Molecular marker of drug-resistant mycobacterium abscessus based on fusA gene mutation and application of molecular marker
By detecting specific mutations in the fusA gene of Mycobacterium abscessus, molecular markers and nucleotide sequences are provided, and a kit is constructed for the rapid and accurate identification of drug resistance in Mycobacterium abscessus. This solves the problem of difficulty in identifying drug resistance mechanisms in existing technologies, and enables rapid diagnosis and effective treatment.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- GUANGZHOU INSTITUTES OF BIOMEDICINE AND HEALTH CHINESE ACADEMY OF SCIENCES
- Filing Date
- 2026-02-27
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies are insufficient to effectively identify and diagnose the mechanisms of amikacin resistance in Mycobacterium abscesses, leading to difficulties in clinical treatment.
By detecting specific mutations in the fusA gene of Mycobacterium abscessus (fusA1318 A>G, fusA1613 G>A, fusA1872_1883 dup GGGCGACGTGAT), molecular markers and nucleotide sequences are provided to construct a kit for rapid and accurate drug resistance detection.
It enables rapid diagnosis of resistance to aminoglycosides and macrolides in Mycobacterium abscessis, provides guidance for clinical medication, shortens the treatment window, and improves patient prognosis.
Smart Images

Figure CN121852574A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and more particularly to [the field of biomedical technology]. fusA Molecular markers and their applications for drug-resistant abscess-forming mycobacteria with gene mutations. Background Technology
[0002] Mycobacterium abscessus ( Mycobacterium amscessus Mycobacterium tumefaciens (Mab) is a rapidly growing nontuberculous mycobacterium that can cause refractory infections in human lungs, skin, and soft tissues. This bacterium exhibits intrinsic resistance to many common antibiotics, making clinical treatment difficult.
[0003] Amikacin (AMK), an important aminoglycoside antibiotic, is one of the core drugs for treating Mab infections. Its main mechanism of action is through targeting the 16S rRNA of the 30S ribosomal subunit. 16S rRNA is an important component of the small ribosomal subunit. AMK interferes with mRNA translation by binding to the A site in the 16S rRNA decoding region, causing translational errors and thus inhibiting normal bacterial growth and reproduction. The corresponding gene encoding 16S rRNA... rrs Mutations in this gene can lead to resistance in Mab to AMK. Additionally, the gene encoding the ribosomal protein S12... rpsL Specific mutations in the protein can also lead to changes in the sensitivity of Mab to aminoglycoside drugs. However, increasing clinical and experimental evidence suggests that a significant proportion of clinically resistant Mab strains do not carry this mutation. rrs , rpsL Gene mutation. This suggests the existence of an undiscovered resistance mechanism of Mab to AMK.
[0004] Therefore, there is an urgent need in this field to discover new mechanisms related to Mab resistance to AMK in order to improve the existing molecular diagnostic system and provide more accurate guidance for clinical anti-infective therapy. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a solution based on... fusA Molecular markers and their applications for drug-resistant abscess-forming mycobacteria with gene mutations.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a set of molecular markers for detecting drug resistance in Mycobacterium abscessus, said molecular markers being Mycobacterium abscessus. fusA Mutations in genes; fusA Gene mutations include fusA 1318 A>G、 fusA 1613 G>A、 fusA1872_1883 dup GGGCGACGTGAT.
[0007] This invention research found that fusA 1318 A>G and fusA Mabs with the 1872_1883 dup GGGCGACGTGAT mutation are resistant to aminoglycoside antibiotics (e.g., AMK, gentamicin (GEN), kanamycin (KAN), tobramycin (TOB)) and tetracyclines (e.g., tigecycline (TGC)). When a mab produces... fusA The 1613 G>A mutation results in cross-resistance to aminoglycosides (AMK, GEN, KAN, TOB), macrolides (e.g., clarithromycin (CLA), azithromycin (AZM), roxithromycin (ROX)), and tetracyclines (TGC).
[0008] Definition of noun: mutation site fusA 1318 A>G: indicates fusA The A at position 1318 of the gene's nucleic acid sequence is changed to G.
[0009] mutation site fusA 1613 G>A: indicates fusA The G at position 1613 of the gene's nucleic acid sequence is changed to A.
[0010] mutation site fusA 1872_1883 dup GGGCGACGTGAT: indicates fusA A tandem repeat (GGGCGACGTGAT) appears at positions 1872 to 1883 after position 1883 of the gene's nucleic acid sequence.
[0011] In a second aspect, the present invention provides a set of nucleotide sequences for detecting drug resistance in Mycobacterium abscessus, said nucleotide sequences comprising nucleotides as shown in any one of SEQ ID No. 2-4.
[0012] Sequencing revealed that it carries fusA 1318 A>G gene mutation fusA Nucleotide sequence, as shown in SEQ ID No. 2; with fusA 1613 G>A gene mutation fusA Nucleotide sequence, as shown in SEQ ID No. 3; with fusA1872_1883 dup GGGCGACGTGAT gene mutation fusA The nucleotide sequence is shown in SEQ ID No. 4.
[0013] Thirdly, the present invention provides a kit for detecting drug resistance in Mycobacterium abscessus, the kit comprising the nucleotide sequence described in the second aspect.
[0014] This invention has discovered substances containing the aforementioned mutation sites. fusA Gene sequences were used as positive controls for the test strains. fusA The gene sequence is compared with the nucleotides shown in any one of SEQ ID No. 2-4. If the comparison result of any sequence is consistent with the positive control, the test strain can be determined to be a drug-resistant strain to aminoglycosides and / or macrolides and / or tetracyclines, or a drug-sensitive strain to macrolides.
[0015] As a preferred embodiment of the third aspect, the kit further includes primers for amplifying the nucleotide sequence described in the second aspect, the nucleotide sequences of which are shown in SEQ ID No. 5-6.
[0016] This invention constructs a method capable of amplifying data containing various mutation sites. fusA Primers for the gene, which amplify the gene of the test strain. fusA After obtaining the gene and amplification product, it is compared with the positive control or wild-type strain. If any of the above mutations are detected, the strain to be tested can be determined to be a drug-resistant strain to aminoglycosides and / or macrolides and / or tetracyclines, or a drug-sensitive strain to macrolides.
[0017] As a preferred embodiment of the third aspect, the kit further includes PCR buffer, MgCl2 solution, dNTPs, Taq DNA polymerase, ddH2O, nucleic acid dyes, and sequencing purification reagents.
[0018] Fourthly, the present invention provides the application of the molecular markers described in the first aspect, the nucleotide sequences described in the second aspect, and the kits described in the third aspect in detecting drug resistance or sensitivity of Mycobacterium abscessus.
[0019] As a preferred embodiment of the fourth aspect, the drug resistance refers to the resistance of Mycobacterium abscessis to aminoglycosides, macrolides, and / or tetracyclines; the sensitivity refers to the sensitivity to macrolides.
[0020] This invention has found that fusA 1318 A>G and fusAMab cells with the 1872_1883 dup GGGCGACGTGAT mutation are resistant to aminoglycoside antibiotics (e.g., AMK, GEN, KAN, TOB) and tetracyclines (e.g., TGC), while exhibiting lateral sensitivity to macrolide antibiotics (e.g., CLA, AZM, ROX). When Mab cells produce… fusA The 1613 G>A mutation results in cross-resistance to aminoglycosides (e.g., AMK, GEN, KAN, TOB), macrolides (e.g., CLA, AZM, ROX), and tetracyclines (e.g., TGC).
[0021] Therefore, when the mycobacterium abscess to be tested... fusA Detected in genes fusA 1318 A>G or / and fusA When the 1872_1883 dup GGGCGACGTGAT mutation occurs, *Mycobacterium abscessus* exhibits resistance to aminoglycosides and / or tetracyclines, while showing some sensitivity to macrolides. When the tested *Mycobacterium abscessus*... fusA Detected in genes fusA When the 1613 G>A mutation is present, *Mycobacterium abscessum* exhibits resistance to aminoglycosides, macrolides, and / or tetracyclines. Therefore, the molecular markers described in the first aspect, the nucleotide sequences described in the second aspect, and the kits described in the third aspect can be used to detect the resistance or sensitivity of *Mycobacterium abscessum* to antibiotics.
[0022] As a preferred embodiment of the fourth aspect, the aminoglycoside drug is any one of AMK, GEN, KAN, TOB, and TGC; the macrolide drug is any one of CLA, AZM, and ROX; and the tetracycline drug is TGC.
[0023] Fifthly, the present invention provides a method for detecting antibiotic resistance in Mycobacterium abscessus, comprising the following steps: S1 uses the forward amplification primers shown in SEQ ID No. 5 and the reverse amplification primers shown in SEQ ID No. 6 to amplify the genome of the target Mycobacterium abscessus. fusA Genes, Acquisition fusA Gene amplification products; S2 uses Sanger sequencing pairs fusA Sequencing of gene amplification products; S3 will fusA The nucleotide sequences of the gene amplification product are respectively compared with those of wild-type Mycobacterium abscessus. fusA Gene comparison; S4 Result Judgment: fusAGene amplification products and wild-type Mycobacterium abscessus fusA If any of the following mutations occur after gene matching, the bacteria are identified as antibiotic-resistant: (1) The above fusA Genetic development fusA 1613 G>A mutation; identified as drug-resistant bacteria to aminoglycosides, macrolides, and / or tetracyclines; (2) The above fusA Genetic development fusA 1318 A>G mutation; identified as a drug-resistant bacterium to aminoglycosides and / or tetracyclines; (3) The above fusA Genetic development fusA The 1872_1883 dup GGGCGACGTGAT mutation indicates a resistant bacterium to aminoglycosides and / or tetracyclines.
[0024] As a preferred embodiment of the fifth aspect, the fusA Genetic development fusA The 1318 A>G mutation was identified as a resistant strain to AMK, GEN, KAN, TOB, and TGC. fusA Genetic development fusA The 1613 G>A mutation was identified as a resistant strain to AMK, GEN, KAN, TOB, CLA, AZM, ROX, and TGC. fusA Genetic development fusA The 1872_1883 dupGGGCGACGTGAT mutation was identified as a drug-resistant strain to AMK, GEN, KAN, TOB, and TGC.
[0025] Sixthly, the present invention provides a method for detecting Mycobacterium abscessus. fusA Application of reagents containing any of the following gene mutation sites in detecting the susceptibility of Mycobacterium abscessis to macrolide antibiotics: (1) The above fusA Genetic development fusA 1318 A>G mutation; (2) The above fusA Genetic development fusA The 1872_1883 dup GGGCGACGTGAT mutation.
[0026] This invention discovers that not only can it be achieved through... fusA Gene mutation detection can be used to assess Mab's drug resistance and its sensitivity to antibiotics. Experiments have shown that when... fusA Genetic development fusA 1318 A>G、 fusAMutations in any of the 1872-1883 dupGGGCGACGTGAT sequences increase Mab’s sensitivity to macrolide antibiotics (CLA, AZM, ROX).
[0027] In a seventh aspect, the present invention provides a method for improving the sensitivity of Mycobacterium abscesses to macrolide drugs, the method being for improving the sensitivity of Mycobacterium abscesses to macrolide drugs. fusA The gene undergoes any of the following mutations: (1) The above fusA Genetic development fusA 1318 A>G mutation; (2) The above fusA Genetic development fusA The 1872_1883 dup GGGCGACGTGAT mutation.
[0028] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention discloses for the first time fusA Gene mutations are a significant cause of resistance in Mab to AMK, GEN, KAN, TOB, and TGC, filling a gap in existing drug resistance gene databases. By detecting the molecular markers provided in this invention, rapid and accurate molecular diagnosis of AMK, GEN, KAN, TOB, and TGC resistance in clinical isolates can be achieved, overcoming the drawback of long cycles (>3 days) in traditional phenotypic drug susceptibility testing.
[0029] 2. The diagnostic markers and detection primers of the present invention can provide clinicians with timely medication guidance, avoid the use of ineffective drugs, shorten the treatment window, and improve patient prognosis, thus having high clinical application value.
[0030] 3. The present invention also discovered that different fusA Gene mutation sites can simultaneously affect the sensitivity of strains to macrolide antibiotics (such as CLA, AZM, and ROX) (some become more sensitive, while others become more resistant). Therefore, while detecting resistance to AMK, GEN, KAN, and TOB, this marker can also provide crucial decision-making information for subsequent combination therapy regimens (such as whether macrolide antibiotics can be used in combination). Attached Figure Description
[0031] Picture 1 For Sanger sequencing fusA A schematic diagram comparing the gene mutation detection results with the wild-type Mab GZ002 (a). fusA The 1318th position A is changed to G, which is defined as Mab. fusA1318 b. fusA The 1613th position G is changed to A and defined as Mab fusA1613 c. fusAThe concatenation of GGGCGACGTGAT appearing after the 188th position is defined as Mab. fusA1883 ); Picture 2 On solid 7H10 medium plates, different fusA A schematic diagram illustrating the drug sensitivity of gene-edited strains to different drugs; Picture 3 A schematic diagram showing the growth of the gene-edited strain (a. Mab) WT and Mab's fusA Growth curves of gene-edited strains; b. Mab fusA The relative adaptive cost of gene-edited strains. Detailed Implementation
[0032] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.
[0033] Example 1: Discovery and Validation of Drug Resistance-Related Mutation Sites 1. Screening of spontaneously resistant mutants: Take wild Mab plants (Mab WT The bacterial suspensions were spread on 7H10 solid medium containing different concentrations of AMK (16, 32, 64, 128 μg / mL), and the spontaneous mutation frequency was calculated after incubation, as shown in Table 1.
[0034] Table 1. Spontaneous resistance mutation frequency of Mab at different AMK concentrations. 2. Initial screening and whole-genome sequencing: Single colonies were randomly picked from drug-resistant plates and subjected to antimicrobial susceptibility testing to confirm elevated MICs. Strains with elevated MICs were then subjected to testing for known resistance genes (…). rrs , rpsL PCR amplification and Sanger sequencing were performed. In the absence of known drug resistance genes ( rrs , rpsL Among the AMK-resistant strains with mutations, whole-genome sequencing and Sanger sequencing revealed 5 strains carrying the mutation. fusA Strains with gene mutations. One of them is... fusA 1318 A>G mutation, 3 strains were fusA 1613 G>A mutation, one of which is fusA 1872_1883 dupGGGCGACGTGAT mutation (Table 2).
[0035] Table 2. Findings from whole-genome sequencing and Sanger sequencing fusA mutation * Note: The strain number is B2-S32-42 as an example. "B2" means the bacteria in the second batch, "S" means strain, "32" means the AMK concentration used in the screening plate is 32 μg / mL, and "42" means the 42nd single colony picked.
[0036] Example 2: Verification of the function of the mutation site through gene editing 1. Constructing gene-edited strains: Using the CRISPR / Cas12a system and Mab GZ002 as the parent material, according to Table 2... fusA Gene-edited strains were constructed using mutation sites. fusA Gene-edited strains carrying specific mutations at gene sites (1318, 1613, and 1883) were successfully constructed and named Mab. fusA1318 Mab fusA1613 Mab fusA1883 After successful construction, PCR and sequencing were performed for verification. The sequencing results were then compared with those of the wild-type Mab GZ002 strain (Mab GZ002). WT )of fusA Genes were compared, and the comparison results are as follows: Picture 1 As shown, the gene-edited strain obtained was: Mab fusA1318 Mab fusA1613 Mab fusA1883 .
[0037] 2. Drug sensitivity test: The MICs of various drugs against gene-edited strains and wild-type strains were determined using the micro-broth dilution method; the drug resistance of gene-edited strains to various drugs was verified using the solid plate method. The tested drugs are as follows: Aminoglycoside drugs: AMK, GEN, KAN, TOB; Macrolide antibiotics: CLA, AZM, ROX; Tetracycline drugs: TGC.
[0038] The drug sensitivity results are shown in Table 3 and Picture 2 : Table 3. MICs of different drugs against different gene-edited strains * Note: Due to the induced drug resistance characteristics of CLA, the MIC was read on day 14 of culture, while the MIC of other drugs was read on day 3.
[0039] 3. Assess growth status: Growth curves of wild-type strains and gene-edited strains and their relative fitness costs were measured, as shown in Picture 3 .
[0040] 4. Test results: The comprehensive above test results showed that the MIC values of all gene-edited strains against aminoglycoside drugs were significantly increased (2 - 8 times) compared with the wild-type strains, and the MIC values against tetracycline drugs were also significantly increased, confirming that the mutations at these sites directly led to resistance to AMK, GEN, KAN, TOB, and TGC (Table 3). In addition, the mutations at different sites had different sensitivities to different macrolides, some became resistant and some became sensitive: From the results of measuring the sensitivity to macrolide drugs by the solid plate method, Mab fusA1318 、Mab fusA1883 became more sensitive to macrolide drugs (CLA, AZM, ROX), while the MIC of CLA, AZM, and ROX against Mab fusA1613 strains increased by 2 - 8 times ( Picture 2 ). For the growth situation, the growth of all gene-edited strains was worse than that of the wild-type strains, indicating that the strains paid a certain fitness cost to become drug-resistant ( Picture 3 ).
[0041] The wild-type sequence involved in the present invention can refer to the nucleotide sequence of the fusA gene (encoding elongation factor G (EF-G), gene ID: MAB_3849c) of the Mab standard strain (GZ002, CP034181) in the public database (NCBI GenBank).
[0042] The mutations of the present invention are variations occurring at specific nucleotide positions of the fusA gene based on the standard strain, and the nucleotide sequence of the unmutated fus A gene is shown in SEQ ID No.1. The nucleotide sequence with the fusA 1318 A>G gene mutation is shown in SEQ ID No.2; the nucleotide sequence with the fusA 1613 G>A gene mutation is shown in SEQ ID No.3; the nucleotide sequence with the fusA 1872_1883 dup GGGCGACGTGAT gene mutation is shown in SEQ ID No.4.
[0043] Assembly and application of the detection kit in Example 3 1. This example provides a kit for detecting the drug resistance or sensitivity of Mycobacterium abscessus to antibiotic drugs, which contains the following reagents: (1) Used for amplification fusA The gene contains forward amplification primers Mab-fusA-F and reverse amplification primers Mab-fusA-R for regions at sites 1318, 1613, and 1883. The primer sequences are as follows: Mab-fusA-F: gaacttcgccttcgccactt (SEQ ID No. 5); Mab-fusA-R:ctcgccgtgagaagaccatg (SEQ ID No. 6).
[0044] (2) Reagents required for PCR reaction: Taq DNA polymerase (2.5 U): 0.5 μL, MgCl2 (25 mM): 3.5 μL, dNTPs (10 mM): 2 μL, 10× PCR buffer: 5 μL, primer-F: 2.5 μL (for identification) fusA Mutation forward amplification primers: Mab-fusA-F: gaacttcgccttcgccactt), primer-R: 2.5 μL (for identification) fusA Mutant reverse amplification primers: Mab-fusA-R: ctcgccgtgagaagaccatg), bacterial culture sample or DNA sample: 2 μL, ddH2O: 32 μL, total PCR reaction volume: 50 μL, positive control (containing known...) fusA Mutated DNA), nucleic acid dyes, and sequencing purification reagents.
[0045] 2. Clinical applications: (1) Sample processing: Mab strains were isolated and cultured from the patient's sputum or tissue, and genomic DNA was extracted.
[0046] (2) PCR amplification and sequencing: Use the primers in the kit to amplify the target region by PCR, and then perform Sanger sequencing after purifying the PCR product.
[0047] (3) Result interpretation: The sequencing results are compared with the wild-type reference sequence (e.g., NCBI accession number: CP034181), and the results are determined according to the following criteria: like fusA Genetic development fusA 1613 G>A mutation; identified as drug-resistant bacteria to aminoglycosides, macrolides, and / or tetracyclines; like fusA Genetic development fusA 1318 A>G mutation; identified as a drug-resistant bacterium to aminoglycosides and / or tetracyclines; like fusA Genetic development fusA The 1872_1883 dup GGGCGACGTGAT mutation indicates a resistant bacterium to aminoglycosides and / or tetracyclines.
[0048] like fusA Genetic development fusA 1318 A>G mutation; identified as a susceptible bacterium to macrolide antibiotics.
[0049] like fusA Genetic development fusA The 1872_1883 dup GGGCGACGTGAT mutation indicates that the bacteria is susceptible to macrolide antibiotics.
[0050] If not detected fusA The gene mutation indicates that the bacteria are either resistant to or susceptible to aminoglycosides, macrolides, and / or tetracyclines.
[0051] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A set of molecular markers for detecting drug resistance in Mycobacterium abscessus, characterized in that, The molecular marker is Mycobacterium abscessus. fusA Genetic mutation; The fusA Gene mutations include fusA 1318 A > G、 fusA 1613 G > A、 fusA 1872_1883 dupGGGCGACGTGAT.
2. A group of nucleotides for detecting drug resistance in Mycobacterium abscessus, characterized in that, The nucleotides include those with sequences as shown in any one of SEQ ID No. 2-4.
3. A kit for detecting drug resistance in Mycobacterium abscessus, characterized in that, The kit comprises the nucleotide sequence of claim 2.
4. The kit according to claim 3, characterized in that, The kit further includes primers for amplifying the nucleotide sequence of claim 2, the nucleotide sequences of which are shown in any one of SEQ ID No. 5-6.
5. The reagent kit as described in claim 3, characterized in that, The kit also includes PCR buffer, MgCl2 solution, dNTPs, Taq DNA polymerase, ddH2O, nucleic acid dyes, and sequencing purification reagents.
6. The use of the molecular marker as described in claim 1, the nucleotide sequence as described in claim 2, and the kit as described in any one of claims 3-5 in detecting drug resistance or sensitivity of Mycobacterium abscessus.
7. The application as described in claim 6, characterized in that, The drug resistance or sensitivity refers to the resistance or sensitivity of Mycobacterium abscessis to aminoglycosides, macrolides, and / or tetracyclines.
8. A method for detecting antibiotic resistance in Mycobacterium abscessus, characterized in that, Includes the following steps: S1 uses the forward amplification primers shown in SEQ ID No. 5 and the reverse amplification primers shown in SEQ ID No. 6 to amplify the genome of the target Mycobacterium abscessus. fusA Genes, Acquisition fusA Gene amplification products; S2 uses Sanger sequencing pairs fusA Sequencing of gene amplification products; S3 will fusA The nucleotide sequence of the gene amplification product is similar to that of wild-type Mycobacterium abscessus. fusA Gene comparison; S4 Result Judgment: fusA Gene amplification products and wild-type Mycobacterium abscessus fusA If any of the following mutations occur after gene matching, the bacteria are identified as resistant to aminoglycosides and / or macrolides and / or tetracyclines: (1) The above fusA Genetic development fusA 1613 G > A mutation; identified as a drug-resistant bacterium to aminoglycosides, macrolides, and / or tetracyclines; (2) The above fusA Genetic development fusA 1318 A > G mutation; identified as a drug-resistant bacterium to aminoglycosides and / or tetracyclines; (3) The above fusA Genetic development fusA The 1872_1883 dup GGGCGACGTGAT mutation indicates a resistant bacterium to aminoglycosides and / or tetracyclines.
9. Detection of Mycobacterium abscessus fusA Application of reagents containing any of the following gene mutation sites in detecting the susceptibility of Mycobacterium abscessis to macrolide antibiotics: (1) The above fusA Genetic development fusA 1318 A > G mutation; (2) The above fusA Genetic development fusA The 1872_1883 dup GGGCGACGTGAT mutation.
10. A method for improving the sensitivity of Mycobacterium abscessis to macrolide drugs, characterized in that, The method described is for the treatment of Mycobacterium abscessus. fusA The gene undergoes any of the following mutations: (1) The above fusA Genetic development fusA 1318 A > G mutation; (2) The above fusA Genetic development fusA The 1872_1883 dup GGGCGACGTGAT mutation.