SNP (Single Nucleotide Polymorphism) molecular marker for detecting length of bottle gourd fruit and application of SNP molecular marker

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker for detecting the length character of a bottle gourd fruit and application of the SNP molecular marker. The SNP molecular marker corresponds to an SNP site Chr010-2347101 on a chromosome 10 of a bottle gourd Bottle source 'Hangzhou Gsource' gene v1 genome, the polymorphism of the site is C / T, and the SNP molecular marker is closely linked with the length character of the bottle gourd fruit. When the basic group of the SNP site is C, the bottle gourd is in a long fruit type; when the basic group of the SNP site is T, the bottle gourd is in a short fruit type. Based on the SNP site, the invention further provides a KASP primer group for detecting the SNP molecular marker, and a detection method for carrying out KASP-PCR (Polymerase Chain Reaction) amplification by utilizing the primer group and carrying out genetic typing through a fluorescence signal. In addition, the invention further provides application of the SNP molecular marker in bottle gourd breeding and a kit. The method has the advantages of rapid detection, high accuracy, large flux, no influence of environmental factors and the like, and is beneficial to improving the breeding efficiency of the length character of the bottle gourd fruit.

Description

Technical Field

[0001] This invention relates to the field of biological breeding technology, and more specifically, to an SNP molecular marker for detecting the length of bottle gourd fruits and its application. Background Technology

[0002] Bottle gourd (Lagenaria siceraria (Molina) Standl.) (2n=2x=22) is a plant belonging to the genus Lagenaria in the family Cucurbitaceae, and is one of my country's important specialty cucurbit vegetables. Among cucurbit crops, fruit morphology is one of the most important biological and commercial traits. Bottle gourd fruits exhibit extremely rich natural variation in shape, including flattened round, nearly round, cow-leg-shaped, rod-shaped, short cylindrical, long cylindrical, long-necked spherical, pear-shaped, long-stemmed pear-shaped, and slender-waisted gourd-shaped types, making them important materials for studying the morphological changes and evolution of cucurbit crops. Fruit size, especially fruit length, is one of the important indicators for evaluating the appearance quality of vegetables, directly affecting consumer acceptance and market value. From a crop breeding perspective, fruit size is also closely related to yield per unit area, making it an important agronomic trait that has long been a focus of attention in crop domestication and improvement. With the continuous improvement of consumer demand for the quality of horticultural crops, fruit shape, size, and their related genetic basis have gradually become the focus of genetic breeding research on cucurbit vegetables.

[0003] Currently, numerous studies have been conducted both domestically and internationally on the mapping of genes and genetic regulation mechanisms related to fruit size in various vegetable crops. However, compared to cucurbitaceous crops such as cucumber, watermelon, and melon, research on bottle gourd started relatively late, and systematic research on the genetic basis, key gene mapping, and molecular breeding applications of bottle gourd fruit length traits is still insufficient. Existing research has limited molecular marker resources for bottle gourd fruit length traits, and related detection methods still have shortcomings in terms of accuracy and practicality. This, to some extent, restricts the precise improvement of bottle gourd fruit traits and the progress of molecular breeding. In actual production and breeding processes, the identification of bottle gourd fruit length mainly relies on field phenotypic measurements, that is, after the fruit has developed to a certain stage, the trait type is determined by manually measuring the fruit length. This method not only requires a long growth cycle but is also labor-intensive and easily affected by factors such as cultivation environment, management level, and human measurement errors, making it difficult to guarantee the accuracy and stability of the identification results. Furthermore, phenotypic identification methods can usually only be carried out in the later stages of plant growth, making it difficult to screen for target traits in the early stages of breeding, thus prolonging the breeding cycle and reducing breeding efficiency.

[0004] With the development of molecular biology techniques, molecular marker-assisted selection (MAS) technology has provided a new technical approach for the early and accurate identification of crop traits. Currently, the main types of molecular markers used for crop traits include SSR markers and Indel markers. Indel markers typically require PCR amplification followed by gel electrophoresis for identification, which is relatively cumbersome, has a long detection cycle, and suffers from low throughput due to limitations in electrophoretic resolution. Furthermore, the operation is complex and costly. In large-scale screening of breeding materials, these molecular marker methods are insufficient to meet the practical needs for high-throughput, low-cost, and rapid detection.

[0005] Therefore, existing technologies still have significant shortcomings in the molecular detection and assisted breeding of bottle gourd fruit length traits. These shortcomings mainly manifest as low detection efficiency, complex operational procedures, and difficulty in conducting precise screening at the seedling stage, making it difficult to achieve rapid, stable, and efficient identification of bottle gourd fruit length traits. Against this backdrop, there is an urgent need for a simpler, more accurate molecular detection method suitable for large-scale screening of breeding materials to improve the efficiency and reliability of bottle gourd fruit length trait identification and promote the development of bottle gourd molecular breeding work. Summary of the Invention

[0006] One of the technical problems to be solved by this invention is to provide an SNP molecular marker for detecting the length trait of bottle gourd fruit, so as to solve the problems of existing technologies that mainly rely on field phenotypic measurements, have long detection cycles, are greatly affected by environmental factors, and are difficult to accurately identify the length trait of fruit in the early stage of breeding.

[0007] To overcome the shortcomings of the prior art, this invention provides an SNP molecular marker for detecting the length trait of bottle gourd fruit, wherein the SNP molecular marker corresponds to the bottle gourd. Bottle gourd 'Hangzhou Gourd' genome v1 The SNP site Chr010-2347101 on chromosome 10 of the genome, wherein the polymorphism of the SNP site is closely linked to the length trait of bottle gourd fruit, and its polymorphism is C / T.

[0008] Preferably, the SNP site Chr010-2347101 is located in a segment of a bottle gourd nucleotide sequence, and is numbered starting from the 5′ end of the nucleotide sequence: When the nucleotide sequence is as shown in SEQ ID NO:4, and the base corresponding to the SNP site is C, the bottle gourd exhibits a long fruit type; When the nucleotide sequence is as shown in SEQ ID NO:5, and the base at the corresponding SNP site is T, the bottle gourd exhibits a short fruit type.

[0009] Compared with existing technologies, the SNP molecular marker for detecting the length trait of bottle gourd fruits in this invention has the following advantages: This invention obtains specific SNP loci closely linked to the length trait of bottle gourd fruits through screening, transforming the fruit length phenotypic information, which traditionally requires manual measurement during the fruiting period, into genetic marker information that can be stably detected at the DNA molecular level. Because the SNP loci provided by this invention have clear and stable allelic variation characteristics in both long and short-fruited bottle gourd materials, and are highly consistent with the fruit length phenotypic expression in segregating populations, this molecular marker can accurately predict the length trait of bottle gourd fruits during the seedling stage, avoiding errors caused by environmental conditions, growth stage differences, and human factors in field measurements. This invention effectively solves the problems of low efficiency, insufficient accuracy, and long breeding cycles in the prior art for detecting fruit length traits, providing a stable and reliable genetic marker basis for molecular-assisted breeding of bottle gourd fruit length traits.

[0010] Another technical problem to be solved by the present invention is to provide a KASP primer set for detecting the SNP molecular marker, so as to solve the problems of cumbersome molecular marker detection steps, low detection throughput, high cost and unsuitability for rapid screening of large-scale breeding materials in the prior art.

[0011] To overcome the shortcomings of the prior art, the present invention provides a KASP primer set for detecting the SNP molecular marker, the primer set comprising: The first allele-specific forward primer named HgCD-FAM has the nucleotide sequence shown in SEQ ID NO:1; The second allele-specific forward primer named HgCD-HEX has the nucleotide sequence shown in SEQ ID NO:2; The reverse primer named HgCD-COMMON has the nucleotide sequence shown in SEQ ID NO:3; Among them, SEQ ID NO:1 is: 5′-GAAGGTGACCAAGTTCATGCTAGATCGAACGGTGGCTTGAG-3′; SEQ ID NO:2 is: 5′-GAAGGTCGGAGTCAACGGATTAGATCGAACGGTGGCTTGAA-3′; SEQ ID NO:3 is: 5′-ACAAGCAACAGCAACTCTTCACAG-3′.

[0012] This invention provides a method for detecting the length trait of bottle gourd fruit using the aforementioned primer set, comprising the following steps: (a) Extracting genomic DNA from the bottle gourd sample to be tested; (b) Using the DNA extracted in step (a) as a template, perform KASP-PCR amplification using the primer set described above; (c) Detect the fluorescence signal of the PCR product and perform genotyping; (d) Determine the fruit length trait of the bottle gourd to be tested based on the genotyping results: If the genotype is CC, it is determined to be the long-fruited type; If the genotype is TT, it is determined to be short-fruited. If the genotype is CT, it is determined to be the intermediate fruit length type.

[0013] Preferably, the DNA extraction in step (a) is performed using the TPS method, which includes: grinding young bottle gourd leaves, adding TPS solution, incubating in a 65°C water bath, centrifuging, collecting the supernatant, precipitating the DNA with isopropanol, and dissolving it with an aqueous solution.

[0014] Preferably, the KASP amplification reaction system in step (b) comprises: 2.5 μL of 2× KASPMaster Mix, 2.5 μL of template DNA, and 0.07 μL of KASP primers, wherein the KASP primers are prepared from the primer set, and the remaining volume is made up by ddH2O.

[0015] Preferably, the PCR amplification procedure in step (b) includes: Step 1: Pre-denaturation at 94 ℃ for 15 minutes; Step 2: 10 cycles of landing PCR, each cycle consisting of denaturation at 94 °C for 20 seconds, and annealing / extension at 61 °C starting at 0.6 °C and holding for 60 seconds each cycle. Step 3: 26 cycles of standard PCR, each cycle consisting of denaturation at 94 °C for 20 seconds and annealing / extension at 55 °C for 60 seconds.

[0016] Compared with existing technologies, the KASP primer set and detection method for detecting the SNP molecular markers in this invention have the following advantages: This invention designs allele-specific KASP primers targeting SNP sites closely linked to the length trait of bottle gourd fruits, enabling different alleles to generate differentiated fluorescence signals during PCR amplification, thus achieving direct differentiation of CC, TT, and CT genotypes. The primer set and detection method of this invention transform the traditional low-throughput detection method relying on enzyme digestion or gel electrophoresis analysis into a high-throughput molecular detection method based on fluorescence signal interpretation, significantly simplifying the experimental procedure and shortening the detection time. Furthermore, since the detection method is unaffected by tissue type, developmental stage, and environmental conditions, it can stably and reproducibly identify the genotype of fruit length traits during the seedling stage, solving the problems of low detection efficiency, insufficient accuracy, and difficulty in conducting molecular-assisted selection in the early stages of breeding in the prior art. This provides an efficient and reliable technical means for large-scale molecular breeding of bottle gourd fruit length traits.

[0017] The present invention also provides a kit for detecting the length trait of bottle gourd fruit, the kit comprising the primer set of the KASP molecular marker described above, and at least one of DNA extraction reagent, PCR reaction buffer or fluorescent detection reagent.

[0018] Preferably, the primer set is provided in the kit as a premixed KASP primer mixture and is prepared by dilution with ddH2O.

[0019] This invention provides an application of the aforementioned SNP molecular markers in bottle gourd breeding, used to select bottle gourd fruit length traits through molecular marker-assisted selection during the seedling stage, including using KASP technology to genotype the F2 or F3 segregating populations of bottle gourd and comparing it with phenotypic data to screen for long-fruited or short-fruited individual plants.

[0020] The kit for detecting the length trait of bottle gourd fruit and its application described in this invention have the following advantages compared with existing technologies: This invention integrates the KASP molecular marker primer set for detecting fruit length traits with detection components such as DNA extraction reagents, PCR reaction buffers, or fluorescent detection reagents. This standardizes and modularizes the molecular detection process for fruit length traits, avoiding the problems of complex operation, poor repeatability, and large human error caused by the dispersed preparation of reagents in existing technologies. In particular, providing the primer set as a premixed KASP primer mixture helps ensure the stability and consistency of the proportions of each primer, thereby improving the reliability and repeatability of genotyping results. In breeding applications, this invention, based on the stable and clear correspondence between the aforementioned SNP molecular markers and the length trait of bottle gourd fruits, combined with the high-throughput fluorescence detection advantages of KASP technology, enables breeders to rapidly and accurately perform genotyping screening of F2 or F3 segregating populations at the seedling stage, without waiting for the plants to enter the fruiting stage for field fruit measurement. This effectively solves the problems of long identification cycles, low efficiency, and difficulty in conducting large-scale screening in the early stages of the prior art for fruit length trait identification. Through the integrated design of the above-mentioned reagent kit and the synergistic effect of molecular marker-assisted selection, this invention not only reduces detection costs and labor input but also significantly shortens the breeding cycle, providing a practical and reliable technical means for large-scale, high-efficiency molecular breeding of bottle gourd fruit length traits. Attached Figure Description

[0021] Figure 1 Phenotypic diagrams of fruit length traits in different bottle gourd materials, where: 1GB-X represents a long-fruited bottle gourd inbred line; 1GB-Y represents a short-fruited bottle gourd inbred line; and 1GB-F1 represents a bottle gourd material with medium-length fruit. Figure 2 The figure shows the results of ΔSNP-index analysis of the length trait of bottle gourd fruit, displaying candidate genomic regions associated with the length trait; Figure 3 This is a diagram showing the genotyping results of fruit length-related SNP sites in the F2 segregating population of bottle gourd using the HgCD KASP primer set. Detailed Implementation

[0022] First, those skilled in the art should understand that these embodiments are merely illustrative of the technical principles of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art can make adjustments as needed to adapt to specific application scenarios.

[0023] This invention provides a SNP molecular marker for detecting the length trait of bottle gourd fruit, wherein the SNP molecular marker corresponds to bottle gourd. Bottle gourd 'Hangzhou Gourd' genome v1 The SNP site Chr010-2347101 on chromosome 10 of the genome, wherein the polymorphism of the SNP site is closely linked to the length trait of bottle gourd fruit, and its polymorphism is C / T.

[0024] As a preferred embodiment, the SNP site Chr010-2347101 is located within a segment of a bottle gourd nucleotide sequence, and is numbered starting from the 5′ end of the nucleotide sequence: When the nucleotide sequence is as shown in SEQ ID NO:4, and the base corresponding to the SNP site is C, the bottle gourd exhibits a long fruit type; When the nucleotide sequence is as shown in SEQ ID NO:5, and the base at the corresponding SNP site is T, the bottle gourd exhibits a short fruit type.

[0025] This invention provides a KASP primer set for detecting the SNP molecular marker, the primer set comprising: The first allele-specific forward primer named HgCD-FAM has the nucleotide sequence shown in SEQ ID NO:1; The second allele-specific forward primer named HgCD-HEX has the nucleotide sequence shown in SEQ ID NO:2; The reverse primer named HgCD-COMMON has the nucleotide sequence shown in SEQ ID NO:3; Among them, SEQ ID NO:1 is: 5′-GAAGGTGACCAAGTTCATGCTAGATCGAACGGTGGCTTGAG-3′; SEQ ID NO:2 is: 5′-GAAGGTCGGAGTCAACGGATTAGATCGAACGGTGGCTTGAA-3′; SEQ ID NO:3 is: 5′-ACAAGCAACAGCAACTCTTCACAG-3′.

[0026] This invention provides a method for detecting the length trait of bottle gourd fruit using the aforementioned primer set, comprising the following steps: (a) Extracting genomic DNA from the bottle gourd sample to be tested; (b) Using the DNA extracted in step (a) as a template, perform KASP-PCR amplification using the primer set described above; (c) Detect the fluorescence signal of the PCR product and perform genotyping; (d) Determine the fruit length trait of the bottle gourd to be tested based on the genotyping results: If the genotype is CC, it is determined to be the long-fruited type; If the genotype is TT, it is determined to be short-fruited. If the genotype is CT, it is determined to be the intermediate fruit length type.

[0027] As a preferred embodiment, the DNA extraction in step (a) is performed using the TPS method, which includes: grinding young bottle gourd leaves, adding TPS solution, incubating in a 65°C water bath, centrifuging, collecting the supernatant, precipitating the DNA with isopropanol, and dissolving it with an aqueous solution.

[0028] As a preferred embodiment, the KASP amplification reaction system in step (b) comprises: 2.5 μL of 2×KASP Master Mix, 2.5 μL of template DNA, and 0.07 μL of KASP primers, wherein the KASP primers are prepared from the primer set, and the remaining volume is made up by ddH2O.

[0029] As a preferred embodiment, the PCR amplification procedure in step (b) includes: Step 1: Pre-denaturation at 94 ℃ for 15 minutes; Step 2: 10 cycles of landing PCR, each cycle consisting of denaturation at 94 °C for 20 seconds, and annealing / extension at 61 °C starting at 0.6 °C and holding for 60 seconds each cycle. Step 3: 26 cycles of standard PCR, each cycle consisting of denaturation at 94 °C for 20 seconds and annealing / extension at 55 °C for 60 seconds.

[0030] The present invention provides a kit for detecting the length trait of bottle gourd fruit, the kit comprising a primer set of the KASP molecular marker, and at least one of a DNA extraction reagent, a PCR reaction buffer, or a fluorescent detection reagent.

[0031] As a preferred embodiment, the primer set is provided in the kit as a premixed KASP primer mixture and is prepared by dilution with ddH2O.

[0032] This invention provides an application of the aforementioned SNP molecular markers in bottle gourd breeding, used to select bottle gourd fruit length traits through molecular marker-assisted selection during the seedling stage, including using KASP technology to genotype the F2 or F3 segregating populations of bottle gourd and comparing it with phenotypic data to screen for long-fruited or short-fruited individual plants.

[0033] With the development of molecular biology techniques, molecular markers have been widely used in crop trait identification and variety breeding because they can directly detect genetic variations at the DNA level and are unaffected by tissue type, developmental stage, and habitat conditions. The SNP-KASP molecular marker provided in this invention has the characteristics of clear polymorphism, genetic stability, and good reproducibility. It can be used for molecular-assisted breeding and related genetic research on the length and shape of bottle gourd fruits, providing a simple, rapid, and reliable technical means for the efficient breeding of bottle gourd varieties.

[0034] The KASP molecular marker for detecting the length of bottle gourd fruits and its application, as described in this invention, has significant technical advantages compared to existing technologies. Existing technologies primarily rely on field fruit measurements and manual phenotypic surveys for screening bottle gourd fruit length traits. This is not only labor-intensive and time-consuming but also easily affected by factors such as growth environment, measurement time, and human judgment, resulting in low accuracy and stability of the detection results. In contrast, the SNP molecular marker provided by this invention is closely linked to the length trait of bottle gourd fruits, enabling accurate differentiation of different alleles at the DNA molecular level. It transforms phenotypic traits, which are significantly influenced by environment and growth stage, into stable and detectable genetic marker information, thereby significantly improving the accuracy and reliability of fruit length trait identification. Furthermore, the KASP molecular marker detection method constructed based on the SNP sites of this invention utilizes the competitive amplification of allele-specific primers and the fluorescence signal interpretation mechanism to achieve rapid genotyping without the need for restriction enzyme digestion and gel electrophoresis analysis. The detection process is simplified, less time-consuming, and suitable for high-throughput operation. The method of this invention can complete the prediction and screening of fruit length traits at the seedling stage of bottle gourd, without waiting for the plants to enter the fruiting stage for field surveys, which can effectively shorten the breeding cycle and reduce manpower input.

[0035] The following specific embodiments, incorporating data, are provided to further elaborate on the technical solution of the present invention: Example 1: Obtaining SNP molecular markers related to the length trait of bottle gourd fruit and designing KASP primers This example illustrates the process of obtaining SNP molecular markers related to the length trait of bottle gourd fruit: F2 segregating populations were constructed using the long-fruited bottle gourd inbred line “1GB-X” and the short-fruited bottle gourd inbred line “1GB-Y” as parents. Significant segregation of fruit length trait was observed in the F2 segregating populations. From these populations, 20 plants exhibiting extremely long fruit and 20 plants exhibiting extremely short fruit were selected, and equal amounts of young leaves were collected from each plant to construct mixed pools for long-fruited and short-fruited varieties. These samples, along with young leaves from both parents (“1GB-X” and “1GB-Y”), were sent to Beijing Novogene Technology Co., Ltd. for sequencing. The fruit length phenotypes of the different materials are as follows: Figure 1 As shown. Figure 1 Phenotypic diagrams of different bottle gourd fruit lengths are shown; where 1GB-X represents a long-fruited bottle gourd inbred line, 1GB-Y represents a short-fruited bottle gourd inbred line, and 1GB-F1 represents a bottle gourd with intermediate fruit length.

[0036] After filtering and quality control, the sequencing data was compared to the gourd. Bottle gourd 'Hangzhou Gourd' genome v1 The genome was analyzed using BSA-seq and the ΔSNP-index algorithm (e.g., Figure 2 As shown, Figure 2 (This is a ΔSNP-index analysis diagram of bottle gourd fruit length). Based on the BSA-seq analysis results, the candidate regions related to fruit length traits were initially located in the anterior region of chromosome 10. Figure 2 Based on the parental genome resequencing data, KASP primers were developed near the candidate region. Analysis revealed a C-to-T SNP mutation at position 2347101 on chromosome Chr010, which was significantly correlated with the length of bottle gourd fruit. Based on this, KASP primer HgCD was designed, with the sequence shown in SEQ ID NO:1-3, specifically: HgCD-FAM: GAAGGTGACCAAGTTCATGCTAGATCGAACGGTGGCTTGAG; HgCD-HEX: GAAGGTCGGAGTCAACGGATTAGATCGAACGGTGGCTTGAA; HgCD-COMMON:ACAAGCAACAGCAACTCTTCACAG.

[0037] Example 2: A method for detecting the length trait of bottle gourd fruit based on HgCD KASP primer set This embodiment provides a molecular detection procedure for detecting the length trait of bottle gourd fruit, the detection being based on bottle gourd. Bottle gourd 'Hangzhou Gourd' genome v1The SNP locus Chr010-2347101 (C / T) on chromosome 10 of the genome has a base of C at this locus for long-fruited materials and a base of T at this locus for short-fruited materials. The genotype CC indicates a long-fruited type, TT indicates a short-fruited type, and CT indicates an intermediate-length fruited type. The following steps are included: (a) Extraction of genomic DNA from bottle gourd samples (TPS method) Approximately 2 g of sample was taken from young bottle gourd leaves and placed in a centrifuge tube containing steel balls. The sample was homogenized using a tissue homogenizer at 60 Hz for 60 s. 700 μL of preheated TPS solution (65 °C) was added to the homogenized centrifuge tube, and the mixture was thoroughly mixed and incubated in a 65 °C water bath for 30 min. After cooling to room temperature, the sample was centrifuged (12000 rpm, 10 min), and 400 μL of the supernatant was transferred to a 1.5 mL centrifuge tube. 400 μL of pre-chilled isopropanol was added to the centrifuge tube, and the sample was centrifuged again (12000 rpm, 10 min), discarding the supernatant. The precipitate was washed with 75% ethanol, air-dried, and dissolved in ddH2O to obtain the genomic DNA solution.

[0038] (b) KASP-PCR amplification reaction (primer preparation, reaction system and amplification procedure) The KASP primer set used to detect the above SNP sites is the HgCD primer set, as shown in SEQ ID NO:1-3, including: HgCD-FAM: GAAGGTGACCAAGTTCATGCTAGATCGAACGGTGGCTTGAG HgCD-HEX:GAAGGTCGGAGTCAACGGATTAGATCGAACGGTGGCTTGAA HgCD-COMMON:ACAAGCAACAGCAACTCTTCACAG The KASP primer mixture is prepared as follows: each 100 μL primer mixture includes 12 μL (100 μM) HgCD-FAM, 12 μL (100 μM) HgCD-HEX, 30 μL (100 μM) HgCD-COMMON, and 46 μL ddH2O.

[0039] The KASP-PCR amplification reaction system includes: 2.5 μL 2× KASP Master Mix, 2.5 μL template DNA, 0.07 μL KASP primers (prepared from the primer set above), and the remaining volume is added to the required volume with ddH2O.

[0040] The PCR amplification procedure includes: Pre-denaturation at 94 ℃ for 15 min; 94 ℃ for 20 s, 61–55 ℃ (decreasing by 0.6 ℃ per cycle) for 60 s, for a total of 10 cycles; 94 ℃ for 20 s, 55 ℃ for 60 s, for a total of 26 cycles; Store at 4°C.

[0041] (c) Fluorescence signal detection and genotyping After the PCR reaction is completed, the fluorescence data of the amplification products are read, the data are analyzed, and the genotyping results are exported.

[0042] (d) Determine fruit length traits based on genotyping results Determining the correspondence between genotype and trait using fluorescence signals: When only the FAM signal is detected, the genotype is CC, corresponding to the long fruit type; When only the HEX signal is detected, it is the TT genotype, corresponding to the short fruit type; When both FAM and HEX signals are detected, it indicates the CT genotype, corresponding to the intermediate fruit length type. The unamplified control was NTC.

[0043] In this diagram, blue dots represent detected FAM signals (CC); red dots represent detected HEX signals (TT); green dots represent simultaneous detection of FAM and HEX signals (CT); and black dots represent NTC.

[0044] Example 3: Validation of extreme phenotypes in F2 population individuals using HgCD SNP-KASP molecular markers Based on the SNP molecular markers and their KASP primer sets related to the length trait of bottle gourd fruit described in Examples 1 / 2, this embodiment further verifies the accuracy and feasibility of the SNP-KASP molecular markers in molecular-assisted selection by separating population materials in F2.

[0045] Extreme phenotypic individuals from the F2 population were selected, with long-fruited material "1GB-X" and short-fruited material "1GB-Y" serving as controls. Testing and evaluation were conducted according to the following steps.

[0046] (a) Extraction of genomic DNA from bottle gourd samples to be tested Take approximately 2 g of young bottle gourd leaves from individuals exhibiting extreme phenotypes in the F2 population and from control materials. Place them in a 2 mL centrifuge tube containing steel balls and grind them using a tissue homogenizer (60 Hz, 60 s). Add 700 μL of preheated TPS solution to the homogenized sample, mix thoroughly, and incubate at 65 °C for 30 min. After cooling to room temperature, centrifuge (12000 rpm, 10 min), and transfer 400 μL of the supernatant to a 1.5 mL centrifuge tube. Add 400 μL of pre-cooled isopropanol and centrifuge (12000 rpm, 10 min), discarding the supernatant. Rinse with 75% ethanol, air dry, and dissolve in ddH2O to obtain an aqueous DNA solution.

[0047] (b) KASP-PCR amplification reaction KASP primer preparation: Each 100 μL primer mixture includes 12 μL (100 μM) HgCD-FAM, 12 μL (100 μM) HgCD-HEX, 30 μL (100 μM) HgCD-COMMON, and 46 μL ddH2O.

[0048] The KASP-PCR reaction system consists of: 2.5 μL 2× KASP Master Mix, 2.5 μL template DNA, 0.07 μL KASP primers, and the remaining volume is made up with ddH2O.

[0049] The KASP-PCR reaction procedure includes: Pre-denaturation at 94 ℃ for 15 min; 94 ℃ for 20 s, 61–55 ℃ (decreasing by 0.6 ℃ per cycle) for 60 s, for a total of 10 cycles; 94 ℃ for 20 s, 55 ℃ for 60 s, for a total of 26 cycles; Store at 4°C.

[0050] (c) Fluorescence signal detection and genotyping After PCR, fluorescence was read using the Omega F SNP genotyping instrument, and cluster analysis and genotyping were performed on the fluorescence data using ClusterCaller software.

[0051] (d) Phenotypic measurement and genotype correspondence determination Two weeks after pollination of bottle gourd, the length of each individual bottle gourd fruit was measured and recorded in the field, and compared with the KASP genotyping results. The genotyping rules were: CC for long fruit, TT for short fruit, and CT for medium fruit length. The comparison between the genotyping results and field phenotypes is shown in Table 1. The genotype corresponding to long fruit materials was CC, and the genotype corresponding to short fruit materials was TT. Genotype and phenotype were highly correlated. The SNP marker genotyping clustering results of different individual plants in the F2 segregating population are shown below. Figure 3 As shown, where Figure 3 The image shows the SNP marker genotyping of different individual plants in the F2 segregating population using the HgCD primer set; blue dots indicate the detection of FAM signal, which is the CC genotype and a homozygous long-fruited bottle gourd; red dots indicate the detection of HEX signal, which is the TT genotype and a homozygous short-fruited bottle gourd; green dots indicate the simultaneous detection of FAM and HEX signals, which is the CT genotype and a bottle gourd with intermediate fruit length; black dots indicate NTC.

[0052] Table 1 Genotypes and phenotypes of the F2 population

[0053] The above test results demonstrate that the SNP molecular markers and KASP primer sets for the length trait of bottle gourd fruit provided by this invention can accurately and rapidly identify the genotype of bottle gourd fruit length, and can be used for marker-assisted selection of fruit length traits. Comparison with field phenotypes shows that the KASP molecular markers are highly correlated with the bottle gourd fruit length phenotype, verifying their feasibility and effectiveness in bottle gourd breeding. Compared with traditional phenotypic identification methods, this molecular detection method has higher accuracy and efficiency, enabling rapid screening of target materials in the early stages of breeding.

[0054] In the above embodiments, by constructing segregating populations and combining BSA-seq and ΔSNP-index analysis, the SNP locus Chr010-2347101 (C / T), which is significantly associated with the length of bottle gourd fruit, was obtained, and based on this, the KASP primer set HgCD was designed for genotyping detection. Furthermore, the KASP-PCR fluorescence genotyping method provided by this invention clarifies the correspondence between CC, TT, and CT genotypes and long fruit, short fruit, and intermediate fruit length types. The molecular marker and detection method were further validated in the F2 segregating population, combining field fruit length measurement results with KASP genotyping results (including Table 1 and...). Figure 3 The comparison showed that the SNP-KASP molecular marker provided by the present invention is highly consistent with the fruit length phenotype, and can realize accurate identification and stable determination of the length trait of bottle gourd fruit.

[0055] In summary, this invention utilizes SNP loci closely linked to the target trait as genetic markers. Competitive amplification using allele-specific KASP primers generates differential fluorescence signals, enabling rapid differentiation of different genotypes at the DNA molecular level and predicting fruit length traits accordingly. Compared to traditional phenotypic screening methods relying on field measurements, this invention can complete genotyping and trait prediction at the seedling stage, reducing the impact of environmental factors and human error, and significantly improving the accuracy, stability, and repeatability of identification. Furthermore, the detection process eliminates the need for enzyme digestion and gel electrophoresis, simplifying the procedure and making it suitable for high-throughput screening. This facilitates shorter breeding cycles, lowers labor costs, and improves the efficiency of molecularly assisted selection for bottle gourd fruit length traits.

[0056] In the description of this invention, the references to "one embodiment," "some embodiments," "in this embodiment," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0057] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A SNP molecular marker for detecting the length trait of bottle gourd fruit, characterized in that, The SNP molecular marker corresponds to the bottle gourd. Bottle gourd 'Hangzhou Gourd' genome v1 The SNP site Chr010-2347101 on chromosome 10 of the genome, wherein the polymorphism of the SNP site is closely linked to the length trait of bottle gourd fruit, and its polymorphism is C / T.

2. The SNP molecular marker according to claim 1, characterized in that: The SNP site Chr010-2347101 is located in a segment of a bottle gourd nucleotide sequence, and is numbered starting from the 5′ end of the nucleotide sequence: When the nucleotide sequence is as shown in SEQ ID NO:4, and the base corresponding to the SNP site is C, the bottle gourd exhibits a long fruit type; When the nucleotide sequence is as shown in SEQ ID NO:5, and the base at the corresponding SNP site is T, the bottle gourd exhibits a short fruit type.

3. A KASP primer set for detecting the SNP molecular marker of claim 1, characterized in that, The primer set includes: The first allele-specific forward primer named HgCD-FAM has the nucleotide sequence shown in SEQ ID NO:1; The second allele-specific forward primer named HgCD-HEX has the nucleotide sequence shown in SEQ ID NO:2; The reverse primer named HgCD-COMMON has the nucleotide sequence shown in SEQ ID NO:3; Among them, SEQ ID NO:1 is: 5′-GAAGGTGACCAAGTTCATGCTAGATCGAACGGTGGCTTGAG-3′; SEQ ID NO:2 is: 5′-GAAGGTCGGAGTCAACGGATTAGATCGAACGGTGGCTTGAA-3′; SEQ ID NO:3 is: 5′-ACAAGCAACAGCAACTCTTCACAG-3′.

4. A method for detecting the length trait of bottle gourd fruit using the primer set described in claim 3, characterized in that, Includes the following steps: (a) Extracting genomic DNA from the bottle gourd sample to be tested; (b) Using the DNA extracted in step (a) as a template, perform KASP-PCR amplification reaction using the primer set described in claim 3; (c) Detect the fluorescence signal of the PCR product and perform genotyping; (d) Determine the fruit length trait of the bottle gourd to be tested based on the genotyping results: If the genotype is CC, it is determined to be the long-fruited type; If the genotype is TT, it is determined to be short-fruited. If the genotype is CT, it is determined to be the intermediate fruit length type.

5. The method according to claim 4, characterized in that, The DNA extraction in step (a) is performed using the TPS method, which includes: grinding young bottle gourd leaves, adding TPS solution, incubating in a 65°C water bath, centrifuging, collecting the supernatant, precipitating the DNA with isopropanol, and dissolving it with an aqueous solution.

6. The method according to claim 4, characterized in that, The KASP amplification reaction system in step (b) includes: 2.5 μL of 2× KASP Master Mix, 2.5 μL of template DNA, and 0.07 μL of KASP primers, wherein the KASP primers are prepared from the primer set described in claim 3, and the remaining volume is made up with ddH2O.

7. The method according to claim 4, characterized in that, The PCR amplification procedure in step (b) includes: Step 1: Pre-denaturation at 94 ℃ for 15 minutes; Step 2: 10 cycles of landing PCR, each cycle consisting of denaturation at 94 °C for 20 seconds, and annealing / extension at 61 °C starting at 0.6 °C and holding for 60 seconds each cycle. Step 3: 26 cycles of standard PCR, each cycle consisting of denaturation at 94 °C for 20 seconds and annealing / extension at 55 °C for 60 seconds.

8. A kit for detecting the length trait of bottle gourd fruit, characterized in that, The kit comprises the primer set of the KASP molecular marker as described in claim 3, and at least one of DNA extraction reagent, PCR reaction buffer or fluorescent detection reagent.

9. The reagent kit according to claim 8, characterized in that, The primer set is provided in the kit as a premixed KASP primer mixture and is prepared by dilution with ddH2O.

10. An application of the SNP molecular marker according to claim 1 in bottle gourd breeding, characterized in that, This method is used to select bottle gourd fruit length traits using molecular markers during the seedling stage. It involves using KASP technology to genotype the F2 or F3 segregating populations of bottle gourd and comparing the results with phenotypic data to screen for long-fruited or short-fruited individual plants.

Images