DdPCR platform-based replicative virus rapid detection method
By using primer and probe combinations and Linkage values in the ddPCR platform, the problems of false positives and insufficient sensitivity in the qPCR method have been solved, achieving high sensitivity and accurate detection of replicating viruses and ensuring the safety of CAR-T cell therapy.
Patent Information
- Application Number
- CN202511601590.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-04
- Publication Date
- 2026-04-14
AI Technical Summary
Existing qPCR methods are prone to false positives, interference from plasmid residues, and insufficient sensitivity when detecting replicating viruses, making it difficult to effectively detect replicating lentiviruses and leading to the risk of secondary cancer in CAR-T cell therapy.
A method based on the ddPCR platform was adopted, which introduced primer and probe combinations targeting GagPol, Rev and VSV-G sequences, combined with droplet generation and PCR amplification, and used the Linkage value to determine whether the sample contains replicating virus, so as to achieve rapid and accurate detection.
It achieves highly sensitive detection of replicating viruses, with a sensitivity of up to 2.5 copies/μl, significantly improving the accuracy and specificity of detection, avoiding false positive results, and meeting the quality control requirements of CAR-T cell therapy.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, and more specifically to a rapid detection method for replicating viruses based on the ddPCR platform. Background Technology
[0002] CAR-T (Chimeric Antigen Receptor T-Cell) is a treatment that modifies human T cells in vitro through genetic engineering to enable them to recognize and efficiently kill tumor cells, and then reinfuses them into the patient's body to treat malignant tumors.
[0003] In CAR-T cell therapy, viral vectors (such as lentiviruses and retroviruses) are typically used for transduction. Lentiviral vectors are widely used in cell therapy. The latest lentivirus production process utilizes the third-generation plasmid system, which distributes all essential lentiviral components onto the packaging plasmids pRRE and pRSV-Rev, the capsid plasmid pMD2.G, and the shuttle plasmid. The design of the third-generation plasmid system makes it more difficult to generate self-replicating lentiviruses. However, recombination can still occur between vector components or between the vector and the cell genome, potentially leading to the generation of replicating lentiviruses (RCLs). Once RCLs are generated, they can integrate with the cell genome, posing a secondary cancer risk. Currently, regulatory agencies both domestically and internationally require that RCLs be undetectable.
[0004] The "Technical Guidelines for In Vitro Genetically Modified Systemic Pharmaceutical Research and Evaluation (Trial)" document proposes that for the detection of RCL, p24 protein, reverse transcriptase activity, psi-gag, and VSV-G sequences are commonly used to reflect the presence of RCL. Appropriate detection indicators should be selected based on the viral vector, specific circumstances, and research conditions. Currently, qPCR, one of the commonly used rapid detection methods for RCL, operates as follows: Genomic DNA is extracted from the sample; primers and probes designed for the VSV-G sequence are used; a standard curve is created by diluting standard DNA containing the VSV-G sequence; and qPCR quantitative detection is then performed.
[0005] RCL's qPCR rapid detection method, which only quantifies VSV-G copy number, often encounters the following three problems: 1. In the third-generation lentivirus production process, the VSV-G sequence is mainly distributed on the packaging plasmid pMD2.G. Therefore, the detection of the VSV-G sequence is often affected by plasmid residues from the lentivirus process, resulting in false positives. 2. The qPCR experimental protocol requires a standard curve. The standard curve following the experiment has a high concentration of VSV-G copy number, which may contaminate the sample. 3. qPCR sensitivity is poor; the lowest point of the standard curve is often only around 10 copies / μl.
[0006] Therefore, there is an urgent need in this field to develop a new method that can quickly detect replicating viruses, thereby enabling better quality control of CAR-T. Summary of the Invention
[0007] The purpose of this invention is to provide a rapid detection method for replicating viruses based on the ddPCR platform and its application.
[0008] In a first aspect of the present invention, a rapid detection method for replicating viruses based on a ddPCR platform is provided, the method comprising the steps of: (S1) Provide a sample to be tested, wherein the sample to be tested is a DNA sample; (S2) Prepare the ddPCR reaction system, add the sample to be tested, mix well, and then generate droplets; The ddPCR reaction system includes primer-probe combinations selected from the group consisting of GagPol primer pairs, GagPol probes, Rev primer pairs, Rev probes, VSV-G primer pairs, VSV-G probes, or combinations thereof, targeting GagPol sequences, Rev sequences, and / or VSV-G sequences. (S3) After the droplets are generated, PCR amplification is performed, and the droplets are read to obtain the droplet count. The droplet count results include the droplet counts of Ch1+Ch2+, Ch1+Ch2-, Ch1-Ch2+, and Ch1-Ch2-, as well as the total droplet count of Accepted Droplets. Ch1+Ch2- droplet counts are named NA, Ch1-Ch2+ droplet counts are named NB, Ch1-Ch2- droplet counts are named NE, and the Accepted Droplet count is named NTOT. The Linkage is calculated using the following formula: ) / 0.85 ; (S4) Determine whether the sample to be tested is positive or negative based on the Linkage results; A linkage (copies / 20μl) ≥1 is considered positive, and a linkage (copies / 20μl) <1 is considered negative. A positive result indicates that the sample contains replicating virus, while a negative result indicates that the sample does not contain or contains virtually no replicating virus.
[0009] In another preferred embodiment, the sample to be tested is a CAR-T DNA sample.
[0010] In another preferred embodiment, the CAR-T DNA sample is a DNA extraction sample of the CAR-T genome.
[0011] In another preferred embodiment, the mass of the sample to be tested is 40 ng-400 ng, more preferably 50 ng-300 ng, more preferably 70 ng-200 ng, and most preferably 100 ng-150 ng, such as 105 ng, 110 ng, 115 ng, 120 ng, 125 ng, 130 ng, 135 ng, 140 ng, or 145 ng.
[0012] In another preferred embodiment, the concentration of the sample to be tested is 10 ng / μl-100 ng / μl, more preferably 15 ng / μl-50 ng / μl, more preferably 20 ng / μl-30 ng / μl, such as 21 ng / μl, 22 ng / μl, 23 ng / μl, 24 ng / μl, 25 ng / μl, 26 ng / μl, 27 ng / μl, 28 ng / μl, 29 ng / μl.
[0013] In another preferred embodiment, the loading volume of the sample to be tested is 0.1 μl-20 μl, more preferably 1 μl-10 μl, more preferably 3 μl-5 μl, such as 4.0 μl, 4.1 μl, 4.2 μl, 4.3 μl, 4.4 μl, 4.5 μl, 4.6 μl, 4.7 μl, 4.8 μl, or 4.9 μl.
[0014] In another preferred embodiment, the replicating virus is selected from the group consisting of replicating lentiviruses (RCL), replicating retroviruses (RCR), or combinations thereof.
[0015] In another preferred embodiment, the Rev sequence is SEQ ID NO: 1.
[0016] In another preferred embodiment, the GagPol sequence is SEQ ID NO: 2.
[0017] In another preferred embodiment, the VSV-G sequence is SEQ ID NO: 3.
[0018] In another preferred embodiment, the primer-probe combination includes: GagPol primer pairs, GagPol probes, Rev primer pairs, and Rev probes.
[0019] In another preferred embodiment, the primer-probe combination includes: GagPol primer pairs, GagPol probes, VSV-G primer pairs, and VSV-G probes.
[0020] In another preferred embodiment, when the replicating virus is a replicating lentivirus (RCL), the primer-probe combination includes: GagPol primer pair, GagPol probe, Rev primer pair and Rev probe.
[0021] In another preferred embodiment, when the replicating virus is a replicating retrovirus (RCR), the primer-probe combination includes: GagPol primer pair, GagPol probe, VSV-G primer pair and VSV-G probe.
[0022] In another preferred embodiment, the GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively.
[0023] In another preferred embodiment, the sequence of the GagPol probe is SEQ ID NO: 6 and / or SEQ ID NO: 7.
[0024] In another preferred embodiment, the Rev primer pair includes Rev-F and Rev-R, whose sequences are SEQ ID NO:8 and SEQ ID NO:9, respectively.
[0025] In another preferred embodiment, the Rev probe has the sequence SEQ ID NO: 10.
[0026] In another preferred embodiment, the VSV-G primer pair includes VSVG-F and VSVG-R, whose sequences are SEQ ID NO: 11 and SEQ ID NO: 12, respectively.
[0027] In another preferred embodiment, the sequence of the VSV-G probe is SEQ ID NO: 13.
[0028] In another preferred embodiment, the probe is a probe with a detectable marker.
[0029] In another preferred embodiment, the probe is a probe with a fluorescent label.
[0030] In another preferred embodiment, the fluorescent label includes: FAM, VIC, HEX, ROX, Cy3, Cy5.
[0031] In another preferred embodiment, the GagPol probe is labeled with FAM or HEX fluorescent tags.
[0032] In another preferred embodiment, the GagPol probe has the sequence SEQ ID NO: 6 and is labeled with FAM fluorescence.
[0033] In another preferred embodiment, the GagPol probe has the sequence SEQ ID NO: 7 and is labeled with HEX fluorescence.
[0034] In another preferred embodiment, the Rev probe is labeled with HEX fluorescence.
[0035] In another preferred embodiment, the VSV-G probe is labeled with FAM fluorescent markers.
[0036] In another preferred embodiment, when the replicating virus is a replicating lentivirus (RCL), the primer-probe combination includes: GagPol primer pair, GagPol probe, Rev primer pair and Rev probe; The GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The GagPol probe has the sequence SEQ ID NO: 6 and is labeled with FAM fluorescence. The Rev primer pair includes Rev-F and Rev-R, whose sequences are SEQ ID NO: 8 and SEQ ID NO: 9, respectively. The Rev probe has the sequence SEQ ID NO: 10 and is labeled with HEX fluorescence.
[0037] In another preferred embodiment, when the replicating virus is a replicating retrovirus (RCR), the primer-probe combination includes: GagPol primer pair, GagPol probe, VSV-G primer pair and VSV-G probe; The GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The GagPol probe has the sequence SEQ ID NO: 7 and is labeled with HEX fluorescence. The VSV-G primer pair includes VSVG-F and VSVG-R, whose sequences are SEQ ID NO: 11 and SEQ ID NO: 12, respectively. The sequence of the VSV-G probe is SEQ ID NO: 13 and is labeled with FAM fluorescence.
[0038] In another preferred example, the method further includes the step of: providing a positive standard, which is a linear DNA sample obtained by digesting a DNA standard plasmid with the restriction enzyme BtsⅠ. The DNA standard plasmid includes a combination of three sequences: Rev, GagPol, and VSV-G.
[0039] In another preferred example, the positive standard includes a combination of three sequences: Rev, GagPol, and VSV-G.
[0040] In another preferred example, the positive standard is prepared into a specification of 1000 copies / μl and stored for later use.
[0041] In another preferred example, the method further includes the step of: providing a negative standard, which is a sample obtained by digesting a DNA standard plasmid with the restriction enzyme RsaⅠ. The DNA standard plasmid includes a combination of three sequences: Rev, GagPol, and VSV-G and has a total of five RsaⅠ restriction sites. After the digestion treatment, there is no Linkage between GagPol and VSV-G or Rev in the negative standard.
[0042] In another preferred example, the negative standard is prepared into a specification of 1000 copies / μl and stored for later use.
[0043] In another preferred example, the method further includes the step of: providing a blank control, such as a blank T cell (MockT).
[0044] In another preferred example, the method further includes the steps of: generating droplets and performing ddPCR amplification on the positive standard, negative standard, and / or blank control, and obtaining Linkage results, so as to perform quality control on the method.
[0045] In another preferred example, if the Linkage results of the positive standard, negative standard, and / or blank control meet the following criteria, it indicates that the method passes the detection: (a) The positive standard is determined to be positive according to the Linkage result; and / or (b) The negative standard or blank control is determined to be negative according to the Linkage result.
[0046] In another preferred embodiment, the method is considered unqualified if the Linkage results of the positive standard, negative standard, and / or blank control meet any of the following criteria: (a) The positive standard was determined to be negative according to the Linkage results; (b) The negative standard or blank control is determined to be positive according to the Linkage results.
[0047] In another preferred embodiment, the ddPCR reaction system further includes: DNA polymerase, dNTPs, buffer, BSA, DMSO, glycerol, or a combination thereof.
[0048] In a second aspect of the invention, a ddPCR reaction system for rapid detection of replicating viruses is provided, the ddPCR reaction system comprising the following components: (a) Primer-probe combinations selected from the group consisting of GagPol primer pairs, GagPol probes, Rev primer pairs, Rev probes, VSV-G primer pairs, VSV-G probes, or combinations thereof, targeting GagPol, Rev, and / or VSV-G sequences; (b) DNA polymerase; (c) dNTPs; and (d) Buffer solution.
[0049] In another preferred embodiment, the ddPCR reaction system further includes additives selected from the group consisting of BSA, DMSO, glycerol, or combinations thereof.
[0050] In another preferred embodiment, the replicating virus is selected from the group consisting of replicating lentiviruses (RCL), replicating retroviruses (RCR), or combinations thereof.
[0051] In another preferred embodiment, the Rev sequence is SEQ ID NO: 1.
[0052] In another preferred embodiment, the GagPol sequence is SEQ ID NO: 2.
[0053] In another preferred embodiment, the VSV-G sequence is SEQ ID NO: 3.
[0054] In another preferred embodiment, the primer-probe combination includes: GagPol primer pairs, GagPol probes, Rev primer pairs, and Rev probes.
[0055] In another preferred embodiment, the primer-probe combination includes: GagPol primer pairs, GagPol probes, VSV-G primer pairs, and VSV-G probes.
[0056] In another preferred embodiment, when the replicating virus is a replicating lentivirus (RCL), the primer-probe combination includes: GagPol primer pair, GagPol probe, Rev primer pair and Rev probe.
[0057] In another preferred embodiment, when the replicating virus is a replicating retrovirus (RCR), the primer-probe combination includes: GagPol primer pair, GagPol probe, VSV-G primer pair and VSV-G probe.
[0058] In another preferred embodiment, the GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively.
[0059] In another preferred embodiment, the sequence of the GagPol probe is SEQ ID NO: 6 and / or SEQ ID NO: 7.
[0060] In another preferred embodiment, the Rev primer pair includes Rev-F and Rev-R, whose sequences are SEQ ID NO:8 and SEQ ID NO:9, respectively.
[0061] In another preferred embodiment, the Rev probe has the sequence SEQ ID NO: 10.
[0062] In another preferred embodiment, the VSV-G primer pair includes VSVG-F and VSVG-R, whose sequences are SEQ ID NO: 11 and SEQ ID NO: 12, respectively.
[0063] In another preferred embodiment, the sequence of the VSV-G probe is SEQ ID NO: 13.
[0064] In another preferred embodiment, the probe is a probe with a detectable marker.
[0065] In another preferred embodiment, the probe is a probe with a fluorescent label.
[0066] In another preferred embodiment, the fluorescent label includes: FAM, VIC, HEX, ROX, Cy3, Cy5.
[0067] In another preferred embodiment, the GagPol probe is labeled with FAM or HEX fluorescent tags.
[0068] In another preferred embodiment, the GagPol probe has the sequence SEQ ID NO: 6 and is labeled with FAM fluorescence.
[0069] In another preferred embodiment, the GagPol probe has the sequence SEQ ID NO: 7 and is labeled with HEX fluorescence.
[0070] In another preferred embodiment, the Rev probe is labeled with HEX fluorescence.
[0071] In another preferred embodiment, the VSV-G probe is labeled with FAM fluorescent markers.
[0072] In another preferred embodiment, when the replicating virus is a replicating lentivirus (RCL), the primer-probe combination includes: GagPol primer pair, GagPol probe, Rev primer pair and Rev probe; The GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The GagPol probe has the sequence SEQ ID NO: 6 and is labeled with FAM fluorescence. The Rev primer pair includes Rev-F and Rev-R, whose sequences are SEQ ID NO: 8 and SEQ ID NO: 9, respectively. The Rev probe has the sequence SEQ ID NO: 10 and is labeled with HEX fluorescence.
[0073] In another preferred embodiment, when the replicating virus is a replicating retrovirus (RCR), the primer-probe combination includes: GagPol primer pair, GagPol probe, VSV-G primer pair and VSV-G probe; The GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The GagPol probe has the sequence SEQ ID NO: 7 and is labeled with HEX fluorescence. The VSV-G primer pair includes VSVG-F and VSVG-R, whose sequences are SEQ ID NO: 11 and SEQ ID NO: 12, respectively. The sequence of the VSV-G probe is SEQ ID NO: 13, and it is labeled with FAM fluorescence.
[0074] In a third aspect of the present invention, a rapid detection kit for replicating viruses based on the ddPCR platform is provided, the kit comprising: (Z1) A first container, and a primer-probe combination selected from the group consisting of GagPol primer pairs, GagPol probes, Rev primer pairs, Rev probes, VSV-G primer pairs, VSV-G probes, or combinations thereof, located within the first container for GagPol sequences, Rev sequences, and / or VSV-G sequences.
[0075] In another preferred embodiment, the Rev sequence is SEQ ID NO: 1.
[0076] In another preferred embodiment, the GagPol sequence is SEQ ID NO: 2.
[0077] In another preferred embodiment, the VSV-G sequence is SEQ ID NO: 3.
[0078] In another preferred embodiment, the primer-probe combination includes: GagPol primer pairs, GagPol probes, Rev primer pairs, and Rev probes.
[0079] In another preferred embodiment, the primer-probe combination includes: GagPol primer pairs, GagPol probes, VSV-G primer pairs, and VSV-G probes.
[0080] In another preferred embodiment, when the replicating virus is a replicating lentivirus (RCL), the primer-probe combination includes: GagPol primer pair, GagPol probe, Rev primer pair and Rev probe.
[0081] In another preferred embodiment, when the replicating virus is a replicating retrovirus (RCR), the primer-probe combination includes: GagPol primer pair, GagPol probe, VSV-G primer pair and VSV-G probe.
[0082] In another preferred embodiment, the GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively.
[0083] In another preferred embodiment, the sequence of the GagPol probe is SEQ ID NO: 6 and / or SEQ ID NO: 7.
[0084] In another preferred embodiment, the Rev primer pair includes Rev-F and Rev-R, whose sequences are SEQ ID NO:8 and SEQ ID NO:9, respectively.
[0085] In another preferred embodiment, the Rev probe has the sequence SEQ ID NO: 10.
[0086] In another preferred embodiment, the VSV-G primer pair includes VSVG-F and VSVG-R, whose sequences are SEQ ID NO: 11 and SEQ ID NO: 12, respectively.
[0087] In another preferred embodiment, the sequence of the VSV-G probe is SEQ ID NO: 13.
[0088] In another preferred embodiment, the probe is a probe with a detectable marker.
[0089] In another preferred embodiment, the probe is a probe with a fluorescent label.
[0090] In another preferred embodiment, the fluorescent label includes: FAM, VIC, HEX, ROX, Cy3, Cy5.
[0091] In another preferred embodiment, the GagPol probe is labeled with FAM or HEX fluorescent tags.
[0092] In another preferred embodiment, the GagPol probe has the sequence SEQ ID NO: 6 and is labeled with FAM fluorescence.
[0093] In another preferred embodiment, the GagPol probe has the sequence SEQ ID NO: 7 and is labeled with HEX fluorescence.
[0094] In another preferred embodiment, the Rev probe is labeled with HEX fluorescence.
[0095] In another preferred embodiment, the VSV-G probe is labeled with FAM fluorescent markers.
[0096] In another preferred embodiment, when the replicating virus is a replicating lentivirus (RCL), the primer-probe combination includes: GagPol primer pair, GagPol probe, Rev primer pair and Rev probe; The GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The GagPol probe has the sequence SEQ ID NO: 6 and is labeled with FAM fluorescence. The Rev primer pair includes Rev-F and Rev-R, whose sequences are SEQ ID NO: 8 and SEQ ID NO: 9, respectively. The Rev probe has the sequence SEQ ID NO: 10 and is labeled with HEX fluorescence.
[0097] In another preferred embodiment, when the replicating virus is a replicating retrovirus (RCR), the primer-probe combination includes: GagPol primer pair, GagPol probe, VSV-G primer pair and VSV-G probe; The GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The GagPol probe has the sequence SEQ ID NO: 7 and is labeled with HEX fluorescence. The VSV-G primer pair includes VSVG-F and VSVG-R, whose sequences are SEQ ID NO: 11 and SEQ ID NO: 12, respectively. The sequence of the VSV-G probe is SEQ ID NO: 13, and it is labeled with FAM fluorescence.
[0098] In another preferred embodiment, the kit further includes: (Z2) The second container, and the ddPCR reagent located in the second container.
[0099] In another preferred embodiment, the ddPCR reagent includes: DNA polymerase, dNTPs, droplet generating oil, reaction buffer, droplet reading oil, nucleic acid extraction reagent, TE buffer, PF-68 droplet generating card, or a combination thereof.
[0100] In another preferred embodiment, the kit further includes: (Z3) The third container, and the positive standard, negative standard and / or blank control contained in the third container.
[0101] In another preferred embodiment, the positive standard is a linear DNA sample obtained by digesting a DNA standard plasmid with the restriction endonuclease BtsⅠ. The DNA standard quality plasmid includes a combination of three sequences: Rev, GagPol, and VSV-G.
[0102] In another preferred embodiment, the negative standard is a sample obtained by digesting a DNA standard plasmid with the restriction endonuclease RsaⅠ. The DNA standard plasmid includes a combination of three sequences: Rev, GagPol, and VSV-G, and has a total of five RsaI restriction sites. After enzyme digestion, no linkage exists between GagPol and VSV-G or Rev in the negative standard.
[0103] In another preferred embodiment, the blank control is blank T cells (Mock T).
[0104] In another preferred embodiment, one or more of the first container, the second container, and the third container may be the same container or different containers.
[0105] In another preferred embodiment, the first container and the second container are the same container, and their contents are mixed to form a ddPCR reaction system.
[0106] In another preferred embodiment, the ddPCR reaction system is the ddPCR reaction system described in the second aspect of the present invention.
[0107] In a fourth aspect of the present invention, a rapid detection device for replication viruses based on a ddPCR platform is provided, the device comprising: (M1) Sample input module, the sample input module being configured to provide a sample to be tested for detection, the sample to be tested being a DNA sample; (M2) ddPCR reaction system module, wherein the ddPCR reaction system module is configured to: prepare ddPCR reaction system therein, or contain a pre-prepared and pre-added ddPCR reaction system; The ddPCR reaction system includes primer-probe combinations selected from the group consisting of GagPol primer pairs, GagPol probes, Rev primer pairs, Rev probes, VSV-G primer pairs, VSV-G probes, or combinations thereof, targeting GagPol sequences, Rev sequences, and / or VSV-G sequences. (M3) Sample addition and mixing module, wherein the sample addition and mixing module is configured to: mix the ddPCR reaction system with the sample to be tested evenly; (M4) Droplet generation module, the droplet generation module being configured to generate droplets from the mixture homogenized in the sample addition and mixing module; (M5) PCR amplification module, wherein the PCR amplification module is configured to perform PCR amplification on droplets generated in the droplet generation module; (M6) Droplet reading module, wherein the droplet reading module is configured to: perform droplet reading on the PCR products in the PCR amplification module, the reading includes: the number of droplets of Ch1+Ch2+, Ch1+Ch2-, Ch1-Ch2+, Ch1-Ch2- and the total number of accepted droplets, and name the number of Ch1+Ch2- droplets as NA, the number of Ch1-Ch2+ droplets as NB, the number of Ch1-Ch2- droplets as NE, and the number of accepted droplet droplets as NTOT; (M7) Result output module, the result output module includes a Linkage calculation module and a result determination module, wherein the Linkage calculation module is configured to perform the following calculations on NA, NB, NE, and NTOT in the droplet reading module: ) / 0.85 ; The result determination module is configured to: compare the Linkage calculated value with 1. If Linkage (copies / 20μl) ≥1, the output result is determined to be positive; if Linkage (copies / 20μl) < 1, the output result is determined to be negative; A positive result indicates that the sample to be tested contains replicating virus, and a negative result indicates that the sample to be tested does not contain or basically does not contain replicating virus.
[0108] In another preferred example, the device further includes: (M8) Standard sample module, the standard sample module is configured to: provide positive standard samples, negative standard samples and / or blank control samples as control samples in the detection, so as to perform quality control on the device.
[0109] In another preferred example, if the Linkage results of the positive standard sample, negative standard sample and / or blank control sample meet the following criteria, it indicates that the detection of the device is qualified: (a) The positive standard sample is determined to be positive according to the Linkage result; and / or (b) The negative standard sample or blank control sample is determined to be negative according to the Linkage result.
[0110] In another preferred example, if the Linkage results of the positive standard sample, negative standard sample and / or blank control sample meet any of the following criteria, it indicates that the detection of the device is unqualified: (a) The positive standard sample is determined to be negative according to the Linkage result; (b) The negative standard sample or blank control sample is determined to be positive according to the Linkage result.
[0111] In another preferred example, the device further includes: (M9) Control module, the control module is configured to: control the operation of control modules (M1)-(M7), or control the operation of control modules (M1)-(M8).
[0112] In another preferred example, the sample to be tested is a DNA sample of CAR-T.
[0113] In another preferred embodiment, the CAR-T DNA sample is a DNA extraction sample of the CAR-T genome.
[0114] In another preferred embodiment, the mass of the sample to be tested is 40 ng-400 ng, more preferably 50 ng-300 ng, more preferably 70 ng-200 ng, and most preferably 100 ng-150 ng, such as 105 ng, 110 ng, 115 ng, 120 ng, 125 ng, 130 ng, 135 ng, 140 ng, or 145 ng.
[0115] In another preferred embodiment, the concentration of the sample to be tested is 10 ng / μl-100 ng / μl, more preferably 15 ng / μl-50 ng / μl, more preferably 20 ng / μl-30 ng / μl, such as 21 ng / μl, 22 ng / μl, 23 ng / μl, 24 ng / μl, 25 ng / μl, 26 ng / μl, 27 ng / μl, 28 ng / μl, 29 ng / μl.
[0116] In another preferred embodiment, the loading volume of the sample to be tested is 0.1 μl-20 μl, more preferably 1 μl-10 μl, more preferably 3 μl-5 μl, such as 4.0 μl, 4.1 μl, 4.2 μl, 4.3 μl, 4.4 μl, 4.5 μl, 4.6 μl, 4.7 μl, 4.8 μl, or 4.9 μl.
[0117] In another preferred embodiment, the replicating virus is selected from the group consisting of replicating lentiviruses (RCL), replicating retroviruses (RCR), or combinations thereof.
[0118] In another preferred embodiment, the Rev sequence is SEQ ID NO: 1.
[0119] In another preferred embodiment, the GagPol sequence is SEQ ID NO: 2.
[0120] In another preferred embodiment, the VSV-G sequence is SEQ ID NO: 3.
[0121] In another preferred embodiment, the primer-probe combination includes: GagPol primer pairs, GagPol probes, Rev primer pairs, and Rev probes.
[0122] In another preferred embodiment, the primer-probe combination includes: GagPol primer pairs, GagPol probes, VSV-G primer pairs, and VSV-G probes.
[0123] In another preferred embodiment, when the replicating virus is a replicating lentivirus (RCL), the primer-probe combination includes: GagPol primer pair, GagPol probe, Rev primer pair and Rev probe.
[0124] In another preferred embodiment, when the replicating virus is a replicating retrovirus (RCR), the primer-probe combination includes: GagPol primer pair, GagPol probe, VSV-G primer pair and VSV-G probe.
[0125] In another preferred embodiment, the GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively.
[0126] In another preferred embodiment, the sequence of the GagPol probe is SEQ ID NO: 6 and / or SEQ ID NO: 7.
[0127] In another preferred embodiment, the Rev primer pair includes Rev-F and Rev-R, whose sequences are SEQ ID NO:8 and SEQ ID NO:9, respectively.
[0128] In another preferred embodiment, the Rev probe has the sequence SEQ ID NO: 10.
[0129] In another preferred embodiment, the VSV-G primer pair includes VSVG-F and VSVG-R, whose sequences are SEQ ID NO: 11 and SEQ ID NO: 12, respectively.
[0130] In another preferred embodiment, the sequence of the VSV-G probe is SEQ ID NO: 13.
[0131] In another preferred embodiment, the probe is a probe with a detectable marker.
[0132] In another preferred embodiment, the probe is a probe with a fluorescent label.
[0133] In another preferred embodiment, the fluorescent label includes: FAM, VIC, HEX, ROX, Cy3, Cy5.
[0134] In another preferred embodiment, the GagPol probe is labeled with FAM or HEX fluorescent tags.
[0135] In another preferred embodiment, the GagPol probe has the sequence SEQ ID NO: 6 and is labeled with FAM fluorescence.
[0136] In another preferred embodiment, the GagPol probe has the sequence SEQ ID NO: 7 and is labeled with HEX fluorescence.
[0137] In another preferred embodiment, the Rev probe is labeled with HEX fluorescence.
[0138] In another preferred embodiment, the VSV-G probe is labeled with FAM fluorescent markers.
[0139] In another preferred embodiment, the ddPCR reaction system further includes: DNA polymerase, dNTPs, buffer, BSA, DMSO, glycerol, or a combination thereof.
[0140] In another preferred embodiment, the droplet generation module includes droplet-generating oil.
[0141] In a fifth aspect of the invention, the use of the ddPCR reaction system described in the second aspect of the invention, the kit described in the third aspect of the invention, or the device described in the fourth aspect of the invention is provided for: (a) rapid detection of replicating viruses; and / or (b) quality control of CAR-T.
[0142] In another preferred embodiment, the use includes the method described in the first aspect of the invention.
[0143] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description
[0144] Figure 1 The DNA standard plasmid map is displayed.
[0145] Figure 2 shows the specificity detection results, where Figure 2A The detection values for each sample were obtained using the GagPol and Rev primer-probe combination. Figure 2B Two-dimensional droplet maps of each sample detected using the GagPol and Rev primer-probe combination; Figure 2C The detection values for each sample were obtained using the GagPol and VSV-G primer-probe combination. Figure 2D Two-dimensional droplet maps of each sample detected using the GagPol and VSV-G primer-probe combination.
[0146] Figure 3 The test results for 24 duplicate wells are shown.
[0147] Figure 4 shows the detection results of replicating virus in gDNA of 40 ng-400 ng CAR-T samples, where Figure 4A To detect values, Figure 4B This is a two-dimensional droplet diagram. Detailed Implementation
[0148] Through extensive and in-depth research and numerous screenings, the inventors have, for the first time, creatively discovered that by using the Rev-GagPol linkage as a new indicator to reflect replicating lentiviruses (RCL), or the VSV-G-G-GagPol linkage as a new indicator to reflect replicating retroviruses (RCR), the interference of plasmid residues on the detection of replicating viruses can be eliminated. Furthermore, the use of a standard curve is unnecessary, preventing contamination from high-concentration standards. In addition, the rapid detection method established in this invention exhibits excellent specificity and sensitivity, with no false positives and a sensitivity reaching 2.5 copies / μl, far exceeding the sensitivity of qPCR rapid detection methods (the detection limit of qPCR is at least around 10 copies / μl). This invention was completed based on these findings.
[0149] the term To facilitate a clearer understanding of this disclosure, certain terms are first defined. As used herein, unless otherwise expressly specified herein, each of the following terms shall have the meaning given below.
[0150] The term “about” can refer to a value or composition within an acceptable range of error for a particular value or composition as determined by a person skilled in the art, which will depend in part on how the value or composition is measured or determined.
[0151] The term "virtually non-existent" means that the residual amount of virus is extremely low, within the "acceptable range" recognized in the relevant technical field, such as below the safety threshold specified in industry standards.
[0152] As used in this article, the term "ddPCR" refers to digital droplet PCR, an absolute quantitative analysis method based on PCR technology. Its core principle is to divide the nucleic acid reaction system to be tested into thousands to tens of thousands of nanoliter-sized droplets, each droplet containing either zero or one target nucleic acid molecule. After PCR amplification, the initial copy number of the target nucleic acid is calculated by detecting the fluorescence signal of the droplets ("positive droplets" containing the target molecule emit light, while "negative droplets" without the target molecule do not), combined with the Poisson distribution principle, thus achieving absolute quantification.
[0153] As used in this article, the term "linkage" refers to physically linked DNA, which are DNA segments that are physically adjacent on chromosomes and closely linked by spatial proximity or covalent connections. Because of their proximity in the genome, these segments tend to remain co-segregated during DNA replication, recombination, or amplification (and rarely separate independently). Their linkage can reflect the structural features of the genome or the physical association of specific sequences. In molecular detection, analyzing the co-existence state of physically linked DNA can be used to verify the integrity of target sequences, confirm specific gene structures, or trace the original association of nucleic acid fragments, providing a basis for precise detection (such as pathogen genome fragment identification and gene structural variation analysis).
[0154] As used in this article, the term "qPCR" refers to quantitative real-time PCR, a nucleic acid quantification technique that combines PCR amplification with real-time fluorescence detection. Its core principle involves adding a fluorescent dye (such as SYBR Green) or a specific fluorescent probe to the PCR reaction system. As the PCR cycle proceeds, the target nucleic acid fragment is amplified, and the fluorescence signal intensity increases synchronously with the increase of amplification products. By monitoring the changes in the fluorescence signal in real time, the initial concentration of the target nucleic acid is reflected by the "threshold cycle number (Ct value, i.e., the number of cycles at which the fluorescence signal reaches a set threshold)" (the smaller the Ct value, the higher the initial concentration). This, combined with a standard curve, enables relative or absolute quantification of the target nucleic acid.
[0155] As used in this article, the term "SNP" refers to single nucleotide polymorphism, which is a DNA sequence polymorphism caused by a single nucleotide variation (substitution, insertion, or deletion) at the genome level. Its core characteristics are: the variation occurs at a single base site, and its frequency in the population is usually not less than 1% (as opposed to rare mutations), with the most common type being a single base substitution.
[0156] As used in this article, the term "Mock T" refers to blank T cells, which are T cells that have not received specific target treatment but have undergone the same basic operational steps (such as culture conditions, buffer treatment, etc.) as the experimental group T cells. As an experimental control, its role is to eliminate the influence of non-specific operations (such as culture environment, reagent interference) on the experimental results, and to ensure the reliability and specificity of the experimental results by comparing them with the experimental group.
[0157] Rapid detection method for replication viruses based on ddPCR platform To address the problems of the qPCR rapid detection method, this invention provides a rapid detection method for replicating viruses based on the ddPCR platform (ddPCR method).
[0158] As an example, the ddPCR method for detecting replicating lentivirus (RCL) is as follows: RCL detection (ddPCR method) uses Rev and GagPol, elements distributed on pRSV-Rev and pRRE plasmids during the lentiviral process, as target sequences. Combining the unique Linkage algorithm of ddPCR, this invention proposes a new index: that is, the Linkage of Rev and GagPol is used to reflect RCL. This method can eliminate the interference of plasmid residues on RCL detection and is more consistent with the structure and function of RCL by definition.
[0159] As an example, the ddPCR method for detecting replicating retroviruses (RCRs) is as follows: The traditional RV process uses a three-plasmid system, involving Rev, GagPol, and VSV-G sequences. However, in the RV process, Rev and GagPol reside on the same plasmid. Therefore, extending this to the detection of RCR linkage requires a primer-probe combination of VSV-G and GagPol. This invention proposes a new indicator: using the linkage between VSV-G and GagPol to reflect RCR.
[0160] The principle of ddPCR is to randomly distribute the reaction system containing target nucleic acids into several independent PCR microreaction units (droplets). After PCR reaches its endpoint, the copy number concentration of the target nucleic acid in the sample is calculated by analyzing the positive and negative ratios of each reaction unit and using the Poisson distribution algorithm. In multichannel fluorescent ddPCR, the ddPCR reaction system can detect multiple nucleic acid targets, and droplets containing multiple nucleic acid targets will show double positivity after fluorescence scanning. Double-positive droplets include two cases: multiple nucleic acid targets randomly distributed, and multiple nucleic acid targets physically linked. Linkage refers to multiple nucleic acid targets physically linked in situ, which can be calculated using mathematical formulas. Currently, the Linkage algorithm is widely used in various detections, including genome integrity, SNPs, and viral shell empty rate.
[0161] The rapid detection method established in this invention eliminates the interference of plasmid residues in the lentivirus production process in principle; and since ddPCR relies on the Poisson distribution principle for absolute quantification, there is no need to use a standard curve, thus preventing contamination by high-concentration standards; and it has high sensitivity, at 2.5 copies / μl.
[0162] In the actual testing of this invention, gDNA can be extracted from the CAR-T sample to be tested for instrumental detection. Positive standards, negative standards, and / or blank controls are not necessary in actual testing, but can be used for quality control of the detection method to help determine whether the detection method is qualified—if qualified, it indicates that the test results are reliable; if unqualified, it indicates that the test results are unreliable and the test needs to be repeated.
[0163] The mass of the gDNA to be tested can be 40 ng-400 ng, preferably 50 ng-300 ng, more preferably 70 ng-200 ng, and optimally 100 ng-150 ng, such as 105 ng, 110 ng, 115 ng, 120 ng, 125 ng, 130 ng, 135 ng, 140 ng, and 145 ng.
[0164] The concentration of the gDNA to be tested can be 10 ng / μl-100 ng / μl, preferably 15 ng / μl-50 ng / μl, more preferably 20 ng / μl-30 ng / μl, such as 21 ng / μl, 22 ng / μl, 23 ng / μl, 24 ng / μl, 25 ng / μl, 26 ng / μl, 27 ng / μl, 28 ng / μl, 29 ng / μl.
[0165] The loading volume of the gDNA to be tested can be 0.1 μl-20 μl, preferably 1 μl-10 μl, more preferably 3 μl-5 μl, such as 4.0 μl, 4.1 μl, 4.2 μl, 4.3 μl, 4.4 μl, 4.5 μl, 4.6 μl, 4.7 μl, 4.8 μl, or 4.9 μl.
[0166] As a preferred example, the concentration of the gDNA to be tested can be 25 ng / μl or 4.4 μl.
[0167] In the rapid detection method of the present invention, based on the Rev and GagPol index, or the VSV-G and GagPol index, for replicating lentiviruses (RCL) and replicating retroviruses (RCR), the ddPCR reaction system may include primer-probe combinations selected from the following group targeting GagPol sequences, Rev sequences, and / or VSV-G sequences: GagPol primer pairs, GagPol probes, Rev primer pairs, Rev probes, VSV-G primer pairs, VSV-G probes, or combinations thereof.
[0168] It should be understood that those skilled in the art, based on the concept and disclosure of this invention, can clearly know and expect that any specific primer pairs designed for GagPol sequences, Rev sequences, and / or VSV-G sequences are within the scope of this invention and can be used to achieve the objectives of this invention. The ability to design and obtain the above-mentioned specific primer pairs is within the general skill level of those skilled in the art; correspondingly, those skilled in the art also have the ability to design and obtain corresponding probes according to probe design principles, and these probes are all within the scope of this invention and can be used to achieve the objectives of this invention. The probes of this invention may optionally contain any reporter fluorescent group and / or quencher group.
[0169] As a preferred example, the present invention provides the primer-probe combinations shown in Table 1 below, but the implementation of the present invention is not limited to the primer-probe combinations shown in Table 1.
[0170] Table 1 ddPCR reaction system for rapid detection of replicating viruses The present invention also provides a ddPCR reaction system for rapid detection of replicating viruses, the ddPCR reaction system comprising the following components: (a) Primer-probe combinations selected from the group consisting of GagPol primer pairs, GagPol probes, Rev primer pairs, Rev probes, VSV-G primer pairs, VSV-G probes, or combinations thereof, targeting GagPol, Rev, and / or VSV-G sequences; (b) DNA polymerase; (c) dNTPs; and (d) Buffer solution.
[0171] In addition, the ddPCR reaction system may further include additives selected from the following group: BSA, DMSO, glycerol, or combinations thereof.
[0172] The above ddPCR reaction system can be used as a pre-prepared ddPCR reaction system for adding to the sample to be tested, or it can be prepared on-site during the detection process. The ddPCR reaction system of the present invention can be prepared as a mixture in PCR tubes or other common commercial containers.
[0173] Those skilled in the art, upon obtaining the ddPCR reaction system of the present invention, can use it for rapid detection of viruses in the test samples, especially in CAR-T quality control.
[0174] Rapid Detection Kit for Replicating Viruses Based on ddPCR Platform This invention also provides a rapid detection kit for replicating viruses based on the ddPCR platform, the kit comprising: (Z1) A first container, and a primer-probe combination selected from the group consisting of GagPol primer pairs, GagPol probes, Rev primer pairs, Rev probes, VSV-G primer pairs, VSV-G probes, or combinations thereof, located within the first container for GagPol sequences, Rev sequences, and / or VSV-G sequences.
[0175] Based on this, the reagent kit of the present invention may further include: (Z2) A second container, and ddPCR reagents located within the second container; and / or (Z3) The third container, and the positive standard, negative standard and / or blank control contained in the third container.
[0176] The ddPCR reagent may include: DNA polymerase, dNTPs, droplet generating oil, reaction buffer, droplet reading oil, nucleic acid extraction reagent, TE buffer, PF-68 droplet generating card, or a combination thereof.
[0177] In some cases, the first and second containers can be the same container, and their contents are mixed to form the ddPCR reaction system described in the second aspect of the present invention.
[0178] Main advantages of the invention The rapid detection method for replicating viruses based on the ddPCR platform of this invention eliminates interference from plasmid residues in the production process of viral vectors (such as lentiviruses and retroviruses) in principle. Furthermore, since ddPCR relies on the Poisson distribution principle for absolute quantification, it eliminates the need for a standard curve, preventing contamination from high-concentration standards. Moreover, the method of this invention has high sensitivity, reaching 2.5 copies / μl, which is far more sensitive than qPCR rapid detection methods (the detection limit of qPCR is at least around 10 copies / μl).
[0179] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.
[0180] Example 1: Establishment of a rapid detection method for replicating viruses based on the ddPCR platform Step 1: Obtaining positive and negative standards: The standards were synthesized from the Genewiz website. The DNA standard plasmid was a combination of three sequences: Rev, GagPol, and VSV-G. Figure 1 DNA standards can be cleaved into five fragments by using the restriction endonuclease RsaⅠ, which eliminates the linker and yields a negative standard.
[0181] The Rev sequence is as follows: ctattctttagctcctgactccaatattgtaggagattccaccaatatttgagggcttcccaccccctgcgtcccagaagttccacaatcctcgttacaatcaagagtaagtctctcaagcggtggtagctgaagaggcacaggctccgcagatcgtcccagataagtgctaaggatccgttcactaatcgaatggatctgtctctgtctctctctccaccttcttcttctattccttcgggcctgtcgggtcccctcgggattgggaggtgggttgctttgatagagaaacttgatgagtctgactgccttgaggaggtcttcgtcgctgtctccgcttcttcctgccat (SEQ ID NO: 1); The GagPol sequence is: The VSV-G sequence is:
[0182] Simultaneously, the DNA standards were treated with the restriction endonuclease BtsⅠ to digest them into linear DNA, thus obtaining positive standards. After obtaining the two standards, the negative and positive standards were calibrated using the primer-probe combination of Rev (HEX) and GagPol (FAM) synthesized by Genewiz (for replicating lentiviruses (RCL)) or the primer-probe combination of VSV-G (FAM) and Gagpol (HEX) (for replicating retroviruses (RCR)). The calibrated standards were diluted to 1000 copies / μl, aliquoted, and stored at -80℃ for later use.
[0183] Step 2: Obtain the CAR-T sample genome and extract DNA from the cell sample. After determining the DNA content, the obtained DNA sample is used as the test sample. Simultaneously, a positive standard plasmid is used as a positive control sample for each experiment.
[0184] Step 3: Prepare the ddPCR reaction system, then add 40 ng-400 ng of test sample DNA as the test sample, and 10 copies of positive standard plasmid as the positive control sample. After mixing thoroughly, droplet generation is performed, followed by amplification. After amplification, the droplets are read to obtain the droplet count. The exported Excel file contains the Ch1+Ch2+, Ch1+Ch2-, Ch1-Ch2+, Ch1-Ch2- droplet counts, and the total number of accepted droplets for each data point. Name the Ch1+Ch2- droplet count as NA, the Ch1-Ch2+ droplet count as NB, the Ch1-Ch2- droplet count as NE, and the accepted droplet count as NTOT. Calculate the Linkage using the following formula: ) / 0.85 Result interpretation: Linkage (copies / 20μl) ≥1 is considered positive, and Linkage (copies / 20μl) <1 is considered negative.
[0185] Example 2: Experimental verification of the specificity of the rapid detection method of the present invention Take 1000 copies each of positive standard (PC) and negative standard (NC), Mock T, and PBS ( Figure 2C The corresponding NTC sample was extracted and used as the test sample for detection. The Linkage number was calculated, and the results are shown in [linkage table]. Figure 2A , 2B 2C and 2D.
[0186] in, Figure 2A ,2B The results show the detection values and two-dimensional droplet plots for detection using the GagPol and Rev primer-probe combination (targeting replicating lentivirus (RCL)). Figure 2C , 2D The detection values and two-dimensional droplet plots are for detection using the GagPol and VSV-G primer-probe combination (for replicating retroviruses (RCRs)).
[0187] The GagPol and Rev primer-probe combinations are shown in Table 2 below: Table 2 The GagPol and VSV-G primer-probe combinations are shown in Table 3 below: Table 3 The results show that the rapid detection method of this invention can specifically detect replicating viruses in positive samples (linkage (copies / 20μl) ≥1), while the detection of negative samples (negative standard, Mock T, PBS) is also negative (linkage (copies / 20μl) <1), with no false positives and a result accuracy of 100%. Therefore, the rapid detection method of this invention has excellent specificity.
[0188] Example 3: Experimental verification of the detection limit of the rapid detection method of the present invention A mixture of 2.5 copies / μl of positive standard and 25 ng / μl of mock T DNA was prepared as the detection limit test sample for the experiment. A total of 24 replicates were performed. Linkage and positive rate were calculated. Results are shown below. Figure 3 .
[0189] The results show that the rapid detection method of the present invention can accurately detect the replicating virus in all 24 replicates (the judgment result is Linkage (copies / 20μl) ≥1), with a positive rate of 100%. Therefore, the detection limit of the rapid detection method of the present invention can reach 2.5 copies / μl, which is much more sensitive than the qPCR rapid detection method (the detection limit of qPCR can only reach about 10 copies / μl at the lowest).
[0190] Example 4: Detection of CAR-T genomic DNA samples using the rapid detection method of the present invention Based on the results of Examples 1-3, the rapid detection method of the present invention exhibits excellent specificity and sensitivity, thus establishing a reliable rapid detection method for detecting replicating viruses in CAR-T genomic DNA samples. In the actual detection of the present invention, gDNA can be extracted from the CAR-T sample to be tested for instrumental detection.
[0191] In this embodiment, the detection results of replicating virus in the gDNA of CAR-T samples with loading amounts ranging from 40 ng to 400 ng were examined. Figure 4A , 4B As shown, this indicates that all samples loaded with the same amount were positive (the judgment result is Linkage (copies / 20μl) ≥1).
[0192] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.
Claims
1. A rapid detection method for replicating viruses based on the ddPCR platform, characterized in that, The method includes the following steps: (S1) Provide a sample to be tested, wherein the sample to be tested is a DNA sample; (S2) Prepare the ddPCR reaction system, add the sample to be tested, mix well, and then generate droplets; The ddPCR reaction system includes primer-probe combinations selected from the group consisting of GagPol primer pairs, GagPol probes, Rev primer pairs, Rev probes, VSV-G primer pairs, VSV-G probes, or combinations thereof, targeting GagPol sequences, Rev sequences, and / or VSV-G sequences. (S3) After the droplets are generated, PCR amplification is performed, and the droplets are read to obtain the droplet count. The droplet count results include the droplet counts of Ch1+Ch2+, Ch1+Ch2-, Ch1-Ch2+, and Ch1-Ch2-, as well as the total droplet count of Accepted Droplets. Ch1+Ch2- droplet counts are named NA, Ch1-Ch2+ droplet counts are named NB, Ch1-Ch2- droplet counts are named NE, and the Accepted Droplet count is named NTOT. The Linkage is calculated using the following formula: ) / 0.85 ; (S4) Determine whether the sample to be tested is positive or negative based on the Linkage results; A linkage (copies / 20μl) ≥1 is considered positive, and a linkage (copies / 20μl) <1 is considered negative. A positive result indicates that the sample contains replicating virus, while a negative result indicates that the sample does not contain or contains virtually no replicating virus.
2. The method according to claim 1, characterized in that, The concentration of the sample to be tested is 10 ng / μl-100 ng / μl, preferably 15 ng / μl-50 ng / μl, more preferably 20 ng / μl-30 ng / μl, such as 21 ng / μl, 22 ng / μl, 23 ng / μl, 24 ng / μl, 25 ng / μl, 26 ng / μl, 27 ng / μl, 28 ng / μl, 29 ng / μl.
3. The method according to claim 1, characterized in that, The sample loading volume is 0.1 μl-20 μl, preferably 1 μl-10 μl, more preferably 3 μl-5 μl, such as 4.0 μl, 4.1 μl, 4.2 μl, 4.3 μl, 4.4 μl, 4.5 μl, 4.6 μl, 4.7 μl, 4.8 μl, or 4.9 μl.
4. The method according to claim 1, characterized in that, The replicating virus is selected from the group consisting of replicating lentiviruses (RCL), replicating retroviruses (RCR), or combinations thereof.
5. The method according to claim 1, characterized in that, When the replicating virus is a replicating lentivirus (RCL), the primer-probe combination includes: GagPol primer pair, GagPol probe, Rev primer pair, and Rev probe; The GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The GagPol probe has the sequence SEQ ID NO: 6 and is labeled with FAM fluorescence. The Rev primer pair includes Rev-F and Rev-R, whose sequences are SEQ ID NO: 8 and SEQ ID NO: 9, respectively. The Rev probe has the sequence SEQ ID NO: 10 and is labeled with HEX fluorescence.
6. The method according to claim 1, characterized in that, When the replicating virus is a replicating retrovirus (RCR), the primer-probe combination includes: GagPol primer pair, GagPol probe, VSV-G primer pair and VSV-G probe; The GagPol primer pair includes GagPol-F and GagPol-R, whose sequences are SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The GagPol probe has the sequence SEQ ID NO: 7 and is labeled with HEX fluorescence. The VSV-G primer pair includes VSVG-F and VSVG-R, whose sequences are SEQ ID NO: 11 and SEQ ID NO: 12, respectively; The sequence of the VSV-G probe is SEQ ID NO: 13, and it is labeled with FAM fluorescence.
7. A ddPCR reaction system for rapid detection of replicating viruses, characterized in that, The ddPCR reaction system comprises the following components: (a) Primer-probe combinations selected from the group consisting of GagPol primer pairs, GagPol probes, Rev primer pairs, Rev probes, VSV-G primer pairs, VSV-G probes, or combinations thereof, targeting GagPol, Rev, and / or VSV-G sequences; (b) DNA polymerase; (c) dNTPs; and (d) Buffer solution.
8. A rapid detection kit for replicating viruses based on the ddPCR platform, characterized in that, The kit includes: (Z1) A first container, and a primer-probe combination selected from the group consisting of GagPol primer pairs, GagPol probes, Rev primer pairs, Rev probes, VSV-G primer pairs, VSV-G probes, or combinations thereof, located within the first container for GagPol sequences, Rev sequences, and / or VSV-G sequences.
9. A rapid detection device for replicating viruses based on the ddPCR platform, characterized in that, The device includes: (M1) Sample input module, the sample input module being configured to provide a sample to be tested for detection, the sample to be tested being a DNA sample; (M2) ddPCR reaction system module, wherein the ddPCR reaction system module is configured to: prepare ddPCR reaction system therein, or contain a pre-prepared and pre-added ddPCR reaction system; The ddPCR reaction system includes primer-probe combinations selected from the group consisting of GagPol primer pairs, GagPol probes, Rev primer pairs, Rev probes, VSV-G primer pairs, VSV-G probes, or combinations thereof, targeting GagPol sequences, Rev sequences, and / or VSV-G sequences. (M3) Sample addition and mixing module, wherein the sample addition and mixing module is configured to: mix the ddPCR reaction system with the sample to be tested evenly; (M4) Droplet generation module, the droplet generation module being configured to generate droplets from the mixture homogenized in the sample addition and mixing module; (M5) PCR amplification module, wherein the PCR amplification module is configured to perform PCR amplification on droplets generated in the droplet generation module; (M6) Droplet reading module, wherein the droplet reading module is configured to: perform droplet reading on the PCR products in the PCR amplification module, the reading includes: the number of Ch1+Ch2+, Ch1+Ch2-, Ch1-Ch2+, Ch1-Ch2- droplets and the total number of accepted droplets, naming the number of Ch1+Ch2- droplets as NA, the number of Ch1-Ch2+ droplets as NB, the number of Ch1-Ch2- droplets as NE, and the number of accepted droplet droplets as NTOT; (M7) Result output module, which includes a Linkage calculation module and a result determination module, wherein the Linkage calculation module is configured to perform the following calculations on NA, NB, NE, and NTOT in the droplet reading module: ) / 0.85 ; The result determination module is configured to compare the calculated Linkage value with 1. If Linkage (copies / 20μl) ≥ 1, the output result is determined to be positive; if Linkage (copies / 20μl) < 1, the output result is determined to be negative. A positive result indicates that the sample contains replicating virus, while a negative result indicates that the sample does not contain or contains virtually no replicating virus.
10. The use of the ddPCR reaction system of claim 7, the kit of claim 8, or the device of claim 9, characterized in that, Used for: (a) rapid detection of replicating viruses; and / or (b) quality control of CAR-T.