Application of SNP (Single Nucleotide Polymorphism) molecular marker associated with pig backfat thickness character

Abstract

The invention belongs to the technical field of animal genetic breeding, and provides application of an SNP molecular marker associated with a pig backfat thickness character. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 7, wherein the polymorphism of the 88th basic group is T / C. The method comprises the following steps: performing deep sequencing on individual genomes with different backfat thicknesses of large white pigs, and finding that mononucleotide mutation Tgt exists at the 88th basic group of the 15th exon of the GLB1 gene; and C, inter-group difference exists. According to the present invention, the pig population is further expanded, the genome DNA is subjected to PCR amplification sequencing, the mutation site typing is performed, the correlation analysis with the corrected 100 kg backfat thickness of the large white pig is performed, and the correlation with the pig backfat thickness is determined, such that the reference data can be provided for the molecular marker-assisted breeding of the large white pig, and the continuous requirement of the large-scale production on the efficient feed energy utilization can be easily met.

Description

Cross-reference to related applications

[0001] This invention claims priority to Chinese Patent Application No. CN202511684804.2, filed on November 17, 2025, the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention belongs to the field of animal genetics and breeding technology, specifically, it relates to the application of an SNP molecular marker associated with the backfat thickness trait in pigs. Background Technology

[0003] Backfat thickness, a core economic indicator for assessing carcass traits, directly impacts the economic benefits and slaughter quality of pig farming. Studies have shown that backfat thickness is closely related to fat deposition efficiency, intramuscular fat content, and energy metabolism in pork, with its genetic regulatory mechanism involving the synergistic effects of multiple genes. In recent years, with the widespread application of high-throughput sequencing technology and genome-wide association studies (GWAS), significant progress has been made in elucidating the function of genes related to fat deposition. However, existing research largely focuses on genes involved in known lipid metabolism pathways, leaving gaps in the exploration of candidate genes with unclear functions and their genetic variations. The application of GWAS technology enables researchers to screen single nucleotide polymorphism (SNP) markers significantly associated with target traits across the entire genome.

[0004] β-galactosidase 1 (GLB1), an important member of the lysosomal enzyme family, plays a crucial role in glucose and lipid metabolism. The enzyme encoded by this gene catalyzes the hydrolysis of β-galactosidic bonds and participates in the degradation of glycoproteins and the metabolic regulation of lipid intermediates. Previous studies have shown that abnormal expression of GLB1 is closely related to obesity and metabolic syndrome in humans, and changes in the methylation level of its promoter region may lead to fat accumulation by affecting the activity of lipid synthases. In the field of livestock and poultry breeding, functional research on GLB1 is still in its early stages. Recent analysis of a miniature pig obesity model revealed a dose-dependent relationship between GLB1 expression in adipose tissue and backfat thickness, suggesting that it may affect fat deposition efficiency by regulating lipid droplet formation or fatty acid re-esterification. Currently, there are no systematic reports on the association between genetic variations in the GLB1 gene and the backfat thickness trait in pigs. Summary of the Invention

[0005] The purpose of this invention is to provide an application of SNP molecular markers associated with backfat thickness in pigs.

[0006] To achieve the objectives of this invention, in a first aspect, this invention provides a SNP molecular marker associated with the backfat thickness trait in pigs. The nucleotide sequence of the molecular marker is shown in SEQ ID NO:7, wherein the polymorphism at position 88 is T / C (n is t or c). The molecular marker is located at position 88 of exon 15 of the pig GLB1 gene, which can be referenced to pig genome version number Sscrofa11.1 (GCF_000003025.6). This SNP is located at the rs18898502 site on pig chromosome 13.

[0007] Furthermore, the backfat thickness of pigs with the TT genotype at the polymorphic site was significantly higher than that of pigs with the TC and CC genotypes.

[0008] In a second aspect, the present invention provides primers for amplifying the molecular marker, including an upstream primer as shown in SEQ ID NO:3 and a downstream primer as shown in SEQ ID NO:4.

[0009] Thirdly, the present invention provides detection reagents or kits containing the primers.

[0010] Fourthly, the present invention provides a method for detecting the backfat thickness trait in pigs, comprising: 1) Obtain the genomic DNA of the pig to be tested; 2) Using DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO:3-4; 3) Analysis of PCR amplification products showed that the backfat thickness of pigs with the genotype TT at the corresponding polymorphic site of the molecular marker was significantly higher than that of pigs with the genotypes TC and CC.

[0011] Preferably, the PCR reaction system is as follows: 50 ng DNA template, 12.5 μL of 2×phanta Max Mix, 1 μL each of 10 μM upstream and downstream primers, and ddH2O to bring the total system to 25 μL.

[0012] Preferably, the PCR reaction program is as follows: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 57℃ annealing for 5s, 72℃ extension for 5s, 38 cycles; 72℃ extension for 1min.

[0013] Preferably, step 3) includes: performing nanopore sequencing on the amplification product to obtain the genotype of the polymorphic site.

[0014] Fifthly, the present invention provides any of the following applications of the said molecular marker or its detection reagents or kits: (1) Used for early prediction of back fat thickness in pigs; (2) Used for marker-assisted breeding of pig backfat thickness; (3) Used for pig screening and breeding.

[0015] In this invention, β-galactosidase, encoded by the GLB1 gene, is an important lysosomal hydrolase. Its main function is to catalyze the hydrolysis of terminal β-linked galactose residues in biomolecules such as glycolipids and glycoproteins, participating in the degradation of cellular metabolic waste and energy cycling, and is crucial for maintaining normal cellular metabolism and homeostasis. Functional defects or mutations in the GLB1 gene directly lead to loss of enzyme activity, causing abnormal accumulation of substrates such as GM1 gangliosides in lysosomes, resulting in severe lysosomal storage disease. This disease severely affects the development and function of the nervous system, leading to neuronal death and progressive neurological degeneration. Furthermore, studies have shown that GLB1 plays a key role in cellular senescence, and its expression level is closely related to the activity of cellular senescence markers (such as SA-β-Gal). In addition to its core role in lysosomal metabolism, recent studies have also found that GLB1 may participate in physiological processes such as tissue repair and regeneration by influencing the degradation and remodeling of extracellular matrix components (such as elastin). However, the function of this gene in livestock and poultry muscle development, fat metabolism, or meat quality traits (such as tenderness and water retention) has not yet been clearly reported. Exploring the potential applications of the GLB1 gene in pig breeding may provide new molecular targets and genetic strategies for improving pork quality.

[0016] This invention utilizes deep genome sequencing of Large White pigs exhibiting variations in backfat thickness to identify a signal site in the GLB1 gene region that is significantly correlated with backfat thickness corrected to 100 kg. Therefore, this invention designs specific primers based on a single nucleotide polymorphism (SNP) at exon 15 of the GLB1 gene and amplifies the resulting polymorphism to differentiate backfat thickness among individual pigs. Using this molecular marker, primers are designed to amplify nucleotide sequences containing this SNP site via PCR. Sequencing the amplified products allows for rapid identification of the GLB1 genotype, thereby detecting differences in backfat thickness and providing guidance for pig breed selection. Furthermore, the primers provided in this invention specifically amplify SNP sequences contained in the exons of the GLB1 gene, resulting in a low-cost detection method. Detection can be performed solely through PCR amplification, eliminating the need for large-scale population sampling and measurement.

[0017] To achieve the above objectives, the technical solution provided by the present invention is as follows: (1) The present invention provides a molecular marker for the association of backfat thickness of pigs corrected to 100kg, which is a nucleotide sequence formed by a single nucleotide mutation T>C at the 88th base of the 15th exon of the pig GLB1 gene, including DNA molecules as shown in SEQ ID NO:1 and DNA molecules as shown in SEQ ID NO:2.

[0018] (2) The present invention also provides primers for amplifying the above-mentioned molecular markers, including DNA molecules as shown in SEQ ID NO:3 and DNA molecules as shown in SEQ ID NO:4.

[0019] (3) The present invention also provides a nucleic acid molecule, which is generated by PCR amplification of the molecular marker primers described in (2), including a DNA molecule as shown in SEQ ID NO:5 and a DNA molecule as shown in SEQ ID NO:6.

[0020] (4) The present invention also provides a kit for detecting SNP molecular markers including (1), the kit including primers described in (2) and other reagents required for PCR amplification.

[0021] (5) The present invention also provides a method for detecting SNP molecular markers associated with backfat thickness in pigs, obtaining the genomic DNA of the pig to be tested, using the kit described in (4) to perform PCR amplification on the genomic DNA of the pig to be tested, performing nanopore sequencing on the amplification product, comparing the genotype at the 88th base of exon 15 of the GLB1 gene, and determining the backfat thickness trait of the pig based on the genotype.

[0022] (6) The present invention also provides a method for identifying and screening pig backfat thickness using the SNP molecular marker, including the detection method described in (5).

[0023] (7) The present invention also provides an application of the molecular marker described in (1), the molecular marker primer described in (2), the nucleic acid molecule described in (2) or (3), or the kit described in (4), wherein the application is selected from any one of the following: 1) Detection and analysis of backfat thickness in pigs; 2) Pig selection and breeding.

[0024] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention utilizes deep sequencing of the genomes of Large White pigs with varying backfat thickness to identify a single nucleotide mutation (T>C) at nucleotide 88 of exon 15 of the GLB1 gene, with intergroup differences. Further expansion of the pig population and PCR amplification and sequencing of genomic DNA were performed. Genotyping was conducted at the mutation site, and correlation analysis with corrected 100kg backfat thickness in Large White pigs confirmed the association between the mutation and backfat thickness, providing reference data for marker-assisted breeding of Large White pigs.

[0025] This invention demonstrates that pigs with the TT genotype have significantly higher backfat than those with the TC / CC genotypes at the T>C polymorphism site at base 88 of exon 15 of the GLB1 gene. Therefore, breeding individuals with the TC or CC genotypes is beneficial for meeting the ongoing demand for efficient feed energy utilization in large-scale production. Attached Figure Description

[0026] Figure 1 The PCR amplification results of exon 15 of the Large White pig GLB1 gene in a preferred embodiment of the present invention are shown. M is DL1002Maker, and lanes 1-8 are Large White pig genome PCR amplification products.

[0027] Figure 2 This is a sequence diagram of the sequencing results of a representative individual with the genotype at 88 bases of exon 15 of the Large White pig GLB1 gene in a preferred embodiment of the present invention.

[0028] Figure 3 This is a peak diagram of the sequencing results of a representative individual with the genotype at 88 bases of exon 15 of the porcine GLB1 gene in a preferred embodiment of the present invention. Detailed Implementation

[0029] This invention, through sequencing of mutation sites in a portion of the GLB1 gene nucleotide sequence, discovered that the genotype at nucleotide 88 of exon 15 of the GLB1 gene is associated with the backfat thickness trait in pigs.

[0030] Therefore, this invention provides a molecular marker associated with backfat thickness in pigs, comprising a nucleotide sequence formed by a single nucleotide mutation T>C at nucleotide 88 of exon 15 of the porcine GLB1 gene. The porcine GLB1 gene is referenced from the GenBank database: Gene ID: 100624593, Assembly number Sscrofa11.1 (GCF_000003025.6), Location: NC_010455.5.

[0031] In some specific embodiments, the corrected 100 kg backfat thickness is selected from the vertical distance from the skin on the back to the longest back muscle membrane at 5 cm from the midline of the back between the 3rd and 4th ribs from the bottom of the pig, which is the value obtained by calculating the actual value according to the correction formula at the end of the measurement, etc.

[0032] In some specific implementations, at the 88th base of exon 15 of the porcine GLB1 gene, the backfat thickness of TT genotype pigs is significantly higher than that of TC / CC genotype pigs.

[0033] Based on this, the backfat thickness of individual pigs can be genetically marked according to the genotype at the 88th base of exon 15 of the pig GLB1 gene, which is beneficial for breeding pig breeds with low backfat.

[0034] Therefore, specific primers (SEQ ID NO:3 and SEQ ID NO:4) were designed with reference to exon 15 of the porcine GLB1 gene in the GenBank database. PCR amplification was performed using porcine genomic DNA as a template, and the amplification products were sequenced to obtain gene fragments as shown in SEQ ID NO:5 and SEQ ID NO:6.

[0035] Based on this, the present invention also provides molecular marker primers associated with the trait of backfat thickness in pigs, including DNA molecules as shown in SEQ ID NO:3 and DNA molecules as shown in SEQ ID NO:4. The molecular marker primers are used to amplify the nucleotide sequence of molecular markers containing backfat thickness in pigs, such as SNPs, to analyze the genotype of the molecular marker, thereby determining the feed utilization efficiency of the pigs.

[0036] In another aspect, the present invention also provides a nucleic acid molecule, which is amplified by PCR using the aforementioned molecular marker primers, wherein the genotype of the nucleic acid molecule is associated with the backfat thickness of the pig. Further, the nucleic acid molecule is shown in SEQ ID NO:5 and SEQ ID NO:6.

[0037] In another aspect, the present invention also provides a kit comprising the aforementioned molecular marker primers and other reagents required for PCR amplification.

[0038] Based on this, the present invention also provides a method for detecting backfat thickness in pigs, comprising: obtaining genomic DNA of the pig to be tested; performing PCR amplification using the molecular marker primers; detecting the genotype at 88 base of exon 15 of the pig GLB1 gene based on the nucleotide sequence of the amplification product; and determining the backfat thickness of the pig based on the genotype. For example, the backfat thickness of the pig is determined based on the genotype.

[0039] In some specific embodiments, the detection method further includes sequencing the amplified product and determining the genotype at the 88th base of exon 15 of the porcine GLB1 gene based on the sequencing results.

[0040] Based on this, the present invention also provides a method for screening pigs, including the aforementioned detection method, to determine the backfat thickness of pigs, and then to screen pig breeds to obtain superior pig breeds.

[0041] Based on this, the present invention also provides applications of the molecular marker, the molecular marker primer, the nucleic acid molecule, or the reagent kit, wherein the application is selected from any one of the following: 1) Detection and analysis of backfat thickness traits in 100kg pigs; 2) Pig selection and breeding.

[0042] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0043] Example 1: Obtaining SNP molecular markers and pig GLB1 genotyping according to the present invention 1. Extraction of porcine genomic DNA The experimental pig breed used in this invention is the Large White pig. Sample data and backfat thickness phenotypic data were obtained from Shuangbaotai (Group) Co., Ltd. Ear tissue was collected from 103 Large White pigs. Pig genomic DNA was extracted using a tissue genomic DNA kit produced by Beijing Tiangen Biotech Co., Ltd. (operated according to the kit instructions). The concentration and quality of the extracted DNA were tested and then stored at -20℃ for later use. The specific steps are as follows: 1) Take approximately 100 mg of large white pig ear tissue sample and place it in a 1.5 mL centrifuge tube; 2) Add 200 μL of buffer GA to each sample, vortex, and mix thoroughly; 3) Add 20 μL of proteinase K, vortex to mix, incubate in a water bath at 56 °C for 60 min until the tissue is dissolved, and then briefly centrifuge. 4) Add 200 μL of buffer GB, mix thoroughly by inverting, incubate at 70°C for 30 min until the solution becomes clear, and then briefly centrifuge. 5) Add 200 μL of anhydrous ethanol, shake well for 15 seconds, and briefly centrifuge after flocculent precipitate appears; 6) Add the solution and flocculent precipitate into the adsorption column CB3, then centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 back into the collection tube; 7) Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 into the collection tube; 8) Add 600 μL of washing buffer PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 into the collection tube; 9) Repeat step 8). 10) Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 minutes, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to allow any remaining wash liquid to dry. 11) Transfer the adsorption column CB3 into a clean centrifuge tube, add 70 μL of elution buffer TE dropwise to the middle of the adsorption membrane, incubate at room temperature for 5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into the centrifuge tube. 12) Concentration determination, DNA quality testing, and obtaining DNA from all Large White pigs; 13) The prepared DNA was aliquoted and stored at 4℃ and -20℃ respectively.

[0044] 2. Obtaining the SNP sites of the porcine GLB1 gene The sequencing analysis samples for this invention were provided by the applicant, and Beijing Novogene Technology Co., Ltd. was commissioned to perform deep genome sequencing and subsequent bioinformatics analysis on 50 individuals with differences in backfat thickness. After ensuring the DNA quality of the samples met sequencing requirements, library construction, high-throughput sequencing, data quality control, and alignment analysis were performed. SAMTOOLS software was used to detect SNPs in the high-quality alignment results, and filtering was performed using criteria such as deletion rate, sequencing depth, and minimum allele frequency to obtain a high-confidence SNP set. Subsequently, ANNOVAR software was used to perform functional annotation of the SNP sites, including annotations of gene regions, functional regions, and variant types. Based on the annotation results, gene regions significantly associated with pig birth weight and backfat thickness traits were screened out, and a single nucleotide mutation T>C at nucleotide 88 of exon 15 of the GLB1 gene was identified, which showed a significant correlation with differences in backfat thickness.

[0045] Through the above sequencing and mutation detection process, this invention successfully identified the GLB1 gene SNP site associated with backfat thickness in pigs, providing an important genetic basis for subsequent molecular marker-assisted breeding research.

[0046] 3. Detection of SNP sites in the porcine GLB1 gene (1) PCR amplification The following primer pairs were designed based on the GLB1 gene sequence (Gene ID: 100624593 in the GeneBank database): Forward primer GLB1-F: ACACAGAATCACTTGAAGCTTCC (SEQ ID NO:3) Reverse primer GLB1-R: GCCTGAATTCAAACACTGCC (SEQ ID NO:4) The above primers were used to amplify genomic DNA from 103 Large White pigs. The PCR reaction system was 25 μL, and the concentrations of each component in the system were 50 ng template, 12.5 μL 2×phanta Max Mix, 1 μL each of 10 μM forward and reverse primers, and 9.5 μL ddH2O.

[0047] The PCR procedure was as follows: preheating at 98℃ for 30 seconds; denaturation at 98℃ for 10 seconds, annealing at 57℃ for 5 seconds, extension at 72℃ for 5 seconds, for a total of 38 cycles; final extension at 72℃ for 1 minute; storage at 4℃. 5 μL of the PCR product was analyzed by 1% agarose gel electrophoresis, yielding an amplified product with a single target band length of 360 bp. The results are shown below. Figure 1 .

[0048] (2) Nanopore sequencing and genotyping 1) Nanopore sequencing The obtained PCR amplification products were directly sent to Zhejiang Youkang Biotechnology Co., Ltd. for nanopore sequencing to obtain SEQ ID NO:5 and SEQ ID NO:6 sequences.

[0049] 2) Genotyping Genotyping was performed on the sequencing results of 103 pigs. Representative sequences and peak diagrams for the TT, TC, and CC genotypes are shown below. Figure 2 and Figure 3 .

[0050] Table 1 shows the statistical results of genotype and allele frequencies at the rs18898502 locus on chromosome 13 of Large White pigs. Table 1. Statistical results of genotype and allele frequencies at the rs18898502 locus on chromosome 13 of Large White pigs.

[0051] Example 2: Association Analysis and Application of the SNP Molecular Markers of the Present Invention with Backfat Thickness in Pigs The experimental pig herd used for association analysis consisted of 103 Large White pigs. Polymorphism was detected using the direct sequencing method of PCR products provided in the above examples. Analysis of variance was performed using the GLM program in SAS statistical software to analyze the correlation between the three different genotypes of the porcine GLB1 gene and the backfat thickness trait. The model used was: in Here, μ represents the backfat thickness phenotypic value, and μ is the population mean. This is a genotype effect. Due to the pig farm effect, For gender effect, The paternal effect, This represents a random residual effect. Results are expressed as least squares mean ± standard error, and P < 0.05 is considered statistically significant.

[0052] The association analysis results are shown in Table 2. The backfat thickness of individuals with the TT genotype was significantly higher than that of individuals with the TC and CC genotypes (P<0.05). Table 2. Association analysis between the T>C mutation at rs18898502 site on chromosome 13 of the pig genome and backfat thickness in pigs.

[0053] Note: The shoulder mark is a marker of significant difference in the same quality among different genotypes.

[0054] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. Any of the following applications of SNP molecular markers or their detection reagents or kits associated with the trait of backfat thickness in pigs: (1) Used for early prediction of back fat thickness in pigs; (2) Used for marker-assisted breeding of pig backfat thickness; The nucleotide sequence of the SNP molecular marker associated with the backfat thickness trait in pigs is shown in SEQ ID NO:7, wherein the polymorphism of the 88th base is T / C.

2. The application according to claim 1, characterized in that, The backfat thickness of pigs with the TT genotype at the polymorphic locus was significantly higher than that of pigs with the TC and CC genotypes.

3. A method for detecting the thickness of back fat in pigs, characterized in that, include: 1) Obtain the genomic DNA of the pig to be tested; 2) Using DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO:3-4; 3) Analyze the PCR amplification products. The backfat thickness of pigs with the genotype TT at the polymorphic site of the molecular marker in claim 1 is significantly higher than that of pigs with the genotypes TC and CC.

4. The method according to claim 3, characterized in that, The PCR reaction system consisted of 50 ng DNA template, 12.5 μL of 2×phantaMax Mix, 1 μL each of 10 μM upstream and downstream primers, and ddH2O to bring the total volume to 25 μL.

5. The method according to claim 3, characterized in that, The PCR reaction program was as follows: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 57℃ annealing for 5s, 72℃ extension for 5s, 38 cycles; 72℃ extension for 1min.

6. The method according to any one of claims 3-5, characterized in that, Step 3) includes: performing nanopore sequencing on the amplification products to obtain the genotype of the polymorphic site.

Images