Molecular marker of corn inflorescence development mutant gene sl1 and application thereof

Abstract

The invention discloses a molecular marker of a corn inflorescence development mutant gene sl1 and application of the molecular marker, and belongs to the technical field of plant genetic engineering. The molecular marker is composed of a nucleotide sequence as shown in SEQ ID NO. 1. The invention also provides a primer pair for amplifying the molecular marker. The molecular marker provided by the invention is closely linked with the inflorescence development mutant gene sl1, the identification result is accurate and reliable, a material basis is provided for the application of the inflorescence development mutant gene sl1 in breeding, and the molecular marker has a huge application value in corn yield breeding.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to molecular markers and their applications for the sl1 gene, a mutant gene in maize inflorescence development. Background Technology

[0002] Maize is one of the world's most important cereal crops. Besides being a major source of food and feed, maize kernels also provide a large amount of raw material for the production of various industrial products. Therefore, increasing maize yield has always been a primary goal in maize breeding to meet growing demand. The formation of maize inflorescence morphology directly determines yield, and extensively exploring genes regulating inflorescence development and analyzing their functions has significant theoretical and practical implications for high-yield breeding.

[0003] Currently, many genes regulating inflorescence morphogenesis have been cloned, mainly involved in the formation and differentiation of meristems and sex determination: (1) Genes related to meristem formation. Genes BA1, FEA3, KNR6 / ACO2, and BIF2 / VT2 / BD1 affect inflorescence development by regulating AM, SAM, IM, and BM formation, respectively. Among them, BIF2 and VT2 are involved in the synthesis and transport of IAA, and ACO2 is involved in ethylene synthesis, indicating that plant hormones are very important for the formation of inflorescence meristems. In addition, RTE, EAD1, and Lac4 affect the formation of meristems by regulating boron transport, malic acid transport, and lignin synthesis, respectively, indicating that boron, malic acid, and lignin are indispensable for inflorescence development; (2) Genes related to sex determination. TS1, TS5, and si3 affect sex determination by regulating JA synthesis, JA inactivation, and JA and GA homeostasis, respectively, indicating that plant hormones play an important role in sex determination in maize. In addition, MADS-box genes STS1 and BDE are also involved in determining the identity characteristics of floral organs.

[0004] Although many genes regulating inflorescence morphogenesis have been identified, our understanding of maize inflorescence development remains limited. Therefore, discovering new maize inflorescence development mutants and cloning their regulatory genes is of great significance for revealing the molecular mechanisms of inflorescence development and for high-yield maize breeding practices. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular marker for the maize inflorescence development mutant gene sl1 and its application, in order to solve the problems existing in the prior art. Using the molecular marker of this invention to identify materials carrying the inflorescence development mutant gene sl1 can improve the identification efficiency of maize inflorescence regulatory traits. It can also be used as a genetic marker in maize molecular breeding, maize germplasm resource genetic improvement and other fields.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] In a first aspect, the present invention provides a molecular marker for the maize inflorescence development mutant gene sl1, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] Secondly, the present invention also provides a primer set for detecting the aforementioned molecular marker, the primer set comprising an upstream primer sequence as shown in SEQ ID NO.2 and a downstream primer sequence as shown in SEQ ID NO.3.

[0009] Thirdly, the present invention also provides an application of the described molecular marker or the described primer set in any of the following:

[0010] (1) Identification of the sl1 gene, a mutant gene in maize inflorescence development;

[0011] (2) Screening for varieties with mutations in maize inflorescence development;

[0012] (3) Genetic improvement of maize germplasm resources;

[0013] (4) Screening superior maize germplasm resources.

[0014] Fourthly, the present invention also provides the application of the primer set described above in the preparation of products for identifying the maize inflorescence development mutant gene sl1.

[0015] Preferably, the product is a reagent kit.

[0016] Fifthly, the present invention also provides a product for identifying the maize inflorescence development mutant gene sl1, the product comprising the primer set described above.

[0017] Preferably, the product is a reagent kit.

[0018] In a sixth aspect, the present invention also provides an application of any of the products described in any of the following:

[0019] (1) Identification of the sl1 gene, a mutant gene in maize inflorescence development;

[0020] (2) Screening for varieties with mutations in maize inflorescence development;

[0021] (3) Genetic improvement of maize germplasm resources;

[0022] (4) Screening superior maize germplasm resources.

[0023] In a seventh aspect, the present invention also provides a method for identifying the maize inflorescence development mutant gene sl1, comprising the following steps:

[0024] Using the genomic DNA of the maize material to be tested as a template, PCR amplification was performed using the primer set described above, and the amplification products were analyzed for genotype.

[0025] If the amplification product is only a 312bp DNA fragment, then the maize material to be tested is a material with the inflorescence development mutant gene sl1.

[0026] Eighthly, the present invention also provides a method for breeding superior maize germplasm resources, comprising the following steps:

[0027] Using the genomic DNA of the maize material to be tested as a template, PCR amplification was performed using the primer set described above, and the amplification products were analyzed for genotype.

[0028] If the amplification product is only a 312bp DNA fragment, then the maize material to be tested is a homozygous material with the inflorescence development mutant gene sl1;

[0029] If the amplification product is only a 417bp DNA fragment, then the maize material to be tested is a homozygous material that does not have the inflorescence development mutant gene sl1.

[0030] If the amplification product includes a 417bp and a 312bp DNA fragment, then the maize to be tested is a heterozygous material with the inflorescence development mutant gene sl1.

[0031] Homozygous materials whose amplification products consist of only a 312bp DNA fragment were eliminated, while homozygous materials whose amplification products consisted of only a 417bp DNA fragment or heterozygous materials whose amplification products included both a 417bp and a 312bp DNA fragment were selected as superior maize germplasm resources.

[0032] Preferably,

[0033] The PCR amplification reaction system consisted of: 7.5 μL 2×PCR Mix, 0.3 μL each of 10 μM upstream and downstream primers, 1.5 μL DNA template of 50-200 ng / μL, and 5.4 μL ddH2O.

[0034] The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; and finally incubation at 72℃ for 2 min to end the program.

[0035] The present invention discloses the following technical effects:

[0036] (1) Through genetic analysis, this invention clarifies that the mutant traits carrying the inflorescence development mutant gene sl1 are controlled by a single nuclear gene and exhibit recessive inheritance. The results show that the mutants carrying the inflorescence development mutant gene sl1 have reduced tassel branches and spikelet numbers, as well as reduced silking on some spikelets, reduced silking on female ears, and reduced ear grain filling; the mutant phenotype is stable. The mutants carrying the inflorescence development mutant gene sl1 provided by this invention can provide a material basis for maize yield breeding.

[0037] (2) This invention uses polymorphic molecular marker localization technology to locate the mutant gene sl1 between the polymorphic molecular markers SL1-M3 and SL1-M5 on maize chromosome 3, with an interval of 220,203,627-221,337,496 (reference genome is B73 RefGen_V5). Further, through the development of polymorphic molecular markers, a molecular marker closely linked to this mutant trait is obtained, which can be used to identify or screen whether plants contain the sl1 mutant gene. The detection results are reliable and simple to perform. Using this molecular marker to identify maize materials can improve the efficiency of identifying maize inflorescence-related traits. As a genetic marker applied to maize yield breeding, it has high application value.

[0038] The aforementioned molecular markers and primer set were used to perform PCR amplification and genotyping on different maize materials. Based on the amplification results, homozygous materials whose amplification products consisted of only a 312 bp DNA fragment were eliminated. Homozygous materials whose amplification products consisted of only a 417 bp DNA fragment, or heterozygous materials whose amplification products included both a 417 bp and a 312 bp DNA fragment, were selected as superior maize germplasm resources. This molecular marker and primer set can be used for the breeding of superior maize germplasm resources and has high application value. Attached Figure Description

[0039] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0040] Figure 1 The results of phenotypic identification of maize inflorescence development mutant and wild-type Qi 319 are shown. Among them, A is a comparison of plant type between Qi 319 and the mutant, with a scale bar of 50 cm; B is the male inflorescence of Qi 319 and the mutant, with a scale bar of 50 cm; C is the silk of the female ear of Qi 319 and the mutant, with a scale bar of 50 cm; D is the naturally pollinated ear of Qi 319 and the mutant, with a scale bar of 5 cm.

[0041] Figure 2Molecular marker localization and tight linkage marker development for the sl1 mutant gene in maize inflorescence development; A shows the initial localization results using 83 mutant individuals from the (Mo17× mutant) F2 population; B shows the fine localization results using 1369 mutant individuals from the (Mo17× mutant) F2 population; the numbers below the marker names indicate the number of recombinant individuals in the corresponding population, and the scale bar indicates the physical distance; C shows the electrophoresis results of the sl1 linkage molecular markers developed within the localization interval, where W represents wild-type individuals and M represents mutant individuals. Detailed Implementation

[0042] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0043] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0044] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0045] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0046] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0047] Example 1: Obtaining a mutant carrying the inflorescence development mutant gene sl1

[0048] pass 60Co-γ ray treatment of maize inbred line Qi 319 resulted in the selection of a mutant with abnormal inflorescence development from its mutagenesis progeny. Phenotypic identification of the mutant, grown for many years in Sichuan and Yunnan provinces, showed that it exhibited reduced tassel branch number and spikelet number, as well as reduced silking on some spikelets, reduced silking on female ears, and reduced ear grain filling. The mutant phenotype was stable, and its agronomic traits were not significantly altered. Figure 1 Further research revealed that this mutant trait is controlled by a single recessive gene, which was named settingless1(sl1).

[0049] Example 2: Genetic analysis of mutants carrying the sl1 gene mutation for inflorescence development

[0050] Using the inbred line Mo17 and the mutant, populations of (Mo17× mutant)F2, (Mo17× mutant)BC1, and (Mo17× mutant)BC1F2 were created. The phenotypes of individual plants in each population were observed, and the number of wild-type and mutant plants in each population was counted. Chi-square test showed that the segregation ratio of wild-type to mutant plants in the (Mo17× mutant)F2 and (Mo17× mutant)BC1F2 populations was 3:1, and the segregation ratio of wild-type to mutant plants in the (Mo17× mutant)BC1 population was 1:1 (Table 1). This indicates that the mutant phenotype of the inflorescence development mutant gene sl1 is controlled by a single recessive gene.

[0051] Table 1. Genetic analysis of mutants carrying the sl1 gene mutation for inflorescence development.

[0052] Material Combination Total number of plants Normal plant count Number of mutant strains Target separation ratio χ² <![CDATA[(Mo17×mutant) F2]]> 248 196 52 3:1 1.94 <![CDATA[(Mo17×mutant) BC1]]> 128 75 53 1:1 3.45 <![CDATA[(Mo17×mutant) BC1F2]]> 874 664 210 3:1 0.39

[0053] Example 3: Localization of the sl1 mutant gene for maize inflorescence development

[0054] According to the method described in Example 2, an F2 population (Mo17× mutant) was constructed. Eighty-three mutant plants from this population were used to locate the sl1 gene, a mutant gene associated with maize inflorescence development. The marker primer sequences used for this location are shown in Table 2, and the gene location results are as follows: Figure 2 The mutant gene sl1 was initially located between markers 213.275 and 217.894 on the long arm of maize chromosome 3, with a physical distance of 4.5 Mb. Figure 2 (A)

[0055] To further narrow the localization interval, new marker primers were developed between markers 213.275 and 217.894 (Table 2). Simultaneously, the localization population was expanded. A (Mo17× mutant) BC1F2 population was constructed according to the method described in Example 2. Genotyping was performed on 1369 mutant individuals in the (Mo17× mutant) BC1F2 population using the new marker primers. The mutant gene sl1 was further localized between markers SL1-M3 and SL1-M5, with a physical distance of 1.13 Mb between the two markers. Figure 2 (B)

[0056] Table 2 Primer sequences used for locating the mutant gene sl1

[0057] Primer name upstream primer Downstream primer 213.275 TCTACTCGAGTTGCGGCAC (SEQ ID NO.5) TTAAGCCGTTAACCGACGAC (SEQ ID NO.6) SL1-M1 ATGGCGAAACCGTACAAATC (SEQ ID NO.7) GATCCACTTCAAGAGCCTCG (SEQ ID NO.8) SL1-M2 CACCGTTCTGTTGCTGACTGG (SEQ ID NO.9) ATTTGCCAGGGATCCGAACG (SEQ ID NO.10) SL1-M3 ACATCAAAGCCCGACTGTAG (SEQ ID NO.11) ACGCGTCGATTGACGTACG (SEQ ID NO.12) SL1-M4 TTGCTTTTCTAATTTCTATGCAGC (SEQ ID NO.13) GGCACGCAAAATTAGTCCAT (SEQ ID NO.14) SL1-M5 CCTGCATACACCGCCATCAGAACTTCGT (SEQ ID NO.15) GAGACGTCGACCACGGCGAGCAGAGGAG (SEQ ID NO.16) SL1-M6 CGGAGCATGTCTCTGAGTGAA (SEQ ID NO.17) TTTAGGCACGTGGCAGAAAAT (SEQ ID NO.18) SL1-M7 GGTACGCTGTTGCACGTAAA (SEQ ID NO.19) TGAGAAGACAGCTGCAGGG (SEQ ID NO.20) 217.894 GGGACGAAACCCTAATGGAG (SEQ ID NO.21) CGCGGAGCTAAATCTGTAGG (SEQ ID NO.22)

[0058] Example 4: Development and validation of molecular markers closely linked to the sl1 gene, a mutant gene in maize inflorescence development.

[0059] Based on the above mapping results, the inflorescence development mutant gene sl1 was located between markers SL1-M3 and SL1-M5, with a physical distance of 1.13 Mb. A molecular marker closely linked to the mutant gene sl1 was developed within the mapping interval and named sl1InDel, with its nucleotide sequence shown in SEQ ID NO.1.

[0060] Amplification primers were designed for this molecular marker, and the primer sequences are shown in SEQ ID NO.2-3.

[0061] Upstream primer sl1InDel-F (SEQ ID NO.2): AGCTGTGATTGTCGCCACA;

[0062] Downstream primer sl1InDel-R (SEQ ID NO.3): ACCCTTCGCAAAAACCTAGC.

[0063] Genotyping was performed on individual plants of the (Mo17× mutant) F2 population in Example 2, and PCR amplification was performed using the primer set designed above.

[0064] The PCR amplification reaction system consisted of: 7.5 μL 2×PCR Mix, 0.3 μL each of 10 μM upstream and downstream primers, 1.5 μL DNA template at a concentration of 50-200 ng / μL, and 5.4 μL ddH2O.

[0065] The PCR amplification reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; and finally incubation at 72℃ for 2 min to end the program.

[0066] PCR amplification results showed that the mutant plant could only amplify a single 312 bp band (its nucleotide sequence is shown in SEQ ID NO.1); the wild-type plant could only amplify a single 417 bp band (its nucleotide sequence is shown in SEQ ID NO.4), or simultaneously amplify a 417 bp and a 312 bp band. Figure 2 (C)

[0067] Meanwhile, field phenotype identification of this population revealed that mutant plants exhibited reduced number of male spike branches and spikelets, as well as reduced silks on some spikelets, reduced silks on female ears, and reduced grain filling, while wild-type plants showed normal behavior (no mutant phenotype).

[0068] The above results demonstrate that the sl1InDel molecular marker described in this invention is closely linked to the maize inflorescence development mutant gene sl1 and exhibits co-dominance, thus it can serve as a molecular marker for the maize inflorescence development mutant gene sl1. The molecular markers of this invention are accurate and reliable for identifying the genotype of individual plants and can be used as molecular markers for the maize inflorescence development mutant gene sl1.

[0069] The nucleotide sequence of the sl1InDel molecular marker (SEQ ID NO.1): AGCTGTGATTGTCGCCACAGTCCAGATCAATAGATCATTGGATGTGCAAACGTTACGACAATGATACGAGGGTCAAGGTGCATGTGTTAGTACTTAGTAGTGCCAATCAATATTCAGAGTGCTATGCTTTCTGTCAAGACTAATTAGCACGCC CAAAGTTTTCTATCGTTAATTGGTTGTACTACACGTGCCAGCAGCAGCAGCAGCCCAGCCCACCGTGGTGATGCAGCCCAGCCCACTGCGGTGATGCAGCCCAGCCCATACAACGGCCCGGGGCACCTGACCTCTGACAGCTAGGTTTTTGCGAAGGGT.

[0070] SEQ ID NO.4: AGCTGTGATTGTCGCCACAGTCCAGATCAATAGATCATTGGATGTGCAAACGTTACGACAATGATACAAGGGTCAGGGTGTATGTGTTAGTAGTGCCAATCAATATTCAAGGGTGCACAATCACAGGCGAAATGTTTGTGTTTGGACGCGGTCATGAATCACTCGGAGCGAGCGGTCCCAAAGACAAAGAGTGCTATGCTTTCTGTC AAGACTAATTAGCACGCCCAAAGTACAATGGTTCTATCGTTAATTGGTTGTACCACACCTGCCAGCAGCAGCAGCAGCCCTGCCCACTGCGGTGATACAGCTCAGCTCACCGTGGTGATGCAGCCCAGCCCACTGCGGTGATGCAGCCCAGCCCACATACAACGGCCCGGGGCACCTGACCTCTGACAGCTAGGTTTTTGCGAAGGGT.

[0071] Fine mapping of the mutant gene sl1 allows for the development of tightly linked molecular markers for this mutant trait, which can be used to rapidly transfer the sl1 mutant trait into other inbred lines. Further cloning of the sl1 mutant gene enables the rapid formation of the mutant trait in other materials using site-directed gene editing technology, promoting the application of the sl1 mutant trait in maize yield breeding. The mutant gene sl1 and the dominant molecular marker sl1InDel tightly linked to the mutant trait provided by this invention offer a material basis for maize yield breeding.

[0072] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker for the maize inflorescence development mutant gene sl1, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1.

2. A primer set for detecting the molecular marker of claim 1, characterized in that, The primer set includes an upstream primer sequence as shown in SEQ ID NO.2 and a downstream primer sequence as shown in SEQ ID NO.

3.

3. The use of the molecular marker of claim 1 or the primer set of claim 2 in any of the following: (1) Identification of the sl1 gene, a mutant gene in maize inflorescence development; (2) Screening for varieties with mutations in maize inflorescence development; (3) Genetic improvement of maize germplasm resources; (4) Screening superior maize germplasm resources.

4. The use of the primer set according to claim 2 in the preparation of a product for identifying the maize inflorescence development mutant gene sl1.

5. The application according to claim 4, characterized in that, The product in question is a reagent kit.

6. A product for identifying the sl1 gene mutation in maize inflorescence development, characterized in that, The product includes the primer set as described in claim 2.

7. The product according to claim 6, characterized in that, The product in question is a reagent kit.

8. The use of the product according to any one of claims 6-7 in any of the following: (1) Identification of the sl1 gene, a mutant gene in maize inflorescence development; (2) Screening for varieties with mutations in maize inflorescence development; (3) Genetic improvement of maize germplasm resources; (4) Screening superior maize germplasm resources.

9. A method for identifying the sl1 gene mutation in maize inflorescence development, characterized in that, Includes the following steps: Using the genomic DNA of the maize material to be tested as a template, PCR amplification was performed using the primer set described in claim 2, and the amplification products were analyzed for genotype. If the amplification product is only a 312bp DNA fragment, then the maize material to be tested is a material with the inflorescence development mutant gene sl1.

10. A method for breeding superior maize germplasm resources, characterized in that, Includes the following steps: Using the genomic DNA of the maize material to be tested as a template, PCR amplification was performed using the primer set described in claim 2, and the amplification products were analyzed for genotype. If the amplification product is only a 312bp DNA fragment, then the maize material to be tested is a homozygous material with the inflorescence development mutant gene sl1; If the amplification product is only a 417bp DNA fragment, then the maize material to be tested is a homozygous material that does not have the inflorescence development mutant gene sl1. If the amplification product includes a 417bp and a 312bp DNA fragment, then the maize to be tested is a heterozygous material with the inflorescence development mutant gene sl1. Homozygous materials whose amplification products consist of only a 312bp DNA fragment were eliminated, while homozygous materials whose amplification products consisted of only a 417bp DNA fragment or heterozygous materials whose amplification products included both a 417bp and a 312bp DNA fragment were selected as superior maize germplasm resources.

Images