SNP molecular marker method related to wheat NDVI phenotype value and application

By providing SNP molecular markers related to wheat NDVI phenotypic values ​​and their detection methods, the problem of low selection efficiency of wheat NDVI phenotypic values ​​in existing technologies has been solved. This enables rapid and accurate identification of wheat NDVI phenotypic potential at the seedling stage, significantly improving breeding efficiency and accuracy.

CN121852596APending Publication Date: 2026-04-14ANYANG INST OF TECH
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-28
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies lack SNP molecular markers that are stable and significantly correlated with wheat NDVI phenotypic values, resulting in long phenotypic selection cycles, low efficiency, and susceptibility to environmental interference, making it difficult to achieve early and precise breeding of wheat varieties with high light efficiency and high yield.

Method used

This invention provides SNP molecular markers related to wheat NDVI phenotypic values ​​and their detection methods. By detecting the 51st base of SEQ ID NO:1 or SEQ ID NO:2 nucleotide sequence and combining it with KASP typing technology, the NDVI phenotypic potential of individual wheat plants can be rapidly and accurately identified, and materials with high NDVI potential can be screened in early generation breeding populations.

Benefits of technology

It enables rapid and accurate prediction of NDVI phenotypic values ​​of individual wheat plants during the seedling stage, significantly shortens the breeding cycle, improves screening accuracy and efficiency, reduces the scale of field trials and the consumption of manpower and resources, and provides a stable molecular breeding tool.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852596A_ABST
    Figure CN121852596A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP molecular marker method related to a wheat NDVI phenotypic value and application, and relates to the technical field of molecular biology and crop breeding, the SNP molecular marker has a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, the 51st basic group is a site A or G, the A allele indicates high NDVI phenotypic value potential, the G allele indicates low NDVI phenotypic value potential, and the SNP molecular marker has a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2. The invention also provides a primer pair and a detection method for detecting the SNP molecular marker, a method for wheat molecular marker-assisted breeding by using the SNP molecular marker, and application of the SNP molecular marker in preparation of related screening kits. Through multi-environment verification, the molecular marker provided by the invention is stably associated with the NDVI character of wheat, can realize rapid and accurate prediction in the seedling stage, and provides a stable and reliable molecular tool for early breeding of high-photosynthetic-efficiency and high-yield varieties of wheat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and crop breeding technology, specifically to SNP molecular marker methods and applications related to wheat NDVI phenotypic values. Background Technology

[0002] Improving wheat yield is a perpetual theme in ensuring food security. The Normalized Difference Vegetation Index (NDVI), as an important agronomic phenotypic indicator, can rapidly and non-destructively reflect the greenness, biomass, and photosynthetic activity of crop canopies, and is closely related to the final yield potential of wheat. Therefore, identifying genetic markers stably associated with the NDVI trait is of great significance for the early and precise breeding of high-light-efficiency and high-yielding wheat varieties.

[0003] In existing technologies, genome-wide association analysis (GWAS) has become the mainstream method for identifying genetic loci for complex traits in crops. For example, some related studies used 166 wheat varieties as materials and combined high-density SNP physical maps to conduct association analysis on the NDVI trait at the seedling stage and 10 days after flowering. This study successfully detected multiple loci significantly associated with NDVI and pointed out that these loci can be used for detection in breeding materials after developing markers. In addition, there are also many existing patents on SNP molecular markers involving other agronomic traits (such as chlorophyll content and quality traits) (such as the major effective locus and SNP marker for wet gluten content in wheat flour, publication number CN118326073B). These patents usually disclose specific marker sequences and claim their application in molecular breeding. These existing technologies collectively demonstrate that discovering SNP markers based on GWAS and using them for assisted breeding is a well-known technical approach in this field.

[0004] However, the aforementioned existing technologies still share a key common problem: they either remain at the scientific research stage, only disclosing genomic regions or loci associated with traits without providing fully validated, directly detectable specific SNP marker sequences; or, while providing marker sequences, these markers are for other traits (such as chlorophyll content) rather than specifically for the wheat NDVI phenotype. Therefore, the field still lacks a set of specific SNP molecular markers that have been validated across multiple environments and large-scale populations, and are stably and significantly correlated with wheat NDVI phenotypic values, as well as early, precise prediction and breeding schemes based on these markers that can overcome the drawbacks of long phenotypic selection cycles and low efficiency in traditional methods.

[0005] In summary, existing technologies have not yet solved the problem of how to transform genetic research on wheat NDVI phenotypes into a stable, efficient, and highly operable molecular breeding tool. Therefore, this invention aims to provide a novel set of SNP molecular markers and their application schemes to fill the aforementioned technological gap. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of existing technologies by providing a method and application of SNP molecular markers related to wheat NDVI phenotypic values. By providing specific SNP molecular markers that have been validated in multiple environments and are stably associated with wheat NDVI phenotypic values, along with their detection methods, the NDVI phenotypic potential of individual wheat plants can be rapidly and accurately identified during the seedling stage. This overcomes the shortcomings of traditional phenotypic selection, such as long cycles, low efficiency, and susceptibility to environmental interference, and provides a reliable technical means for the early targeted breeding of high-photometric and high-yielding wheat varieties.

[0007] To solve the above-mentioned technical problems, the present invention provides the following technical solution: On the one hand, a SNP molecular marker related to wheat NDVI phenotypic values, wherein the SNP molecular marker is any one or two of the following:

[0008] (1) The nucleotide sequence is the molecular marker shown in SEQ ID NO:1, wherein the 51st base is A or G;

[0009] (2) The nucleotide sequence is the molecular marker shown in SEQ ID NO:2, wherein the 51st base is A or G.

[0010] Furthermore, when the 51st base of the molecular marker shown in SEQ ID NO:1 is A, it indicates a high potential for wheat NDVI phenotypic value;

[0011] When the molecular marker shown in SEQ ID NO:1 has a base of G at position 51, it indicates a low potential for wheat NDVI phenotypic value.

[0012] Furthermore, when the 51st base of the molecular marker shown in SEQ ID NO:2 is A, it indicates a high potential for wheat NDVI phenotypic value;

[0013] When the molecular marker shown in SEQ ID NO:2 has a base of G at position 51, it indicates a low potential for wheat NDVI phenotypic value.

[0014] On the other hand, a primer pair for detecting SNP molecular markers associated with wheat NDVI phenotypic values ​​is applicable to SNP molecular markers associated with wheat NDVI phenotypic values. This primer pair can specifically amplify DNA fragments containing the 51st SNP site in SEQ ID NO:1 or SEQ ID NO:2.

[0015] Furthermore, the primer pair is designed based on the sequence of SEQ ID NO:1 and is used to amplify the DNA region including the 51st base in SEQ ID NO:1.

[0016] Furthermore, the primer pair is designed based on the sequence of SEQ ID NO:2 and is used to amplify the DNA region including the 51st base in SEQ ID NO:2.

[0017] On the other hand, a method for identifying SNP molecular markers related to wheat NDVI phenotypic values, applicable to SNP molecular markers related to wheat NDVI phenotypic values, includes the following steps:

[0018] Step 1: Extract genomic DNA from the wheat plants to be tested;

[0019] Step 2: Detect the allelic genotype of at least one SNP molecular marker at the 51st base in the genomic DNA;

[0020] Step 3: Based on the alleles detected in Step 2, determine the NDVI phenotypic potential of the wheat plant to be tested: when the 51st base of the molecular marker shown in SEQ ID NO: 1 and / or the 51st base of the molecular marker shown in SEQ ID NO: 2 is A, the wheat plant to be tested is determined to have a high NDVI phenotypic potential; when the 51st base of the molecular marker shown in SEQ ID NO: 1 and / or the 51st base of the molecular marker shown in SEQ ID NO: 2 is G, the wheat plant to be tested is determined to have a low NDVI phenotypic potential.

[0021] In step two, the allelic genotype of the SNP molecular marker is detected by sequencing, KASP genotyping based on allele-specific PCR, or TaqMan probe method.

[0022] On the other hand, a method for marker-assisted breeding of wheat using SNP molecular markers, applicable to SNP molecular markers related to wheat NDVI phenotypic values, includes the following steps:

[0023] S1, extract genomic DNA from individual plants in the early generation of the breeding population;

[0024] S2, using the SNP molecular marker method, detect and screen individual plants that carry allele A at the 51st base of at least one SNP molecular marker;

[0025] S3. The individual plants selected in step S2 are used as materials with high NDVI phenotypic potential for subsequent breeding operations.

[0026] In S2, the two SNP molecular markers shown in SEQ ID NO:1 and SEQ ID NO:2 are detected simultaneously, and single plants that carry allele A at the 51st base of both markers are preferentially screened.

[0027] Furthermore, the application of SNP molecular marker methods related to wheat NDVI phenotypic values ​​in the preparation of kits for screening wheat germplasm with high NDVI phenotypic values.

[0028] Compared with existing technologies, this SNP molecular marker method and its application related to wheat NDVI phenotypic values ​​have the following advantages:

[0029] I. This invention provides specific SNP molecular markers and their detection primer pairs that have been validated in multiple environments and large-scale populations and are stably and significantly correlated with wheat NDVI phenotypic values. This transforms the traditional NDVI potential evaluation based on field phenotypic observation into a precise and operable genome-level detection method. This method can rapidly and accurately predict the NDVI phenotypic potential of individual wheat plants by detecting the allelic genotype of the 51st base of SEQ ID NO:1 and / or SEQ ID NO:2 at the seedling stage. This effectively overcomes the technical bottlenecks of traditional phenotypic selection, which relies on multi-year, multi-location field trials, has a long cycle, is greatly affected by environmental interference, and is inefficient. It provides a stable and reliable molecular tool for the early breeding of high photosynthetic efficiency and high-yield wheat varieties.

[0030] II. This invention establishes an early and efficient screening method based on DNA detection by integrating identified SNP molecular markers into the molecular marker-assisted breeding process. It can quickly screen out individual plants carrying favorable alleles in early breeding populations using efficient typing techniques such as KASP, significantly improving the accuracy and efficiency of screening high NDVI potential materials. This greatly shortens the breeding cycle, reduces the scale of field trials and the consumption of manpower and resources, and achieves targeted and rapid aggregation of target traits.

[0031] Other advantages, objectives and features of the invention will be set forth in part in the description which follows, and in part will be apparent to those skilled in the art from the following examination or study, or may be learned from the practice of the invention. Attached Figure Description

[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.

[0033] Figure 1 This is an allelic variation analysis diagram of Kukri_c3407_1165 of the present invention;

[0034] Figure 2This is an allelic variation analysis diagram of wsnp_Ex_c8615_14454633 of the present invention;

[0035] Figure 3 This is a flowchart illustrating the steps of the SNP molecular marker method of the present invention. Detailed Implementation

[0036] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0037] Example 1

[0038] like Figures 1 to 3 As shown, the purpose of this embodiment is to verify the association between the SNP molecular marker shown in SEQ ID NO:1 and the wheat NDVI phenotypic value, and to clarify the application effect of this marker in screening potential single wheat plants with high NDVI phenotypic value. Specifically, wheat genomic DNA was extracted, and the allelic genotype of the 51st base of SEQ ID NO:1 was detected using KASP typing technology. Combined with the field NDVI phenotypic value measurement results, the correspondence between different genotypes and NDVI phenotypic values ​​was analyzed, providing an operable technical solution for marker-assisted breeding of wheat.

[0039] 1. Experimental materials: 300 core wheat germplasm resources preserved in the mid-term bank of the Institute of Crop Science, Chinese Academy of Agricultural Sciences were selected, including 65 foreign varieties (lines) and 235 domestic varieties (lines), covering four major winter wheat regions: the northern winter wheat region, the Huang-Huai winter wheat region, the middle and lower reaches of the Yangtze River winter wheat region, and the southwestern winter wheat region. This population has good genetic diversity and regional representativeness, which can fully verify the universality of the markers.

[0040] 2. Experimental Design: The experiment was conducted simultaneously in Manas County (MNS) and Zepu County (ZP) of Xinjiang in 2021, employing a split-plot design with two water treatments: normal irrigation (N) and drought stress (D). The drought stress treatment involved withholding water during the wheat heading, flowering, grain-filling, and maturity stages to simulate water deficit during critical growth periods. A total of 900 plots were constructed, with three replicates for each variety, arranged in a randomized block design. Each plot consisted of one row, 1.5 m long, with a row spacing of 30 cm. Field management followed local conventional wheat planting standards.

[0041] 3. Wheat genomic DNA extraction: 0.1g of fresh leaves from each wheat seedling plot were selected during the seedling stage, and genomic DNA was extracted using the Tiangen Plant Genomic DNA Extraction Kit (DP305). The specific steps are as follows:

[0042] (1) Place the fresh leaves in a pre-cooled mortar, add liquid nitrogen and grind quickly into powder, then immediately transfer to a 2mL centrifuge tube;

[0043] (2) Add 600 μL of CTAB extract preheated to 65°C to the centrifuge tube, gently invert and mix, and then place it in a 65°C constant temperature water bath for 30 minutes, inverting the centrifuge tube once every 10 minutes during this period.

[0044] (3) After the water bath, add an equal volume of chloroform-isoamyl alcohol mixture (volume ratio 24:1) to the centrifuge tube, gently invert 10-15 times until the solution becomes milky, and let it stand at room temperature for 10 minutes.

[0045] (4) Place the centrifuge tube in a high-speed refrigerated centrifuge and centrifuge at 12,000 rpm for 10 minutes. Carefully aspirate the supernatant into a new 2 mL centrifuge tube.

[0046] (5) Add 0.8 times the volume of isopropanol to the clear liquid, gently invert and mix, and let stand at room temperature for 20 minutes to allow the DNA to precipitate fully;

[0047] (6) Centrifuge at 12000 rpm for 10 minutes, discard the supernatant, add 500 μL of 75% ethanol solution to the precipitate, gently wash the precipitate twice, and centrifuge at 10000 rpm for 5 minutes after each wash.

[0048] (7) Discard the ethanol solution, invert the centrifuge tube onto clean filter paper, air dry the DNA precipitate at room temperature, add 50 μL of LTE buffer to dissolve the DNA, and store it in a -20°C refrigerator for later use.

[0049] After extraction, the purity and concentration of DNA were detected using a Nanodrop2000 micro-volume spectrophotometer. The OD260 / OD280 ratio was required to be between 1.8 and 2.0, and the DNA concentration was adjusted to 50 ng / μL to ensure that it met the requirements for subsequent SNP detection.

[0050] 4. SNP molecular marker detection: In this embodiment, KASP genotyping technology based on allele-specific PCR was used to detect the allele genotype of the SNP molecular marker shown in SEQ ID NO:1. The specific operation is as follows:

[0051] In this implementation, the primer design is carried out as follows:

[0052] Based on the nucleotide sequence of SEQ ID NO:1

[0053] (AGAACGGAGATCCCAGAAGTGGAGTGACGAATCAGTTATTGTAGCAACTG[A / G]GTTGTGATTGTGTGGATCCCAAGCTCCACCACGTAAATTGGGAAGCATGT) Design specific primers, where upstream primer 1 targets the allele with base A at position 51, upstream primer 2 targets the allele with base G at position 51, and the downstream primer is a common primer. The primer sequences are as follows:

[0054] Upstream primer 1 (A allele specific):

[0055] AGAACGGAGATCCCAGAAGTGGAGTGACGAATCAGTTATTGTAGCAACTGA;

[0056] Upstream primer 2 (G allele specific):

[0057] AGAACGGAGATCCCAGAAGTGGAGTGACGAATCAGTTATTGTAGCAACTGG;

[0058] Downstream primer (common):

[0059] CATGTCCCTTTAACGTGGTGGAGCTTGGGATCCACACAATCACAAC;

[0060] The primers were synthesized by a bioengineering company with HPLC-grade purity. After synthesis, they were dissolved in TE buffer, the concentration was adjusted to 10 μM, and stored at -20℃ for later use.

[0061] KASP reaction system configuration: The total volume of the KASP reaction system is 10 μL, and the amounts of each component are as follows: 2×KASPMasterMix 5 μL, primer mixture (upstream primer 1, upstream primer 2, downstream primer volume ratio of 1:1:2) 0.14 μL, DNA template (50 ng / μL) 2 μL, and enzyme-free pure water 2.86 μL.

[0062] KASP reaction program settings: Place the prepared reaction system in a real-time PCR instrument (Bio-Rad CFX96) for amplification. The reaction program is as follows:

[0063] (1) Pre-denaturation: 94℃, 15 minutes;

[0064] (2) Touchdown stage: denaturation at 94℃ for 20 seconds, annealing and extension at 61℃ for 60 seconds, for a total of 10 cycles, with the annealing temperature decreasing by 0.6℃ in each cycle;

[0065] (3) Amplification stage: denaturation at 94℃ for 20 seconds, annealing and extension at 55℃ for 60 seconds, for a total of 26 cycles;

[0066] (4) Keep warm: 40℃ for 1 minute.

[0067] Genotype interpretation: After the reaction, the fluorescence signal was analyzed by the software of the real-time PCR instrument, and the genotype of each sample was determined according to the fluorescence type: when only the fluorescence signal corresponding to upstream primer 1 was detected, the genotype was AA; when only the fluorescence signal corresponding to upstream primer 2 was detected, the genotype was GG; when both fluorescence signals were detected at the same time, it was considered a heterozygous genotype (in this embodiment, heterozygous genotypes were treated as missing and not included in subsequent analysis).

[0068] 5. Wheat NDVI Phenotypic Value Determination: NDVI values ​​were measured in each plot using a GreenSeeker instrument manufactured by a certain company during the three key growth stages of wheat: heading, flowering, and grain-filling. During measurement, the instrument was placed 50 cm above the wheat canopy and advanced at a uniform speed from front to back in the middle of the plot. Each plot was measured three times, and the average value was taken as the NDVI phenotypic value for that plot. The statistical results of NDVI phenotypic values ​​under different environmental growth stage treatments are shown in Table 1 below:

[0069] Table 1. Phenotypic analysis of wheat NDVI values:

[0070]

[0071] Note: 2021-MNS-HN represents normal irrigation during the heading stage of Manas in 2021; 2021-MNS-HD represents drought stress during the heading stage of Manas in 2021; 2021-MNS-FN represents normal irrigation during the flowering stage of Manas in 2021; 2021-MNS-FD represents drought stress during the flowering stage of Manas in 2021; 2021-MNS-GN represents normal irrigation during the grain-filling stage of Manas in 2021; 2021-MNS-GD represents drought stress during the grain-filling stage of Manas in 2021; 2022-MNS-HN represents normal irrigation during the heading stage of Manas in 2022; 2022-MNS-HD represents drought stress during the heading stage of Manas in 2022; 2022-MNS-FN represents normal irrigation during the flowering stage of Manas in 2022; 2022-MNS-FD represents normal irrigation during the heading stage of Manas in 2022. Drought stress during the flowering period in Manas; 2022-MNS-GN represents normal irrigation during the grain-filling period in Manas in 2022; 2022-MNS-GD represents drought stress during the grain-filling period in Manas in 2022; 2021-ZP-HN represents normal irrigation during the heading period in Zepu in 2021; 2021-ZP-HD represents drought stress during the heading period in Zepu in 2021; 2021-ZP-FN represents drought stress during the heading period in Zepu in 2021. Normal irrigation during flowering period; 2021-ZP-FD represents drought stress during flowering period in Zepu in 2021; 2021-ZP-GN represents normal irrigation during grain filling period in Zepu in 2021; 2021-ZP-GD represents drought stress during grain filling period in Zepu in 2021; 2022-ZP-FN represents normal irrigation during flowering period in Zepu in 2022; 2022-ZP-FD represents drought stress during flowering period in Zepu in 2022.

[0072] 6. Genome-wide association analysis: To verify the significant association between the SNP molecular marker shown in SEQ ID NO:1 and the wheat NDVI phenotypic value, a 90K wheat microarray developed by a certain company was used to perform SNP genotyping on the DNA of 300 core wheat germplasm resources. After quality control filtering, 16,649 high-quality SNPs were obtained. Genome-wide association analysis was performed using TASSEL 5.0 software based on the MLM (Q+K) model. A p-value ≤ 0.001 was considered a significant association between the marker and the trait. Loci detected under multiple environments were considered stably heritable loci. The association analysis results are shown in Table 2 below:

[0073] Table 2. Information on significantly associated loci in wheat NDVI phenotypic values:

[0074]

[0075] Note: Environments (Env) are already noted in Table 1.

[0076] 7. Results and Analysis:

[0077] SNP molecular marker genotyping results: After KASP genotyping of 300 wheat core germplasm resources, 297 valid genotypes were successfully obtained, including 281 samples with genotype AA and 16 samples with genotype GG. The genotyping success rate was 99%, indicating that the primer pair has good specificity and can efficiently and accurately detect the allelic genotype of the SNP molecular marker shown in SEQ ID NO:1.

[0078] Association analysis between different genotypes and NDVI phenotypic values: Statistical analysis was performed on the NDVI phenotypic values ​​of samples with different genotypes. The results are shown in Table 3 below:

[0079] Table 3. Wheat NDVI phenotypic values ​​corresponding to the polymorphism at the Kukri_c3407_1165 (SEQ ID NO:1) site:

[0080]

[0081] Table 1 shows that wheat NDVI values ​​varied significantly under different environmental growth stage treatments, with coefficients of variation ranging from 4.89% to 24.16%, indicating rich genetic diversity in the NDVI phenotype of the tested population, making it suitable for association analysis between SNP markers and traits. Table 2 shows that the marker shown in SEQ ID NO:1 was significantly associated with wheat NDVI phenotype values ​​in multiple environments, with P values ​​ranging from 0.0000076517 to 0.00033365, and a contribution rate of 4.46% to 7.05%, demonstrating the stability and reliability of the association between this marker and the NDVI trait. Table 3 shows that the mean NDVI value of wheat samples with genotype AA was 0.74±0.07, significantly higher than that of samples with genotype GG (mean NDVI value 0.66±0.07). The mean NDVI value of the GG genotype was 12.12% lower than that of the AA genotype. The t-test analysis showed that the difference in NDVI phenotypic values ​​between the two genotypes was highly significant (P<0.01), indicating that when the 51st base of the SNP molecular marker shown in SEQ ID NO:1 is A, it does indeed indicate that wheat has the potential for a high NDVI phenotypic value; when it is G, it indicates that wheat has the potential for a low NDVI phenotypic value.

[0082] This embodiment, through detailed experimental design and operational procedures, combined with phenotypic variance analysis, genome-wide association analysis, and genotype-phenotype correspondence analysis, fully verified the stable association between the SNP molecular marker shown in SEQ ID NO:1 and the wheat NDVI phenotypic value. The detection method for this marker is simple to operate, highly specific, and has high genotyping accuracy. It can quickly determine the NDVI phenotypic potential of wheat seedlings, providing a reliable technical means for early screening of wheat germplasm with high NDVI phenotypic values, effectively shortening the breeding cycle and improving breeding efficiency.

[0083] Example 2

[0084] like Figures 1 to 3 As shown, this embodiment aims to verify the application effect of the SNP molecular marker combination shown in SEQ ID NO:1 and SEQ ID NO:2 in marker-assisted breeding of wheat. By simultaneously detecting the allelic genotypes of the two markers, single plants with double AA genotypes are screened. Combined with field NDVI phenotypic value verification, the accuracy and superiority of the combined marker screening are clarified, providing a more efficient technical solution for the breeding of new wheat varieties with high light efficiency and high yield.

[0085] 1. Experimental materials: The early generation (F2 generation) of wheat breeding population was selected. This population was obtained by crossing the high-yielding variety Jimai 22 with the stress-resistant variety Xindong 20. It contained 500 individual plants and was planted in the experimental field in Manas County, Xinjiang. Field management was carried out in accordance with the standard of conventional breeding experiments.

[0086] 2. Experimental design: The experimental field adopted a randomized block design, with each single plant planted in one plot. The plot size was 1 row × 1.5m with a row spacing of 30cm. Three replicates were set up. Two water treatments were set up at the same time: normal irrigation and drought stress. The drought stress treatment method was the same as in Example 1.

[0087] 3. Wheat genomic DNA extraction: During the wheat seedling stage, 0.1g of fresh leaves were selected from each individual plant, and genomic DNA was extracted using the same DNA extraction method as in Example 1 (Tiangen DP305 kit). The purity and concentration of the DNA were tested to ensure that the OD260 / OD280 ratio was between 1.8 and 2.0. The concentration was adjusted to 50ng / μL and stored at -20℃ for later use.

[0088] 4. Detection of combined SNP molecular markers:

[0089] In this embodiment, the primer design is implemented as follows:

[0090] In addition to the primers corresponding to SEQ ID NO:1 in Example 1, specific primers were designed based on the nucleotide sequence of SEQ ID NO:2 (TGCATCTGCTTGACACCAGAATTGGTACCCCTTGCACACTCTCTTTGCCA[A / G]GATCCAGCCTCTCCTGGTAATGCTAAGCCTACATAGGCTGATGCGGCATA). Upstream primer 1 targets the allele with base A at position 51, upstream primer 2 targets the allele with base G at position 51, and the downstream primers are common primers. The sequences are as follows:

[0091] Upstream primer 1 (A allele specific):

[0092] TGCATCTGCTTGACACCAGAATTGGTAACCCCTTGCACACTCTCTTTGCCAA;

[0093] Upstream primer 2 (G allele specific):

[0094] TGCATCTGCTTGACACCAGAATTGGTAACCCCTTGCACACTCTCTTTGCCAG;

[0095] Downstream primer (common):

[0096] TATGCCGCATCAGCCTATGTAGGCTTAGCATTACCAGGAGAGGCTGGATC;

[0097] The primer was also synthesized by a certain Sangon Biotech company, with HPLC-grade purity, and stored at a concentration of 10 μM for future use.

[0098] KASP Reaction System and Procedure: The KASP reaction systems of SEQ ID NO:1 and SEQ ID NO:2 are consistent with those in Example 1, with a total volume of 10 μL and the same amount of each component. The reaction procedure was performed using the same real-time PCR instrument, and the program settings were the same as in Example 1, namely, pre-denaturation at 94℃ for 15 minutes, 10 cycles of touchdown, 26 cycles of amplification, and a final incubation at 40℃ for 1 minute.

[0099] Genotype interpretation: Genotypes were interpreted based on the fluorescence signals corresponding to the two markers. The genotype interpretation criteria for each marker were the same as in Example 1, i.e., the determination methods for AA and GG genotypes were consistent, and heterozygous genotypes were treated as deletions. Finally, the genotype combinations of each plant at the two marker sites were counted, and plants with the double AA genotype (base A at position 51 of both SEQ ID NO:1 and SEQ ID NO:2) were screened out.

[0100] 5. Determination of wheat NDVI phenotypic values: During the heading, flowering, and grain-filling stages of wheat, the NDVI values ​​of each individual plant plot were measured using a GreenSeeker instrument. The measurement method was the same as in Example 1. Each plot was measured three times, and the average value was taken as the NDVI phenotypic value of that individual plant. The statistical results of NDVI phenotypic values ​​under each environmental growth stage treatment are the same as those in Table 1 of Example 1.

[0101] 6. Results and Analysis:

[0102] Combined marker genotyping results: After KASP genotyping of 500 F2 generation plants, 492 valid genotyping results were successfully obtained. Among them, 386 plants were of the double AA genotype, 42 plants were of the SEQ ID NO:1 being AA and SEQ ID NO:2 being GG, 35 plants were of the SEQ ID NO:2 being AA and SEQ ID NO:1 being GG, and 29 plants were of the double GG genotype. The genotyping success rate was 98.4%, indicating that the primer pairs of the two markers have good specificity and the combined detection procedure is stable and feasible.

[0103] Validation of the association between genotype and NDVI phenotypic value of a single marker (SEQ ID NO:2):

[0104] The association analysis results between the marker shown in SEQ ID NO:2 and the wheat NDVI phenotypic value are shown in Table 4 below:

[0105] Table 4 shows the wheat NDVI phenotypic values ​​corresponding to the polymorphism at the wsnp_Ex_c8615_14454633 (SEQ ID NO:2) locus:

[0106]

[0107] As shown in Tables 2 and 4, the marker shown in SEQ ID NO:2 was also significantly associated with wheat NDVI phenotypic values ​​in multiple environments, with P values ​​ranging from 0.0000071205 to 0.00028898 and a contribution rate of 4.60% to 7.08%. The mean NDVI value of the AA genotype samples was 0.74±0.06, which was significantly higher than that of the GG genotype samples (0.66±0.07). The mean NDVI value of the GG type was 12.12% lower than that of the AA type, and the difference reached a highly significant level (P<0.01). This proves that the marker shown in SEQ ID NO:2 can also effectively indicate the potential of wheat NDVI phenotypic values ​​when used alone.

[0108] The association analysis between different genotype combinations and NDVI phenotypic values ​​is shown in the table below:

[0109]

[0110] As shown in the table above, the mean NDVI value of plants with the double AA genotype was the highest, reaching 0.75±0.06, significantly higher than that of plants with other genotype combinations; the mean NDVI value of plants with the double GG genotype was the lowest, at 0.65±0.07; and the mean NDVI value of plants with a single AA marker was between the two. Analysis of variance showed that the differences in NDVI phenotypic values ​​among different genotype combinations were highly significant (P<0.01), indicating that using two SNP molecular markers simultaneously for screening can more accurately identify wheat plants with high NDVI phenotypic potential. Combined with Table 1, the results remained stable under different environmental growth stage treatments, further validating the reliability of the combined markers.

[0111] Verification of breeding screening effect: The 386 single plants with double AA genotypes selected were used as candidate materials for subsequent breeding and cultivation. Their field growth was observed and found that the canopy greenness and biomass of these single plants were better than those of single plants with other genotype combinations, which further verified the effectiveness of the combined marker screening.

[0112] This embodiment, through detection and screening of early-generation wheat breeding populations, combined with phenotypic variation analysis in Table 1, correlation site verification in Table 2, and single marker effectiveness verification in Tables 3 and 4, fully demonstrates the application value of the combined SNP molecular markers SEQ ID NO:1 and SEQ ID NO:2. The screening accuracy of the combined markers is higher than that of the single markers, enabling more precise screening of wheat plants with high NDVI phenotypic potential, providing more reliable technical support for marker-assisted breeding of wheat. This method is simple to operate, high-throughput, and can quickly complete screening in early-generation breeding, effectively reducing subsequent breeding workload and shortening the breeding cycle, which is of positive significance for the breeding of new wheat varieties with high light efficiency and high yield.

[0113] Comparative Example

[0114] This comparative study aims to compare the effectiveness of traditional phenotypic selection methods with the SNP molecular marker method of this invention in screening wheat germplasm with high NDVI phenotypic values. Through years of field planting observations and NDVI phenotypic value determination at multiple locations, the limitations of traditional methods are clarified, highlighting the advantages of the technical solution of this invention.

[0115] 1. Experimental materials: 300 wheat core germplasm resources, the same as in Example 1, to ensure the consistency of materials and the objectivity of the comparison results.

[0116] 2. Experimental Design: The experiment was conducted in Manas County and Zepu County, Xinjiang for three consecutive years in 2020, 2021 and 2022. Two water treatments were set up each year: normal irrigation and drought stress. The experimental design was the same as in Example 1, that is, each variety was replicated three times, the plot size was 1 row × 1.5m, the row spacing was 30cm, and the randomized block design was used.

[0117] 3. Traditional phenotypic selection process:

[0118] Field planting and management: Sowing, fertilization, weeding and other field management are carried out according to the conventional wheat planting standards every year. The drought stress treatment method is the same as in Example 1, that is, no watering is carried out from the heading stage to the maturity stage.

[0119] Long-term determination of NDVI phenotypic values: NDVI values ​​of each plot were measured using a GreenSeeker instrument during the heading, flowering, and grain-filling stages each year. The measurement method was the same as in Example 1. Each plot was measured three times, and the average value was taken as the NDVI phenotypic value of that plot for that year. The statistical results of NDVI phenotypic values ​​under each environmental growth stage treatment are the same as those in Table 1 of Example 1.

[0120] High NDVI germplasm screening: The NDVI phenotypic values ​​of each variety were recorded for three consecutive years, and the average NDVI value over the three years was calculated. The varieties with the highest average NDVI values ​​were identified as high NDVI phenotypic germplasm, and the corresponding individual plants were selected as candidate materials.

[0121] 4. Results and Analysis:

[0122] Results of traditional screening methods: After more than three years of field planting and NDVI testing, 87 varieties with average NDVI values ​​ranking in the top 30% were selected from 300 core wheat germplasm resources, a screening rate of 29%. Genotyping of the 87 selected varieties (using the KASP method in Example 1) revealed that 65 varieties had genotypes of AA (SEQ ID NO:1) or double AA (SEQ ID NO:1+SEQ ID NO:2), with a screening accuracy of 74.7%; the remaining 22 varieties had genotypes of GG or a single GG combination, which were incorrectly selected materials, with a misselection rate of 25.3%.

[0123] Analysis of the limitations of traditional methods: As shown in Table 1, wheat NDVI phenotypic values ​​are significantly affected by environment, growth stage, and water treatment. NDVI values ​​fluctuate significantly across different years and locations, with a coefficient of variation reaching as high as 24.16%. This necessitates traditional phenotypic selection methods requiring continuous planting at multiple locations for three years to preliminarily determine the NDVI potential of varieties, resulting in a screening cycle of up to three years. Furthermore, environmental interference leads to low screening accuracy, with a false selection rate exceeding 25%, and requires substantial field management and measurement work, resulting in high human and material costs, making it difficult to meet the needs of large-scale breeding screening. In contrast, the SNP molecular marker method of this invention, based on genomic DNA detection, is unaffected by environmental factors. Combined with the validation results in Tables 2, 3, and 4, it can rapidly and accurately screen germplasm with high NDVI potential, significantly outperforming traditional methods.

[0124] This comparative example, by comparing the traditional method with the SNP molecular marker method of this invention, combined with the environmental variation analysis in Table 1 and the marker effectiveness verification in Tables 2 to 4, highlights the limitations of traditional phenotypic selection methods. Traditional methods suffer from long screening cycles, low accuracy, and high costs, while the method of this invention can quickly complete screening during the wheat seedling stage, with a screening cycle of only about 3 months and an accuracy rate of over 94% (Example 1) or over 97% (Example 2), significantly superior to traditional methods. The technical solution of this invention effectively solves the problems of low efficiency and long cycle in NDVI phenotypic selection in traditional breeding, providing a more efficient and accurate technical means for screening wheat germplasm with high NDVI phenotypic values.

[0125] Simplified Table Summary and Analysis: To more intuitively compare the technical effects of the embodiments of the present invention with those of the comparative examples, and to integrate the core data from each experimental stage, the following table summarizes the key parameters and core results:

[0126]

[0127] Summary of Results: As shown in the tables above, the SNP molecular marker-based method of this invention has significant advantages in screening wheat germplasm with high NDVI phenotypic values. Compared with the traditional phenotypic selection method with a screening cycle of 3 years, the method of this invention can complete the screening in only 3 months, greatly shortening the breeding cycle. In terms of screening accuracy, the accuracy of Example 1 of this invention reaches 94.0%, and the accuracy of Example 2 is further improved to 97.1%, which is much higher than the 74.7% of the traditional method. Combining the phenotypic variation data in Table 1, the association significance data in Table 2, and the genotype-phenotype correspondence data in Tables 3 and 4, it can be seen that the SNP molecular markers of this invention are stably associated with the NDVI trait, with P values ​​all less than 0.001 and contribution rates between 4.46% and 7.08%, which can reliably indicate the potential of wheat NDVI phenotypic values. At the same time, the high-value group screened by the method of this invention has a higher mean NDVI and a smaller standard deviation, indicating that the NDVI phenotypic values ​​of the screened materials are more stable. In summary, the technical solution of this invention is simple to operate, efficient and precise, and can effectively support the breeding of high light efficiency and high yield wheat, and has important practical application value.

[0128] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A SNP molecular marker associated with wheat NDVI phenotypic values, characterized in that, The SNP molecular marker is any one or two of the following: (1) The nucleotide sequence is the molecular marker shown in SEQ ID NO:1, wherein the 51st base is A or G; (2) The nucleotide sequence is the molecular marker shown in SEQ ID NO:2, wherein the 51st base is A or G.

2. The SNP molecular marker associated with wheat NDVI phenotypic value according to claim 1, characterized in that, When the molecular marker shown in SEQ ID NO:1 has an A base at position 51, it indicates a high potential for wheat NDVI phenotypic value. When the molecular marker shown in SEQ ID NO:1 has a base of G at position 51, it indicates a low potential for wheat NDVI phenotypic value.

3. The SNP molecular marker associated with wheat NDVI phenotypic value according to claim 1, characterized in that, When the molecular marker shown in SEQ ID NO:2 has an A base at position 51, it indicates a high potential for wheat NDVI phenotypic value. When the molecular marker shown in SEQ ID NO:2 has a base of G at position 51, it indicates a low potential for wheat NDVI phenotypic value.

4. A primer pair for detecting SNP molecular markers associated with wheat NDVI phenotypic values, applicable to SNP molecular markers associated with wheat NDVI phenotypic values ​​as described in any one of claims 1 to 3, characterized in that, The primer pair can specifically amplify DNA fragments containing the 51st SNP site in SEQ ID NO:1 or SEQ ID NO:

2.

5. A primer pair for detecting SNP molecular markers associated with wheat NDVI phenotypic values ​​according to claim 4, characterized in that, The primer pair is designed based on the sequence of SEQ ID NO:1 and is used to amplify the DNA region including the 51st base in SEQ ID NO:

1.

6. A primer pair for detecting SNP molecular markers associated with wheat NDVI phenotypic values ​​according to claim 4, characterized in that, The primer pair is designed based on the sequence of SEQ ID NO:2 and is used to amplify the DNA region including the 51st base in SEQ ID NO:

2.

7. A method for identifying SNP molecular markers related to wheat NDVI phenotypic values, applicable to SNP molecular markers related to wheat NDVI phenotypic values ​​as described in any one of claims 1 to 3, characterized in that, The method includes the following steps: Step 1: Extract genomic DNA from the wheat plants to be tested; Step 2: Detect the allelic genotype of at least one SNP molecular marker at the 51st base in the genomic DNA; Step 3: Based on the alleles detected in Step 2, determine the NDVI phenotypic potential of the wheat plant to be tested: when the 51st base of the molecular marker shown in SEQ ID NO: 1 and / or the 51st base of the molecular marker shown in SEQ ID NO: 2 is A, the wheat plant to be tested is determined to have a high NDVI phenotypic potential; when the 51st base of the molecular marker shown in SEQ ID NO: 1 and / or the 51st base of the molecular marker shown in SEQ ID NO: 2 is G, the wheat plant to be tested is determined to have a low NDVI phenotypic potential. In step two, the allelic genotype of the SNP molecular marker is detected by sequencing, KASP genotyping based on allele-specific PCR, or TaqMan probe method.

8. A method for marker-assisted breeding of wheat using SNP molecular markers, applicable to the SNP molecular markers related to the wheat NDVI phenotypic value as described in any one of claims 1 to 3, characterized in that, The method includes the following steps: S1, extract genomic DNA from individual plants in the early generation of the breeding population; S2, using the SNP molecular marker method, detect and screen individual plants that carry allele A at the 51st base of at least one SNP molecular marker; S3. The individual plants selected in step S2 are used as materials with high NDVI phenotypic potential for subsequent breeding operations. In S2, the two SNP molecular markers shown in SEQ ID NO:1 and SEQ ID NO:2 are detected simultaneously, and single plants that carry allele A at the 51st base of both markers are preferentially screened.

9. The application of the SNP molecular marker method related to wheat NDVI phenotypic value as described in claim 7 in the preparation of a kit for screening wheat germplasm with high NDVI phenotypic value.

Citation Information

Patent Citations

  • Major loci and SNP markers for wet gluten content in wheat flour and their application

    CN118326073B