Plant co-culture medium: 4.3 g / L MS salt, 20 g / L sucrose, 10 g / L glucose, 0.7 g / L L-proline, 0.5 g / L MES, and 2 mL / L 2,4-D solution. Adjust the pH to 5.8, then add 8 g / L agar powder, 10 mg / L ascorbic acid, and 10 g / L polyvinylpyrrolidone (PVPP), followed by autoclaving. After autoclaving, cool to 50-55 °C, then add 10 mL / L vitamin B5 mixture and 1 mL / L acetylsylgenone solution.

[0045] Plant static medium: 4.3 g / L MS salt, 30 g / L sucrose, 1.0 g / L L-proline, 0.5 g / L MES, 1.5 mL / L 2,4-D solution. Adjust the pH to 5.8, then add 8 g / L agar powder and 10 g / L PVPP, followed by autoclaving. After autoclaving, cool to 50-55 °C. Add 100 mL / L static medium component (RC) stock solution and 1.6 mL / L thiazomycin solution to the medium.

[0046] Plant callus induction medium: 4.3 g / L MS salt, 30 g / L sucrose, 1.0 g / L L-proline, 0.5 g / L LMES, and 1.5 mL / L 2,4-D solution. Adjust the pH to 5.8, then add 8 g / L agar powder and 10 g / L PVPP, followed by autoclaving. After autoclaving, cool to 50-55 °C. Add 100 mL / L RC stock solution, 1.2 mL / L thiazomycin solution, and 1 mL / L Kan solution to the medium.

[0047] Plant germination medium: 4.3 g / L MS salt, 30 g / L sucrose, 0.5 g / L MES. Adjust the pH to 5.8, then add 8 g / L agar powder and 10 g / L PVPP, followed by autoclaving. After autoclaving, cool to 50-55 °C. Add 10 mL / L vitamin B5 mixture, 1 mL / L 6-BAP solution, 1 mL / L IAA solution, 1.2 mL / L thiazolyl succinate, 1.6 mL / L copper sulfate solution, and 1 mL / L Kan solution to the medium.

[0048] Plant rooting medium: 4.3 g / L MS salt, 30 g / L sucrose, 0.5 g / L MES, adjust pH to 5.8, then add 8 g / L agar powder and 10 g / L PVPP, followed by autoclaving. After autoclaving, cool to 50-55 °C. Add 10 mL / L vitamin B5 mixture, 1.2 mL / L thiazolyl succinate solution, 1.6 mL / L copper sulfate solution, 1 mL / L IBA solution, and 1 mL / L Kan solution to the medium.

[0049] 1 / 2 MS medium: 2.4 g / L MS medium, 15 g / L sucrose, 0.5 g / L MES, adjust pH to 5.8. Add 8 g / L agar powder to the solid medium and autoclave.

[0050] LB medium: 25 g / L LB Broth, with 15 g / L agar powder added to the solid medium, and autoclaved at high temperature.

[0051] (2) Transformation of sorghum by tissue culture Prepare Agrobacterium cultures for transformation. Agrobacterium strain AGL1 carrying the pCAMBIA2300-SbAIF1-GFP-BWM plasmid was streaked onto LB solid medium containing Kan and Rif, and cultured at 28°C for 2 days to allow colony growth. A single colony was then selected and transferred to LB liquid medium containing Kan and Rif, and incubated overnight at 28°C and 200 rpm. The next day, Agrobacterium cells were collected and diluted in inoculation medium to an optical density of OD600 nm = 0.4.

[0052] Immature embryos were isolated. Immature seeds were collected from sorghum spikes 12–14 days after flowering and their surfaces were sterilized. In an Erlenmeyer flask, the seeds were treated with a 50% (vol / vol) bleach solution (with 2–3 drops of Tween 20) for 30 min, followed by rinsing with sterile water 3–5 times. The immature embryos were carefully separated from the seeds in a laminar flow hood. Immature embryos measuring 1.0–1.5 mm were selected and placed in inoculation medium for further treatment.

[0053] Transformation and co-culture. Wash the immature embryos with fresh inoculation medium, ensuring minimal coverage. Heat-shock the immature embryos in a 43°C water bath for 3 min, then immediately transfer them to a 25°C metal bath for at least 2 min to cool. Next, immerse the washed immature embryos in the Agrobacterium suspension prepared in step (1) for 10 min. Transfer the treated immature embryos to co-culture medium and incubate in the dark at 25°C for 3 days.

[0054] Callus induction and selection. After step (3), the treated immature embryos were transferred to a static culture medium and placed in the dark at 28°C for 10 days. Subsequently, the embryos were transferred to a callus induction medium under the same conditions and cultured for 10 days to further induce callus formation and select positive transformants.

[0055] Germination. Transfer the surviving callus tissue from the previous step to germination medium and incubate at 28°C with 16 hours of light followed by 8 hours of darkness. Transfer the callus tissue to fresh germination medium every 10 days until seedlings successfully regenerate.

[0056] Rooting. The regenerated seedlings are transplanted into glass bottles containing rooting medium and grown under the same light conditions as during germination for 2–3 weeks to allow root development. Once roots have formed, the seedlings are hardened off for 3 days and then transferred to soil for further growth and to await validation as transgenic plants.

[0057] (III) Screening of homozygous overexpression lines in sorghum After the successfully transformed sorghum seeds mature and are harvested, T1 generation seeds can be obtained. These T1 generation seeds are dried in a 40 ℃ oven for 3 days, then air-dried at room temperature for 10 days. Allowing the sorghum seeds to fully mature before germination can improve the germination rate. The screening steps for positive T1 generation seedlings are as follows.

[0058] (1) Kan screening Sterilize mature T1 generation seeds by first immersing them in 75% ethanol for 1 min, then sterilizing them with 50% sodium hypochlorite for 30 min, and washing them 4-5 times with dH2O. Prepare 1 / 2 MS solid medium, sterilize it, and when the temperature is about 50-60℃, add Kan to make a final concentration of 50 mg / L, mix well, and pour it into sterilized culture bottles. Air-dry the bottles in a clean bench for about 1 h. Place the sterilized sorghum seeds on the surface of the medium, seal them, and place them in a 28℃ incubator for 2 weeks, with 16 h of light and 8 h of darkness. After 2 weeks, the transgenic sorghum seedlings will grow well in the Kan medium, with green leaves and normal growth. The leaves of the non-transgenic Arabidopsis seedlings will turn white. Transfer the well-grown transgenic sorghum seedlings to loose soil for further growth.

[0059] (2) DNA verification DNA was extracted from 84 selected positive seedlings. Using the DNA as a template, PCR amplification was performed using primers 35S-F (ATCCTTCGCAAGACCTTC) / NPTII-R (CCAACGCTATGTCCTGATA) on the pCAMBIA2300-GFP-BWM vector to verify whether the initially screened positive seedlings contained the introduced recombinant vector. DNA extraction was performed using the CTAB method, as follows: A small amount of sorghum leaves was placed in a 2 mL centrifuge tube, a 4 mm diameter steel bead was added, and the tube was frozen in liquid nitrogen. The mixture was then ground into powder using a high-throughput tissue homogenizer. 500 mL of CTAB extraction buffer (1.17 M NaCl, 0.0016 MEDTA) preheated to 65°C was added. 8.0, 0.835 M Ttis 7.5%, 1.6% CTAB, 1% β Mercaptoethanol), mix well; react in a 65℃ water bath for 45 min, carefully shaking the centrifuge tube every 15 min; remove the centrifuge tube, and after cooling to room temperature, add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), carefully shake the test tube for 10 min, and let stand for 10 min; centrifuge at 8000 rpm for 10 min at room temperature, and transfer the supernatant to another 1.5 mL centrifuge tube using a pipette tip with the cut-off end. If the supernatant is still green, repeat the previous step; add 2 / 3 volume of isopropanol ( Mix carefully by inverting the container several times (at 20℃), incubate at 12000 rpm, 4℃, for 10 min; discard the supernatant, add 400 μL of 75% ethanol, wash twice, remove any remaining ethanol with a pipette tip, and dry at room temperature until the ethanol has evaporated completely; once the DNA is dry and transparent, add 20 μL of ddH2O (pH 8.0) to dissolve the DNA; pipette 2 μL of DNA, add loading buffer, and assess the DNA quality using a 1.0% agarose gel, and determine the DNA concentration using a micro spectrophotometer; store the DNA in [location missing]. Store in a refrigerator at 20°C for later use.

[0060] Using the extracted DNA as a template, PCR amplification was performed using primers 35S-F (ATCCTTCGCAAGACCTTC) / NPT-R (CCAACGCTATGTCCTGATA) on the pCAMBIA2300-GFP-BWM vector. After agarose gel electrophoresis, the target band was obtained. Plants with the target band were those containing the recombinant vector; plants without the recombinant vector were discarded. Plants containing the recombinant vector continued to grow until seed maturity, and T2 generation seeds were harvested.

[0061] Identification of homozygous lines with different expression levels (1) Identification of homozygous lines Screening for homozygous non-separating Seeds from positive sorghum seedlings were collected from T1 generation seedlings at a ratio of 3:1 to 3:1 (positive to false positive). Seeds from individual T2 generation seedlings were dried for 10 days, sterilized, and germinated in 1 / 2 MS medium containing Kans. 100 seeds were selected from each positive seedling. After germination, the positivity rate on antibiotic medium was calculated (since T1 generation seeds showed a 3:1 segregation, only seeds from T2 that germinated completely were considered homozygous positive lines). Lines from T2 generation seedlings that were entirely green were considered candidate homozygous lines.

[0062] (2) Screening of homozygous lines with different expression levels Leaves were selected from sorghum plants of 6 homozygous lines, with 10 plants from each line. RNA was extracted from the leaves, reverse transcribed into cDNA, and then analyzed using RT-PCR. PCR experiments were conducted to determine the gene expression levels of different strains, and homozygous strains with different expression levels were screened. Two strains with higher expression levels were selected, namely OE1 and OE2. The relative gene expression levels are shown below. Figure 2 As shown.

[0063] Example 2 Treatment of pathogen infection (a) Preparation of different culture media (1) PDA medium: 200 g fresh potatoes were boiled in 1 L ddH2O for 30 min, filtered through 4 layers of gauze, the filtrate was collected, and the volume was adjusted to 1 L. 20 g / L glucose and 20 g / L agar powder were added and sterilized by high temperature and high pressure.

[0064] (2) V8 liquid culture medium: 200 mL V8 original vegetable juice ddH2O was brought to a final volume of 1L and sterilized under high temperature and high pressure.

[0065] (ii) Anthrax infection (1) Sorghum anthracnose fungus ( Colletotrichum sublineolum Preparation of spore suspension Anthracnose strains of sorghum were activated on PDA agar plates. After 14 days, the bacterial blocks were transferred to Erlenmeyer flasks containing 100 mL of V8 liquid medium and cultured at 25°C with a shaker at 130 rpm for 7 days (12 h dark / 12 h light). The bacterial suspension was filtered through four layers of filter paper and centrifuged at 5000 rpm for 15 min to obtain anthracnose spores. The spores were resuspended in sterile water, counted using a hemocytometer, and the spore suspension concentration was adjusted to 5 × 10⁻⁶. 6 per mL.

[0066] (2) In vitro inoculation of anthrax bacteria on sorghum leaves Place two layers of filter paper in a petri dish and moisten the filter paper with 10 mL of sterile distilled water. Take the third leaf of a 2-week-old sorghum seedling, place it on the moistened filter paper, and inoculate the leaf with 10 droplets on each leaf. Each droplet contains 5 μL of spore suspension. Incubate the petri dishes in the dark for 24 hours in a light incubator at 30°C and 95% humidity, and then transfer them to a sorghum light incubator.

[0067] (3) Phenotypic analysis of anthrax infection Four days after inoculation, photographs were taken, and the size of the lesions was determined using ImageJ software. Five lesions were taken as one biological sample, and DNA was extracted. The expression level of the anthracnose Internally Transscribed Spacer 2 (ITS2) gene was detected by qPCR to measure the fungal growth. The internal reference gene was Eukaryotic Translation Initiation Factor 4α (SbEIF4α).

[0068] The CsITS2 primer sequences are: CsITS2-F: CGTCGTAGGCCCTTAAAGGTAG, CsITS-R: TTACGGCAAGAGTCCCTC; The primer sequences for SbEIF4α are: SbEIF4α-F: CAACTTTGTCACCCGCGATGA, SbEIF4α-R: TCCAGAAACCTTAGCAGCCCA.

[0069] The results are as follows Figure 3 As shown in a, b, and c, SbAIF1 The overexpressing plants showed significantly stronger resistance to anthracnose than the wild type (Fig. a); compared to the wild type, SbAIF1 The bacterial infection area and bacterial biomass in the overexpressing plants were significantly lower than those in the wild type (Figures b and c).

[0070] (iii) Alternaria infection (1) Preparation of Alternaria mycelium Alternaria sorghum ( Alternaria alternata The cells were activated and grown on PDA medium plates for 14 days.

[0071] (2) In vitro inoculation of Alternaria alternata on sorghum leaves Four layers of sterile filter paper were placed in a 13×13 cm petri dish, and 15 mL of sterile dH2O was added to moisten the filter paper. The third leaf of a 14-day-old sorghum seedling, approximately 3 cm in length, was placed on the filter paper. Holes were punched in the plate covered with colonies, with each mycelial block having a diameter of 5 mm. The mycelial blocks were placed in the middle of the leaf and covered with moistened, sterile absorbent cotton. The control group had sterile PDA culture blocks placed on the leaves. The petri dishes were placed in an incubator at 28℃ and 95% humidity for 24 h in the dark, followed by 12 h of light and 12 h of darkness for continued incubation. The incubation was observed daily after inoculation. On the second day, after the mycelium had invaded the leaf, the mycelial blocks were removed and incubation continued.

[0072] (3) Phenotypic analysis of Alternaria infection Photographs were taken, and the area of ​​lesions was measured and counted using ImageJ. Two lesions were collected as one biological sample, and DNA was extracted. Using the SbEIF4α gene of sorghum as an internal control, the expression level of the AaITS2 gene of Alternaria leaf spot pathogen was detected by qPCR to measure the growth of Alternaria.

[0073] The primer sequences for AaITS2 are: AaITS2-F: GTGCCTTCCCCCAAGGTCTCCG, AaITS2-R: CGGAAACGAGGTGGTTCAGGTC.

[0074] The results are as follows Figure 3 As shown in D, E, and F, SbAIF1 The overexpressing plants showed significantly stronger resistance to Alternaria compared to the wild type. Figure 3 A); Compared to the wild type, SbAIF1 The bacterial infection area and bacterial biomass in overexpressing plants were significantly lower than those in wild-type plants. Figure 3 (B and C).

[0075] (iv) Transcriptome analysis and JA content determination (1) Transcriptome analysis of wild-type and SbAIF1 overexpressing plants To further investigate the mechanism by which SbAIF1 enhances the broad-spectrum disease resistance of sorghum, this study conducted transcriptome sequencing. Two weeks-old wild-type sorghum plants and SbAIF1-overexpressing plants were used as samples, and transcriptome sequencing was performed at Beijing Biomarker Biotechnology Co., Ltd.

[0076] (2) Differentially expressed gene analysis Enrichment analysis of differentially expressed genes using the Kyoto Encyclopedia of Genes and Genomes (KEGG) yielded the following results: Figure 4 As shown in Figure A, these genes are significantly enriched in the jasmonic acid-mediated signaling pathway. Further heatmap analysis of genes related to this pathway revealed the following results: Figure 4 As shown in B, key genes in the jasmonic acid signaling pathway were significantly upregulated in SBAIF1-overexpressing plants.

[0077] (3) Determination of jasmonic acid content The jasmonic acid content was determined using an ELISA kit: a double-antibody sandwich method was employed. A solid-phase antibody was prepared by coating microplates with purified jasmonic acid antibody. Jasmonic acid in the sample formed a complex with Horseradish peroxidase (HRP)-labeled jasmonic acid antibody. After washing, 3,3',5,5'-Tetramethylbenzidine (TMB) was added for color development. The absorbance (OD value) at 450 nm was measured using a microplate reader, and the jasmonic acid content was calculated based on a standard curve. Results are as follows: Figure 4 As shown in C, SbAIF1 The JA content in overexpressing plants was significantly higher than that in wild-type plants.

[0078] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of substances that upregulate, enhance, or increase the expression of protein-coding genes, or substances that upregulate, enhance, or increase the activity or content of proteins, in enhancing plant disease resistance; The protein is any one of the following: (a1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; (a2) The protein described in (a1) is obtained by substituting and / or deleting and / or adding amino acids to obtain a protein that has more than 80% identity with and has the same function as the protein shown in (a1). (a3) A fusion protein obtained by linking the N-terminus and / or C-terminus of (a1) or (a2) to a protein tag; The plant in question is sorghum.

2. The application as described in claim 1, characterized in that, The enhancement of plant disease resistance refers to enhancing the plant's ability to resist pathogen infection; the pathogens include *Anthracnose sorghum* and *Alternaria sorghum*.

3. The application of substances that upregulate, enhance, or increase the expression of protein-coding genes, or substances that upregulate, enhance, or increase the activity or content of proteins, in increasing the jasmonic acid content in plant plants; The protein is any one of the following: (a1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; (a2) The protein described in (a1) is obtained by substituting and / or deleting and / or adding amino acids to obtain a protein that has more than 80% identity with and has the same function as the protein shown in (a1). (a3) A fusion protein obtained by linking the N-terminus and / or C-terminus of (a1) or (a2) to a protein tag; The plant in question is sorghum.

4. The application as described in claim 1 or claim 3, characterized in that, The substance that upregulates, enhances, or increases the expression of the protein-coding gene, or the substance that upregulates, enhances, or increases the activity or content of the protein, is any one of the following: (b1) A nucleic acid molecule encoding the protein shown in SEQ ID NO:1 with the amino acid sequence; (b2) An expression cassette containing the nucleic acid molecule described in (b1); (b3) A recombinant vector containing the nucleic acid molecule described in (b1), or a recombinant vector containing the expression cassette described in (b2); (b4) Recombinant microorganisms containing the nucleic acid molecule described in (b1), or recombinant microorganisms containing the expression cassette described in (b2), or recombinant microorganisms containing the recombinant vector described in (b3); (b5) A transgenic plant cell line containing the nucleic acid molecule described in (b1), or a transgenic plant cell line containing the expression cassette described in (b2), or a transgenic plant cell line containing the recombinant vector described in (b3); (b6) A transgenic plant tissue containing the nucleic acid molecule described in (b1), or a transgenic plant tissue containing the expression cassette described in (b2), or a transgenic plant tissue containing the recombinant vector described in (b3); (b7) A transgenic plant organ containing the nucleic acid molecule described in (b1), or a transgenic plant organ containing the expression cassette described in (b2), or a transgenic plant organ containing the recombinant vector described in (b3).

5. A method for cultivating disease-resistant plant plants, characterized in that, This includes upregulating or enhancing or increasing the expression of protein-coding genes in the target plant, and / or increasing the activity and / or content of proteins to obtain disease-resistant plant plants. The protein is any one of the following: (a1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; (a2) The protein described in (a1) is obtained by substituting and / or deleting and / or adding amino acids to obtain a protein that has more than 80% identity with and has the same function as the protein shown in (a1). (a3) A fusion protein obtained by linking the N-terminus and / or C-terminus of (a1) or (a2) to a protein tag; The plant is sorghum; the disease resistance refers to the enhanced ability of the plant to resist infection by pathogens; the pathogens include sorghum anthracnose and sorghum algae.

6. A method for increasing the jasmonic acid content in plant plants, characterized in that, This includes upregulating or enhancing or increasing the expression of protein-coding genes in the target plant, and / or increasing the activity and / or content of proteins; The protein is any one of the following: (a1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; (a2) The protein described in (a1) is obtained by substituting and / or deleting and / or adding amino acids to obtain a protein that has more than 80% identity with and has the same function as the protein shown in (a1). (a3) A fusion protein obtained by linking the N-terminus and / or C-terminus of (a1) or (a2) to a protein tag; The plant in question is sorghum.

7. A method for cultivating transgenic plantlets, characterized in that, This includes upregulating or enhancing or increasing the expression of protein-coding genes in the target plant, and / or increasing the activity and / or content of proteins; The protein is any one of the following: (a1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; (a2) The protein described in (a1) is obtained by substituting and / or deleting and / or adding amino acids to obtain a protein that has more than 80% identity with and has the same function as the protein shown in (a1). (a3) A fusion protein obtained by linking the N-terminus and / or C-terminus of (a1) or (a2) to a protein tag; The plant in question is sorghum.

8. The application of the method according to any one of claims 5 to 7 in plant breeding.

9. The application as described in claim 8, characterized in that, Breeding methods include hybridization, backcrossing, self-pollination, or asexual reproduction.

10. A type of sorghum with broad-spectrum disease resistance, characterized in that, The sorghum genome incorporates exogenous nucleic acid molecules, which contain the coding sequence of the SbAIF1 gene, as shown in SEQ ID NO:3.

Images