KASP molecular marker linked with major QTL (Quantitative Trait Loci) of chromosome 3 of corn leaf included angle character and application of KASP molecular marker

By developing KASP molecular markers and their primer sets related to the leaf angle trait of maize, we have achieved efficient and accurate identification of maize with small leaf angle, which solves the problem of difficulty in identifying the leaf angle trait of maize in the existing technology and promotes the improvement of maize plant type and high-density planting breeding.

CN121852595APending Publication Date: 2026-04-14ANHUI SCI & TECH UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ANHUI SCI & TECH UNIV
Filing Date
2026-01-21
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies are insufficient to efficiently and accurately identify the leaf angle trait in maize, which affects the improvement of maize plant type and the process of breeding for high-density planting.

Method used

Develop KASP molecular markers associated with maize leaf angle traits, and use the KASP molecular marker with SEQ ID NO.1 and its primer set to identify leaf angle traits by PCR amplification and fluorescence signal detection. Provide kits and identification methods.

Benefits of technology

This method enables efficient and accurate identification of small-leaf angled maize, shortens the breeding cycle, improves breeding efficiency, and provides a theoretical basis and technical means for high-density planting-tolerant maize breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852595A_ABST
    Figure CN121852595A_ABST
Patent Text Reader

Abstract

The invention discloses a KASP molecular marker linked with a major QTL (Quantitative Trait Loci) of a chromosome 3 of a corn leaf included angle character and application of the KASP molecular marker, and belongs to the technical field of corn molecular breeding. According to the invention, a major QTL site of the corn leaf included angle character is screened, the QTL site is located at the 162842787 basic group of a chromosome 3 and is C or T, and the site is further developed into a KASP molecular marker with a nucleotide sequence as shown in SEQ ID NO. 1. Experimental results show that the KASP molecular marker developed by the invention can be used for efficiently and accurately identifying whether the corn to be detected is the lobular included angle type corn or not so as to separate a corn single plant with a small leaf included angle and a compact plant type in a population, and the KASP molecular marker is used for dense-planting-resistant improved breeding of the corn, so that the detection cost can be effectively saved, the period can be shortened, and the breeding efficiency can be improved. The invention provides a new theoretical basis and technical means for close-planting-resistant breeding of corn, and is suitable for large-scale popularization and application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of maize molecular breeding technology, and in particular to a KASP molecular marker linked to a major QTL site on chromosome 3 that is associated with the maize leaf angle trait, and its application. Background Technology

[0002] Maize (Zea mays L.), belonging to the Poaceae family, is the highest-yielding food crop, widely used as a vital source of human food, animal feed, and biofuel. Maize production plays an irreplaceable role in food security and economic development. Over the past decade, annual maize production has generally shown an upward trend, but the demand for maize products is expected to increase further. Therefore, to ensure the supply of maize products, improving the genetic characteristics of maize plant type traits to achieve high yields is currently an important research direction and a popular trend among many breeding researchers.

[0003] Leaf angle, the angle between the midrib of a leaf and the stem, is a complex quantitative trait controlled by multiple genes, primarily regulated by additive gene effects, and is one of the key factors influencing the ideal plant architecture of maize. Leaf angle directly affects light energy capture efficiency and planting density tolerance, thereby influencing population light energy utilization and ultimately maize yield. Therefore, studying the genetic mechanisms of leaf angle is crucial for improving maize plant architecture and increasing maize yield. In recent years, with the continuous breakthroughs in molecular biology and high-throughput sequencing technologies, genome-wide association studies (GWAS) have been widely used by researchers in the study of genetic traits in various crops such as cotton, maize, rapeseed, rice, and wheat. The principle lies in using association analysis of phenotypic and genomic genetic variations (such as single nucleotide polymorphisms, SNPs) in large-scale populations to locate phenotypic-related genetic loci and elucidate complex crop traits.

[0004] Therefore, it is urgent to develop SNP sites linked to the leaf angle trait in maize and to develop them into KASP molecular markers to promote the breeding and improvement of maize to tolerate dense planting. Summary of the Invention

[0005] The purpose of this invention is to provide a KASP molecular marker linked to a major QTL locus on chromosome 3 for the leaf angle trait in maize and its application, in order to solve the problems existing in the prior art. Using the KASP molecular marker developed in this invention, it is possible to efficiently and accurately identify whether the maize to be tested is a small-leaf-angle type maize, and then isolate maize individual plants with small leaf angles and compact plant type in the population for use in maize high-density planting improvement breeding. This invention provides a new theoretical basis and technical means for maize high-density planting breeding and is suitable for large-scale promotion and application.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a KASP molecular marker associated with the leaf angle trait in maize. The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.1. In the sequence shown in SEQ ID NO.1, position 31, Y, represents polymorphism, which is C or T.

[0008] The genotypes at position 31 of the sequence shown in SEQ ID NO.1 include CC, CT, and TT.

[0009] The present invention also provides a primer set for the above-mentioned KASP molecular marker, the primer set comprising nucleotide sequences as shown in SEQ ID NO.2 (F1), as shown in SEQ ID NO.3 (F2), and as shown in SEQ ID NO.4 (R1);

[0010] F1 and F2 are connected by fluorescent signal connectors of different colors.

[0011] Furthermore, the fluorescent signal connector connected to F1 is FAM, and the fluorescent signal connector connected to F2 is ViC.

[0012] The present invention also provides the application of the above-mentioned KASP molecular marker or the above-mentioned primer set in the preparation of products for detecting the leaf angle trait of maize.

[0013] Furthermore, the product is a reagent kit.

[0014] The present invention also provides a kit for identifying leaf angle characteristics, comprising the primer set described above.

[0015] The present invention also provides the application of the above-mentioned KASP molecular marker, the above-mentioned primer set, or the above-mentioned kit in identifying the leaf angle trait of maize.

[0016] The present invention also provides a method for identifying the angle trait of maize leaves, comprising the following steps:

[0017] Genomic DNA was extracted from the maize sample to be tested;

[0018] The genomic DNA was amplified by PCR using the primer set described above, and the fluorescence signal of the PCR amplification result was read.

[0019] Based on the fluorescence signal, the leaf angle trait of the maize under test can be identified;

[0020] If the fluorescence signal matches the color of the fluorescent connector of F1, then the corn to be tested is identified as a small-leaf angled corn.

[0021] If the fluorescence signal matches the color of the fluorescent connector of F2, then the corn to be tested is identified as a large-leaf angled corn.

[0022] The present invention also provides the application of the above-mentioned KASP molecular marker, the above-mentioned primer set, or the above-mentioned kit in the breeding of maize leaf angle trait.

[0023] This invention also provides a method for breeding small-leaf angled maize, comprising the following steps:

[0024] Genomic DNA was extracted from the maize sample to be tested;

[0025] The genomic DNA was amplified by PCR using the primer set described above, and the fluorescence signal of the PCR amplification result was read.

[0026] If the fluorescence signal matches the color of the fluorescent connector of F1, then the maize sample to be tested is retained for breeding.

[0027] The present invention discloses the following technical effects:

[0028] This invention screened a major-effect QTL locus for the leaf angle trait in maize. This QTL locus is located at base 162842787 on chromosome 3, and is either C or T. Furthermore, this locus was developed into a KASP molecular marker with the nucleotide sequence shown in SEQ ID NO.1. Experimental results show that using the KASP molecular marker developed in this invention, it is possible to efficiently and accurately identify whether a maize sample is a small-leaf-angle type, thereby isolating individual maize plants with small leaf angles and compact plant types from the population. This can be used for high-density planting improvement breeding of maize, effectively saving detection costs, shortening the cycle, and improving breeding efficiency. This invention provides a new theoretical basis and technical means for high-density planting breeding of maize, and will contribute to the cloning of maize leaf angle-related genes and the development of functional markers for these genes, making it suitable for large-scale application. Attached Figure Description

[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0030] Figure 1 This is a graph showing the distribution of leaf angle traits in a population of 212 inbred lines;

[0031] Figure 2 This is a density distribution map of single nucleotide polymorphisms on chromosomes of 212 inbred lines;

[0032] Figure 3 This is a diagram showing the results of the major-effect QTL site localization analysis at the maize leaf angle;

[0033] Figure 4 This is a graph showing the results of allelic analysis using peak SNP molecular markers at the major QTL locus on chromosome 3 of the maize leaf angle trait.

[0034] Figure 5 This is a graph showing the results of using the KASP molecular marker K2787 to detect 52 hybrids / hybrid combinations and 20 inbred lines. Detailed Implementation

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0040] To enrich the research on maize leaf angle, this invention utilizes 212 important inbred lines from a breeding project in southeastern China as a population. Based on the Maize6H-60K single nucleotide polymorphism (SNP) high-density chip, a SNP site closely linked to the major QTL site of maize leaf angle was located, and the KASP molecular marker was successfully developed, providing a new approach for maize high-density planting tolerance breeding improvement.

[0041] Through in-depth research by the inventors, this invention reveals for the first time a KASP molecular marker linked to a major QTL site on chromosome 3 that is associated with the maize leaf angle trait and its application, which can effectively improve the size of the maize leaf angle.

[0042] The inbred line group utilized in this invention consists of 212 inbred line materials from breeding projects in southeastern China. These materials can be divided into 10 groups: improved Reid, P group, Tang Sipingtou group, Lancaster, early-maturing hard grain group, Lüda red bone group, Reid group, IDT group, X group, and Mixed group.

[0043] Example 1: Determination of leaf angle phenotype in inbred line populations

[0044] The inbred line population was planted in Fengyang County, Anhui Province, China (32°N, 117°E) during 2023 and 2024, divided into two environments: 23FY and 24FY. Two replicates were set up for the 212 inbred lines, and single-row planting was adopted in plots with a row length of 5.00 m, a row spacing of 0.60 m, and a plant spacing of 0.33 m. Field management and other procedures were the same as conventional field management practices.

[0045] After maize reached maturity, five individual plants were randomly selected from each inbred line, and the leaf angle of the three leaves above the ear was measured. The mean leaf angle of the three leaves above the ear was taken as the phenotypic value. The maize leaf angle was defined as the angle between the midrib of the leaf and the stem, measured in degrees (°). The best linear unbiased estimate (BLUE value) was calculated for all environmental phenotypic values ​​of the 212 materials. The results are summarized in Table 1 and [Table data missing]. Figure 1 As shown.

[0046] Table 1. Best linear unbiased estimates (BLUE values) of leaf angle phenotypic values ​​for all environments of 212 materials.

[0047] Material Number Leaf angle (°) Material Number Leaf angle (°) Material Number Leaf angle (°) Material Number Leaf angle (°) SK2200391 20.45 SK2200444 23.39 SK2200497 30.09 SK2200550 19.11 SK2200392 16.85 SK2200445 14.38 SK2200498 31.61 SK2200551 26.24 SK2200393 6.45 SK2200446 24.14 SK2200499 27.95 SK2200552 33.77 SK2200394 21.56 SK2200447 27.34 SK2200500 14.45 SK2200553 15.82 SK2200395 18.40 SK2200448 28.91 SK2200501 11.71 SK2200554 15.26 SK2200396 14.11 SK2200449 17.01 SK2200502 13.79 SK2200555 19.39 SK2200397 18.50 SK2200450 12.18 SK2200503 19.22 SK2200556 29.64 SK2200398 32.69 SK2200451 20.71 SK2200504 17.66 SK2200557 17.07 SK2200399 17.51 SK2200452 17.11 SK2200505 17.45 SK2200558 17.75 SK2200400 10.23 SK2200453 13.38 SK2200506 19.81 SK2200559 14.31 SK2200401 27.35 SK2200454 18.64 SK2200507 21.20 SK2200560 25.23 SK2200402 15.94 SK2200455 13.37 SK2200508 54.98 SK2200561 23.30 SK2200403 12.84 SK2200456 15.24 SK2200509 22.60 SK2200562 37.69 SK2200404 21.76 SK2200457 18.66 SK2200510 28.47 SK2200563 13.56 SK2200405 20.45 SK2200458 17.54 SK2200511 43.64 SK2200564 7.93 SK2200406 12.92 SK2200459 20.37 SK2200512 43.14 SK2200565 24.36 SK2200407 10.57 SK2200460 24.84 SK2200513 29.98 SK2200566 54.86 SK2200408 19.18 SK2200461 18.69 SK2200514 24.80 SK2200567 33.93 SK2200409 16.58 SK2200462 24.89 SK2200515 40.43 SK2200568 22.45 SK2200410 12.69 SK2200463 27.24 SK2200516 34.62 SK2200569 14.12 SK2200411 27.31 SK2200464 27.83 SK2200517 38.13 SK2200570 26.42 SK2200412 26.56 SK2200465 23.65 SK2200518 37.01 SK2200571 42.06 SK2200413 25.55 SK2200466 9.30 SK2200519 31.99 SK2200572 55.52 SK2200414 38.91 SK2200467 22.00 SK2200520 29.58 SK2200573 17.47 SK2200415 21.52 SK2200468 28.36 SK2200521 43.63 SK2200574 22.97 SK2200416 20.97 SK2200469 16.56 SK2200522 34.29 SK2200575 41.05 SK2200417 16.53 SK2200470 23.53 SK2200523 66.91 SK2200576 48.21 SK2200418 26.93 SK2200471 26.04 SK2200524 28.81 SK2200577 22.50 SK2200419 14.83 SK2200472 28.62 SK2200525 28.12 SK2200578 32.83 SK2200420 22.98 SK2200473 7.41 SK2200526 20.01 SK2200579 34.48 SK2200421 11.15 SK2200474 11.59 SK2200527 22.41 SK2200580 14.91 SK2200422 6.62 SK2200475 15.33 SK2200528 20.15 SK2200581 16.61 SK2200423 20.79 SK2200476 10.01 SK2200529 26.41 SK2200582 35.55 SK2200424 24.96 SK2200477 10.29 SK2200530 23.39 SK2200583 24.47 SK2200425 28.79 SK2200478 19.73 SK2200531 9.90 SK2200584 21.18 SK2200426 24.38 SK2200479 11.40 SK2200532 14.16 SK2200585 15.55 SK2200427 25.68 SK2200480 8.84 SK2200533 21.00 SK2200586 18.23 SK2200428 27.15 SK2200481 15.70 SK2200534 15.63 SK2200587 29.07 SK2200429 19.23 SK2200482 25.02 SK2200535 32.73 SK2200588 22.58 SK2200430 17.48 SK2200483 16.51 SK2200536 25.28 SK2200589 24.78 SK2200431 10.08 SK2200484 10.46 SK2200537 31.69 SK2200590 18.09 SK2200432 21.73 SK2200485 22.51 SK2200538 19.55 SK2200591 19.59 SK2200433 14.78 SK2200486 8.43 SK2200539 12.89 SK2200592 17.15 SK2200434 18.72 SK2200487 9.80 SK2200540 31.22 SK2200593 29.16 SK2200435 15.18 SK2200488 12.39 SK2200541 17.18 SK2200594 10.62 SK2200436 19.79 SK2200489 10.13 SK2200542 23.9 SK2200595 13.14 SK2200437 11.17 SK2200490 8.80 SK2200543 12.41 SK2200596 30.19 SK2200438 21.33 SK2200491 8.21 SK2200544 21.23 SK2200597 10.48 SK2200439 21.31 SK2200492 24.88 SK2200545 21.77 SK2200598 37.77 SK2200440 18.13 SK2200493 38.05 SK2200546 18.10 SK2200599 16.34 SK2200441 17.40 SK2200494 22.65 SK2200547 17.50 SK2200600 30.02 SK2200442 17.40 SK2200495 11.77 SK2200548 25.55 SK2200601 19.76 SK2200443 29.91 SK2200496 18.90 SK2200549 13.00 SK2200602 20.49

[0048] Example 2: Obtaining a high-quality SNP dataset for an association population

[0049] Leaf samples were collected from 212 population-related natural populations of maize plants from important inbred lines from a breeding project in southeastern China when the maize reached the five-leaf stage, and DNA was extracted using the CTAB method.

[0050] DNA was extracted using the CTAB method. The reagents and procedures are as follows:

[0051] 1. Preparation of reagents

[0052] (1) Tris-HCl (1.0 M, pH 8.0): 60.58 g Tris-Base and 21 mL concentrated HCl were added to ddH2O and brought to a final volume of 500 mL.

[0053] (2) EDTA (0.5 M, pH 8.0): 186 g EDTA and 25 g NaOH (granules) were added to ddH2O and brought to a final volume of 1 L.

[0054] (3) 2% CTAB: 81.9 g NaCl, 100 mL 1.0 M Tris-HCl (pH 8.0), 40 mL 0.5 M EDTA (pH 8.0), 20 g CTAB, add ddH2O to make up to 1 L, sterilize and it can be used for DNA extraction.

[0055] (4) 5 M ammonium acetate: Add 385.4 g ammonium acetate to ddH2O and bring the volume to 1 L.

[0056] (5) 76% Ethanol (containing 10 mM ammonium acetate): 760 mL of anhydrous ethanol and 2 mL of 5 M ammonium acetate, add ddH2O to make up to 1 L.

[0057] (6) 3 M sodium acetate (pH 5.2): 246.09 g sodium acetate was added to ddH2O and acetic acid to make up to 1 L, and the pH was adjusted to 5.2 with acetic acid.

[0058] (7) 24:1 solution: Add 22 mL of isoamyl alcohol to 500 mL of chloroform and mix well.

[0059] 2. DNA extraction steps using the CTAB method

[0060] 1) Take a small amount of tender leaves (cotyledons for seedlings that germinate indoors) using a 2 mL centrifuge tube with a number written on it, and freeze it in a freezer at -20℃ for later use.

[0061] 2) Grind the sample according to the instructions for use of the grinding machine. The specific steps are as follows:

[0062] After removing the centrifuge tube, place it on ice, open the cap and add a clean steel ball, along with 100 μL of CTAB. After closing the cap, place it in the grinder adapter (28 times / s, 30 s). After grinding, remove the centrifuge tube, open the cap, pour out the steel ball, and then add 300 μL of CTAB.

[0063] 3) Place the centrifuge tubes on a centrifuge tray and bathe them in a water bath at 55-60℃ for 50-60 minutes, gently shaking them every 10 minutes. After the water bath, place them in a fume hood to cool to room temperature.

[0064] 4) Add an equal volume (400 μL) of 24:1 solution to the tube, shake gently for 10 minutes, and then centrifuge at 12000 rpm for 10 minutes;

[0065] 5) Transfer the supernatant (200 μL) to a 1.5 mL centrifuge tube with the same number as the original tube (pre-added with 1 / 10 volume of 3 M sodium acetate of the supernatant), add two volumes of frozen anhydrous ethanol (incubated overnight at -20°C), and let stand for 20-30 min.

[0066] 6) If the DNA clumps are large, you can directly pick out the DNA with a pipette tip and pour out the ethanol. If the amount of DNA is small, close the cap, centrifuge at 8000 rpm for 2 minutes, and then open the cap to pour out the ethanol.

[0067] 7) Then add 76% ethanol to wash the precipitate, rotating occasionally, repeating 1-2 times;

[0068] 8) Gently pour out the alcohol, place the DNA at the bottom of the tube, dry it at room temperature, add TE or ddH2O to dissolve it, and place it in a 37°C incubator for 1 hour before shaking well.

[0069] After obtaining DNA from 212 important inbred lines, genotyping was performed using the Maize6H-60K whole-genome SNP chip developed by the Maize Research Center of the Beijing Academy of Agricultural and Forestry Sciences. During genotyping, SNPs with heterozygosity greater than 10%, allele frequencies less than 5%, and deletion rates greater than 20% were removed, ultimately yielding 58,455 SNP markers. For example... Figure 2 As shown, the number of SNP loci on chromosomes 1 to 10 are 9552, 7344, 7264, 6591, 6423, 5068, 4991, 4886, 4873, and 4232, respectively. Figure 2 The horizontal axis represents the physical location in Mb, and the vertical axis represents the linkage group.

[0070] Example 3 Genome-wide association analysis

[0071] The leaf angle phenotype and SNP dataset obtained were analyzed using the "BLINK" model in the GAPIT software package. A genome-wide association analysis was performed to obtain the p-value for each locus of the leaf angle trait. When the p-value was less than 8.55359 × 10⁻⁶, the p-value was considered acceptable. -7 (-log(p)>6.07) is a significant SNP, and the SNP with the smallest P value is the peak SNP.

[0072] Analysis revealed that the peak SNP for the leaf angle trait was: chromosome 3, AX-86305869 (C / T); Figure 4 As shown, the corresponding blade angle phenotype groupings are as follows: when the SNP at position AX-86305869 is CC, the average blade angle of the material is 21.26°; when it is TT, the average blade angle of the material is 37.41°.

[0073] The p-value for this site is 7.47 × 10⁻⁶. -7 The phenotypic explanatory power (PVE) was 36.36%; for example... Figure 3 As shown, this locus is located at 162,842,787 bp on chromosome 3. The LD decay distance for this population is 200 kb(r). 2 =0.15), therefore, the range of this major effect QTL position is located on chromosome 3 from 162642787 bp to 163042787 bp, with a peak at 162842787 bp.

[0074] Example 4: Development and application of KASP markers for major QTL sites at leaf angles

[0075] A KASP marker, named K2787, was developed for the SNP site AX-86305869. Its nucleotide sequence is shown in SEQ ID NO.1. The underscore indicates the SNP site, and Y represents C or T.

[0076] SEQ ID NO.1:

[0077] CACCCGAGAGGCGGCGGCGGCAGACACAGA Y ACCGTCTCTCCTCCCTTTGTCGTCGTGTCTCTCTGCATGGAAGCCTCCGCCGGCTCGTCGCCACCGCACTCCCAAGAGAACCCGCCG;

[0078] The primer information for this KASP tag is as follows:

[0079] Primer F1: CGGCGGCAGACACAGAC, SEQ ID NO.2;

[0080] Primer F2: CGGCGGCAGACACAGAT, SEQ ID NO.3;

[0081] Primer R1: CGGCGGGTTCTCTTGGGAGTGCGGT, SEQ ID NO.4.

[0082] Primer F1 connects to the fluorescent signal connector FAM, and primer F2 connects to the fluorescent signal connector ViC.

[0083] The SNP sites in the DNA of 52 maize hybrids / hybrid combinations and 20 inbred lines were detected using the K2787 marker, with a blank control (no DNA added). The results are as follows: Figure 5 As shown in Table 2, Figure 5 In the diagram, the X-axis represents FAM fluorescence intensity, and the Y-axis represents ViC fluorescence intensity; the black area at the origin of the coordinate axes represents the blank control; the values ​​on the coordinate axes represent fluorescence signal values. It can be seen that this marker has a good genotyping effect on SNP sites, effectively distinguishing materials with different genotypes and exhibiting high amplification efficiency. Among these materials, 64 were of the CC genotype at the SNP site (…). Figure 5 The red dots are close to the X-axis, and the three samples are SNP loci CT genotypes ( Figure 5 (Green dots), 5 samples were SNP loci TT genotypes ( Figure 5 The blue dot is close to the Y-axis.

[0084] Table 2 Genotypes of the K2787 marker in 52 maize hybrids / hybrids and 20 inbred lines.

[0085] Material number Genotype Material number Genotype Material number Genotype Material number genotype Anke 985 CC MY73 CC AKY500 CC SK2200518 CC Yufeng 303 CC Hongyu No. 8 CC AKY503 CC SK2200522 CC Denghai 605 CC Xiwang128 CC AKY187 CC SK2200523 CC Yuzhongyu 181 CC G500 CC Zhengdan 958 CC SK2200566 TT Anfeng 192 CC Kunrui 522 CC AK096 CT SK2200572 TT Jiyu 757 CC Zheng Pinyu A6 CC 25AKSF024-655*675 CC SK2200575 CC DH997 CC Farmer 100 CC 25AKSF019-483*493 CC SK2200576 TT Zhongnongke 919S CC Fengde Jade No. 10 CC 25AKSF020-525*545 CC SK2200582 TT Xi Dan 33 CC Zhengdan 6122 CC 25AKSF018-461*897 CC SK2200393 CC MC812 CC Luoyu 19 CC 25AKSF017-451*461 CC SK2200466 CC Yueliang660 CC YuDan828 CC 25AKSF032-847*897 CC SK2200473 CC Dongdan 1331 CC DH999-2 CC 25AKSF033-857*897 CC SK2200480 CC Modern 464 CC AK225 CC 25AKSF034-867*897 CC SK2200486 CC Joint Research 35 CC AK229 CC 25AKSF036-887*897 CC SK2200487 CC Yuyu 315 CC AK803 CT Fuxing 168 CC SK2200490 CC Jundan 168 CC AK2306 CT Liangyu99 CC SK2200491 CC Zhengdan 819 CC AK805 CC SK2200414 CC SK2200531 CC Lilong 819 CC Huiyu No. 1 CC SK2200493 TT SK2200564 CC

[0086] The SNP genotypes of the 72 maize materials identified by the K2787 marker were matched one-to-one with the leaf angle phenotypes, and a significance test was performed. The results are shown in Table 3. It was found that the leaf angle of the materials containing the CC genotype was significantly reduced by 27.49° compared to the materials containing the TT genotype. This indicates that the CC genotype at the SNP locus has the effect of reducing the leaf angle.

[0087] Table 3. Significance of the association between K2787 marker and phenotype

[0088] Properties CC CT TT P Observations 64 3 5 Leaf angle 18.95 22.00 46.44 7.32E-7

[0089] Therefore, this invention, through phenotypic analysis and whole-genome microarray sequencing of the maize leaf angle trait, followed by genome-wide association analysis, detected a major QTL locus for the maize leaf angle trait on chromosome 3, contributing 36.36% to the overall leaf angle. This major QTL locus is located between bases 162642787 and 163042787 on chromosome 3, with a peak SNP of AX-86305869 (C / T). Based on this SNP molecular marker closely linked to the major QTL locus, the size of the maize leaf angle can be predicted, effectively selected for optimal leaf angle, and used for marker-assisted breeding of maize materials with small leaf angles, accelerating the breeding process of varieties with small leaf angles and high density tolerance. Marker-assisted selection using the SNP molecular markers disclosed in this invention is simple, highly efficient, and can predict the size of the maize leaf angle. The selection target is clear and unaffected by environmental factors. Individual plants with small leaf angles can be identified in the early stages of corn growth, and other individual plants can be eliminated.

[0090] In summary, the major QTL locus on chromosome 3 of this invention contributes significantly to the maize leaf angle trait and plays a crucial role in regulating the maize leaf angle. It can be used for map-based cloning and marker-assisted selection, and is suitable for large-scale application.

[0091] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A KASP molecular marker associated with the maize leaf angle trait, characterized in that, The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.

1. In the sequence shown in SEQ ID NO.1, position Y at position 31 indicates polymorphism, which is C or T. The genotypes at position 31 of the sequence shown in SEQ ID NO.1 include CC, CT, and TT.

2. A primer set for amplifying the KASP molecular marker of claim 1, characterized in that, The primer set includes nucleotide sequences such as F1 as shown in SEQ ID NO.2, F2 as shown in SEQ ID NO.3, and R1 as shown in SEQ ID NO.4; F1 and F2 are connected by fluorescent signal connectors of different colors.

3. The primer set as described in claim 2, characterized in that, The fluorescent signal connector connected to F1 is FAM, and the fluorescent signal connector connected to F2 is ViC.

4. The application of the KASP molecular marker as described in claim 1 or the primer set as described in claim 2 or 3 in the preparation of a product for detecting the leaf angle trait of maize.

5. The application as described in claim 4, characterized in that, The product in question is a reagent kit.

6. A kit for identifying leaf angle characteristics, characterized in that, Includes the primer set as described in claim 2 or 3.

7. The application of the KASP molecular marker as described in claim 1, the primer set as described in claim 2 or 3, or the kit as described in claim 6 in identifying the leaf angle trait of maize.

8. A method for identifying the leaf angle trait of maize, characterized in that, Includes the following steps: Genomic DNA was extracted from the maize sample to be tested; The genomic DNA was amplified by PCR using the primer set described in claim 2 or 3, and the fluorescence signal of the PCR amplification result was read. Based on the fluorescence signal, the leaf angle trait of the maize under test can be identified. If the fluorescence signal matches the color of the fluorescent connector of F1, then the corn to be tested is identified as a small-leaf angled corn. If the fluorescence signal matches the color of the fluorescent connector of F2, then the corn to be tested is identified as a large-leaf angled corn.

9. The application of the KASP molecular marker as described in claim 1, the primer set as described in claim 2 or 3, or the kit as described in claim 6 in breeding maize leaf angle trait.

10. A method for breeding small-leaf angled maize, characterized in that, Includes the following steps: Genomic DNA was extracted from the maize sample to be tested; The genomic DNA was amplified by PCR using the primer set described in claim 2 or 3, and the fluorescence signal of the PCR amplification result was read. If the fluorescence signal matches the color of the fluorescent connector of F1, then the maize sample to be tested is retained for breeding.