Vanin-1-based depression diagnosis marker and application thereof
By detecting the level of Vanin-1 protein and using Vanin-1 as a biomarker for depression, the challenge of early diagnosis has been solved. Targeted therapy has enabled safe and effective treatment of depression, providing an integrated solution for early intervention and diagnosis-treatment.
Patent Information
- Application Number
- CN202511873493.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-12
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies make it difficult to diagnose depression early, and existing antidepressants are ineffective for one-third of patients, requiring long treatment times. There is a lack of safe and effective new antidepressants and early diagnostic methods.
Using Vanin-1 protein as a biomarker, the levels of Vanin-1 in biological samples are detected for early screening, clinical auxiliary diagnosis, and disease progression assessment of depression. Targeted therapy can also be carried out through liver-specific overexpression or knockdown of Vanin-1.
It enables early diagnosis and safe, effective targeted treatment of depression, providing a new strategy for precision medicine that allows for intervention before symptoms worsen, reducing the impact on social functioning.
Smart Images

Figure CN121856547A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically based on Vanin-1 as a diagnostic biomarker for depression and its application. More specifically, this invention relates to the core role of liver Vanin-1 in the pathogenesis of depression, and the use of Vanin-1 protein as a biomarker for depression. Background Technology
[0002] Major depressive disorder (MDD) is a mental illness that severely impairs mental function and reduces quality of life. The core symptoms of MDD include depressed mood, loss of interest, slowed thinking, and severely impaired sleep quality, as well as inappropriate feelings of guilt, difficulty concentrating, and appetite disorders. Statistics show that MDD has become a common disease globally, affecting over 350 million people worldwide, with a patient growth rate of approximately 18% over the past decade. It is estimated that 5% of adults worldwide suffer from depression each year. Experts predict that MDD may become the second leading cause of death worldwide, after cardiovascular disease. The global cost of treating MDD is approximately US$230 billion annually. Therefore, MDD has become a significant threat to human health, placing a heavy burden on public health systems.
[0003] The pathogenesis of MDD is not yet fully understood, but it mainly includes the monoamine hypothesis, the hypothalamic-pituitary-adrenal axis theory, the inflammation hypothesis, the neurotrophic factor hypothesis, the gut microbiota theory, mitochondrial dysfunction, and the gene-environment interaction theory. MDD usually results from the interaction of several hypotheses. The complexity of the pathogenesis of MDD and the individual heterogeneity present many challenges to the development of antidepressants. Currently, the primary clinical treatment for MDD remains medication, aiming to fundamentally and effectively improve the patient's depressive condition while alleviating anxiety, depression, and other symptoms. Based on individualized principles, adequate dosage and duration of treatment are administered, starting with a small dose and then adjusting according to the patient's condition. Although several antidepressants are currently available, including selective serotonin reuptake inhibitors (SSRIs), tricyclic antidepressants (TCAs), and monoamine oxidase inhibitors (MAOs), one-third of patients do not respond to these medications. Even for those who do respond, it often takes weeks or even months to achieve a therapeutic effect. Therefore, there is an urgent need to develop safer and more effective new antidepressants.
[0004] Vascular non-inflammatory molecules (Vanins) are a class of hydrolases with pantothenic acid thioacetylaminoethanolase activity, playing a crucial role in maintaining metabolic and oxidative stress homeostasis. This family includes homologous genes such as Vanin-1, Vanin-2, and Vanin-3, among which Vanin-1 exhibits high conservation (77.9% homology) between humans and mice, suggesting a key biological function in evolution. Vanin-1 is considered a crucial link between oxidative stress and metabolic homeostasis, enhancing cellular antioxidant capacity by regulating intracellular sulfur metabolism and glutathione synthesis, thereby maintaining homeostasis. However, its application in treating anxiety-depressive-like behaviors has not been reported in the literature. Summary of the Invention
[0005] Purpose of the invention: One of the purposes of the invention is to provide a specific molecular marker for the early diagnosis of depression.
[0006] Second objective of the invention: This invention elucidates the key pathogenic factors and their mechanisms of action in the pathogenesis of depression.
[0007] Technical solution: To achieve the above objectives, the present invention adopts the following technical solution: A biomarker for diagnosing depression, characterized in that the biomarker is Vanin-1 protein.
[0008] The application of the biomarkers in the preparation of diagnostic reagents or kits for depression.
[0009] The application is characterized in that the diagnosis includes early screening for depression, clinical auxiliary diagnosis, or disease progression assessment.
[0010] Application of Vanin-1 protein in the preparation of drugs for treating depression.
[0011] The application is characterized in that the depression is severe depression.
[0012] The amino acid sequence of the Vanin-1 protein can be found in GenBank accession number: DQ100297.1.
[0013] Specifically, this invention provides an auxiliary diagnostic method for depression, the core of which lies in detecting the level of Vanin-1 in biological samples. We have demonstrated that downregulation of hepatic Vanin-1 is a key step in the pathogenesis of depression and has the potential to serve as a biomarker.
[0014] Beneficial Effects: Early detection of depression is difficult primarily because its symptoms are often subtle, easily confused with everyday mood swings, and lack specific diagnostic criteria. Early-stage depression often manifests as persistent low mood, loss of interest, and decreased energy, which are frequently mistaken for "stress," "bad mood," or "being dramatic," and are easily overlooked by the individual and those around them. Patients may maintain a normal work and life, only exhibiting atypical symptoms such as sleep disturbances (e.g., insomnia, early awakening), changes in appetite, and difficulty concentrating; these somatic manifestations are even harder to associate with psychological problems. Furthermore, early-stage patients often experience stigma, are reluctant to express their inner pain, and may even deliberately conceal their emotional abnormalities, further increasing the difficulty of detection. In addition, insufficient public awareness of depression makes it difficult to distinguish between "temporary mood swings" and "pathological depression," leading to many cases being only noticed after symptoms have worsened and social functioning has been impaired. Many patients are overlooked in the early stages, and by the time they seek medical attention, their symptoms have already progressed to moderate to severe. Therefore, the field of depression urgently needs to develop diagnostic reagents and biomarkers that can enable early screening and support early intervention.
[0015] Hepatic vanin-1 is a novel biomarker for depression. Systemic vanin-1 knockout in mice resulted in typical anxiety-depression-like behaviors, as did liver vanin-1 knockout in normal mice. Consistently, vanin-1 levels were significantly reduced in various depression models (CORT-induced depression, CUMS-induced depression, and clinical depression patients), and crucially, the reduction in vanin-1 levels occurred earlier than the development of the depressive phenotype in mice. Experiments demonstrated that overexpression of vanin-1 in mouse liver not only significantly improved anxiety-depression-like behaviors but also repaired hippocampal nerve damage, promoted neurogenesis, and improved mitochondrial and synaptic ultrastructure. This discovery successfully translates into a new precision medicine strategy integrating diagnosis and treatment: early diagnosis can be achieved by detecting vanin-1 levels, and vanin-1 supplementation can provide safe and effective targeted therapy for depression patients, offering a breakthrough solution for the prevention and treatment of depression. Attached Figure Description
[0016] Figure 1 This is a heatmap of the mouse activity trajectory in the OFT experiment in Example 1; Figure 2 This is a graph showing the activity levels in the OFT experiment in Example 1; Figure 3 This is a heatmap of mouse activity trajectory in the EPM experiment of Example 1; Figure 4 This is a statistical graph showing the ratio of exploration time for mice with open and closed arms in the EPM experiment in Example 1; Figure 5 This is a heat map of the activity trajectory in the dark chamber of the LDT experiment in Example 1; Figure 6 This is a statistical chart of LDT activity time in the darkroom in Example 1; Figure 7 This is a statistical graph of the immobility time of mouse tail suspension in the TST experiment in Example 1; Figure 8 This is a statistical graph of the immobility time of mice in the FST experiment in Example 1; Figure 9 This is a statistical chart of the sugar water preference rate in the SPT experiment of Example 1; Figure 10 H&E staining of the hippocampus in Example 1, scale bar: 250 μm; Figure 11 This is the hippocampal Ki67 immunohistochemical staining in Example 1, scale bar: 250 μm; Figure 12 This is a statistical count of the number of Ki67-positive cells in the hippocampal DG region in Example 1, n=3; Figure 13 This is a transmission electron microscope morphological observation of the synapse in Example 1, scale bar: 500 nm; Figure 14 This is a statistical chart of mitochondrial numbers from Example 1; Figure 15 This is a transmission electron microscope observation of mitochondria morphology in Example 1, scale bar: 500 nm; Figure 16 This is a statistical chart of the number of synapses in Example 1, n=3; Figure 17 This is a heatmap of mouse activity trajectory in the OFT experiment in Example 2; Figure 18 This is a graph showing the activity levels in the OFT experiment in Example 2; Figure 19 This is a heatmap of mouse activity trajectory in the EPM experiment of Example 2; Figure 20 This is a statistical graph showing the ratio of exploration time for mice with open and closed arms in the EPM experiment in Example 2; Figure 21 This is a heat map of the activity trajectory in the dark chamber of the LDT experiment in Example 2; Figure 22 This is a statistical chart of LDT activity time in the darkroom in Example 2; Figure 23 This is a statistical graph of the immobility time of mouse tail suspension in the TST experiment in Example 2; Figure 24 This is a statistical graph of the immobility time of mice in the FST experiment in Example 2; Figure 25This is a statistical chart of the sugar water preference rate in the SPT experiment in Example 2; Figure 26 H&E staining of the hippocampus in Example 2, scale bar: 250 μm; Figure 27 This is the hippocampal Ki67 immunohistochemical staining in Example 2, scale bar: 250 μm; Figure 28 This is a statistical count of the number of Ki67-positive cells in the hippocampal DG region in Example 2, n=3; Figure 29 This is a transmission electron microscope morphological observation of the synapse in Example 2. Scale bar: 500 nm. Figure 30 This is a statistical chart of mitochondrial numbers from Example 2; Figure 31 This is a transmission electron microscope observation of mitochondria morphology in Example 2, scale bar: 500 nm; Figure 32 This is a statistical chart of the number of synapses in Example 2, n=3; Figure 33 This refers to the changes in blood Vanin-1 levels in CORT-induced depression model mice in Example 3; Figure 34 This refers to the changes in Vanin-1 content in the liver of CORT-induced depression model mice in Example 3; Figure 35 This refers to the changes in blood Vanin-1 levels in CUMS-induced depression model mice in Example 4; Figure 36 This refers to the changes in Vanin-1 content in the liver of CUMS-induced depression model mice in Example 4; Figure 37 This is a graph showing the activity levels in the OFT experiment in Example 5; Figure 38 This is a statistical graph of the immobility time of mouse tail suspension in the TST experiment in Example 5; Figure 39 This refers to the changes in blood Vanin-1 levels in mice using the CORT time-gradient depression model in Example 5; Figure 40 This refers to the changes in Vanin-1 content in the liver of mice in the CORT time-gradient depression model in Example 5; Figure 41 This refers to the changes in blood Vanin-1 levels in clinical MDD patients in Example 6. Detailed Implementation
[0017] The research approach of this invention is as follows: Gain and loss of function experiments demonstrated that the deficiency of Vanin-1 in the liver is a key factor in the pathogenesis of depression. Simultaneously, by constructing two classic depression models (CORT-induced model and CUMS-induced model), it was confirmed that the level of Vanin-1 in the blood of depressed mice was significantly reduced. Further analysis using the CORT time-gradient drug administration model revealed that the decrease in Vanin-1 occurred earlier than the appearance of the depressive phenotype. Analysis of blood samples from clinical patients validated that Vanin-1 can serve as a potential molecular marker for the initial diagnosis of depression.
[0018] Example 1: Depression induced in systemic Vanin-1 knockout mice can be salvaged by liver-specific Vanin-1 replenishment. To further investigate the antidepressant role of Vanin-1 in the mouse liver-brain axis, we inserted the CDS region (or a mutated CDS region) of Vanin-1 RNA into an AAV viral vector plasmid, packaged the virus, and injected it into mice via tail vein. We then used AAV-mediated gene overexpression technology to achieve long-term overexpression of Vanin-1 in the mouse liver. Behavioral studies were conducted five weeks after AAV injection.
[0019] We conducted a preliminary study using Vanin-1 mice and found that these mice (Vanin-1+AAV8-TBG) exhibited significantly depressive-like behaviors compared to WT mice (WT+AAV8-TBG). Specifically, in the open field test, the central activity distance of the Vanin-1+AAV8-TBG group was significantly reduced (Figures 1 and 2); in the elevated cross maze test, the time spent in the open arm was significantly reduced (Figures 3 and 4); in the light-dark box test, the time spent in the light box was significantly reduced (Figures 5 and 6); and in the tail suspension and forced swimming tests, the immobility time was significantly increased (Figures 7 and 8). The mice also showed a significant decrease in sucrose intake. Figure 9 ).
[0020] To further investigate the direct regulatory effect of hepatic Vanin-1 on this behavioral change, we achieved hepatic Vanin-1 specific overexpression using AAV8-TBG-Vanin-1 and found that the aforementioned depressive-like behavior was significantly reversed in the Vanin-1+AAV8-TBG-Vanin-1 group compared to Vanin-1+AAV8-TBG mice. More importantly, overexpression of the Vanin-1 C213S enzyme activity mutant (Vanin-1+AAV8-TBG-Vanin-1 C213S) did not produce the aforementioned recovery effect. Figure 1-9This suggests that the loss of Vanin-1 enzyme activity is a key factor in inducing a depressive-like phenotype.
[0021] Given that the hippocampus is a crucial center for regulating depressive behavior, we compared the pathological phenotypes of the hippocampus in mice after liver-specific overexpression of Vanin-1. Pathological examination revealed that, compared to Vanin-1 mice, liver-specific Vanin-1 overexpression reversed the pathological damage in the hippocampus of Vanin-1AAV8-TBG mice. Specifically, after reinstatement, the morphology of hippocampal neurons in Vanin-1AAV8-TBG-Vanin-1 mice returned to normal, with relatively clear structures, neat and dense cell arrangement, and a significant increase in the number of adult neurons in the DG region, essentially returning to the WT level; while the neurons in the Vanin-1+AAV8-TBG-Vanin-1 C213S group did not recover (Figures 10-12). Transmission electron microscopy revealed that after liver-specific reinjection of Vanin-1, the number of swollen and damaged mitochondria in the hippocampus of Vanin-1+AAV8-TBG-Vanin-1 mice decreased, the number of newly generated normal mitochondria increased, synaptic structure returned to normal, and synaptic vesicles were more evenly distributed in the synapses. Figure 13-16 ).
[0022] Example 2: Liver-specific knockdown of Vanin-1 mice induces anxiety-depression-like behavior: To further validate the function of Vanin-1, we constructed a loss-of-function model by specifically downregulating Vanin-1 expression in the livers of wild-type mice. Specifically, we used an adeno-associated virus vector to deliver shRNA targeting the Vanin-1 gene (target sequence: TTTCTCCCCTCTCTCTCTTAA) to achieve liver-specific long-term gene knockdown. Five weeks after viral injection, we evaluated the behavioral phenotypes of the mice. The results showed that liver-specific knockdown significantly reduced the central activity distance in the open field test (Figs. 17 and 18), the time spent in the open arm test in the elevated cross maze test (Figs. 19 and 20), the time spent in the light box test in the light-dark box test (Figs. 21 and 22), the immobility time in the tail suspension and forced swimming tests (Figs. 23 and 24), and the sucrose intake was significantly reduced (Fig. 25). These experimental results indicate that liver-specific knockdown increases anxiety-depression-like behavior in mice, suggesting that liver Vanin-1 is a potential effector molecule that transmits signals to the brain.
[0023] Next, we evaluated the pathological phenotypic changes in the hippocampus of liver-specific knockdown mice. The results showed increased pathological damage in the hippocampus of liver-specific knockdown Vanin-1 mice, specifically manifested as abnormal restoration of neuronal morphology, disordered cell arrangement, and a significant reduction in the number of adult neurons in the DG region (Figures 26-28). Transmission electron microscopy revealed an increase in the number of swollen and damaged mitochondria, a decrease in the number of newly generated normal mitochondria, and abnormal synaptic structure in the hippocampus of the knockdown group mice compared to WT mice (Figures 29-32). These results suggest that liver-specific knockdown of Vanin-1 can significantly increase mitochondrial and synaptic structural damage in the hippocampus of WT mice, reduce the number of newly generated mitochondria and synapses, thereby increasing ultrastructural damage in the hippocampus.
[0024] Example 3, Decreased Vanin-1 levels in a CORT-induced depression model: Six-week-old healthy male inbred mice were used as experimental animals. The mice were housed in a standard laboratory environment at 24±2℃ and 50%–60% relative humidity, with free access to food and water, ordinary fluorescent lighting, and an automatic timer switch controlling the 12L:12D photoperiod. After two weeks of acclimatization to the laboratory environment, the mice were grouped and cultured.
[0025] Corticosterone-induced depression model (CORT): Mice were divided into two groups: a control group and a model group. The control group received subcutaneous injections of saline daily, while the model group received subcutaneous injections of 20 mg / kg corticosterone daily for 3 consecutive weeks. Blood, liver, and brain tissue samples were collected from mice at corresponding time points. After modeling, Vanin-1 protein levels were detected using ELISA. As shown in Figure 33, compared with the CTL group, serum Vanin-1 levels in the CORT group were significantly lower (P<0.01). Western blot analysis showed that liver Vanin-1 levels in the CORT group were significantly lower than those in the CTL group (P<0.01) (Figure 34).
[0026] Example 4: Decreased Vanin-1 levels in a CUMS-induced depression model: Chronic unpredictable mild stress (CUMS) depression model: Mice were divided into two groups: a control group and a model group. The control group was fed normally and received no stimulation. The model group underwent a randomized stress test daily, including: cage tilting at 45°C for 24 h, cage rocking for 15 min, moist bedding for 24 h, forced swimming in 4°C ice water for 5 min, swimming in 42°C hot water for 5 min, behavioral restriction for 2 h, water deprivation for 24 h, food deprivation for 24 h, tail clamping for 1 min, continuous light exposure for 36 h, and foot shock for 1 min. Each stimulus was not administered more than twice consecutively to ensure the animals could not predict its occurrence. The stimulation lasted for 4 weeks. After modeling, Vanin-1 levels were measured using ELISA. As shown in Figure 35, compared with the CTL group, the serum Vanin-1 level in the CORT group was significantly lower (P<0.01). Western blot analysis showed that compared with the CTL group, the liver Vanin-1 level in the CORT group was significantly lower (P<0.01) (as shown in Figure 36). The above results indicate that Vanin-1 levels in mouse blood and liver showed a decreasing trend in the depression model.
[0027] Example 5: Decrease in Vanin-1 levels precedes the depressive phenotype in CORT-induced depression models with different disease durations. To clarify the relationship between hepatic Vanin-1 protein levels and the course of depression, we constructed MDD mouse models at different disease stages using CORT: Six- to eight-week-old male C57BL / 6J mice raised in a standard environment were selected and, after one week of acclimatization, the following modeling method was used: CORT-induced MDD mouse model: CORT (40 mg / kg) was injected subcutaneously daily for 3, 7, 14, 21, and 28 days. Behavioral monitoring was performed on these mice. As shown in Figures 37 and 38, after 14 consecutive days of CORT injection, the central movement distance in the open field test was significantly reduced, and the immobility time in the tail suspension test was significantly prolonged, suggesting that these mice had exhibited a depressive-like phenotype. More importantly, on day 7 of CORT injection, Vanin-1 protein expression in the liver of the mice had significantly decreased ( Figure 39 (and 40), suggesting that the decrease in Vanin-1 protein in the mouse liver precedes the development of its depressive-like phenotype, and Vanin-1 may be an important molecular marker for the diagnosis of depression.
[0028] Example 6: Decrease in Vanin-1 levels precedes the depressive phenotype in CORT-induced depression models with different disease durations: We collaborated with Nanjing University Affiliated Gulou Hospital to collect blood samples from 30 newly diagnosed, medication-free patients with depression and age- and sex-matched controls. We assessed patients' emotional and cognitive indicators using relevant scales to determine the severity of their depression. Simultaneously, we measured serum hormone levels. The protocol is as follows: ① Inclusion criteria: Individuals aged 18-60 years who met the diagnostic criteria for depressive disorders in the World Health Organization's International Classification of Diseases, 11th Revision (ICD-11); able to read and understand Chinese; and with 9 years or more of education. The following conditions were excluded: diagnosis of schizophrenia, bipolar disorder, obsessive-compulsive disorder, neurodevelopmental disorders, or other mental disorders; comorbid serious physical illnesses (such as cardiovascular disease, nervous system disease, immune system disease, liver or kidney dysfunction, etc.); use of antipsychotics or antidepressants within the past month; and pregnant or breastfeeding women. ② Clinical scale assessment: The following scales were used to assess changes in depression-related indicators in patients: Hamilton Depression Rating Scale-17 (HAMD-17), Hamilton Anxiety Rating Scale (HAMA), 9-item Patient Health Questionnaire-9 (PHQ-9), 7-item Generalized Anxiety Disorder Scale (GAD-7), Pittsburgh Sleep Scale (PSQI), RBANS (Regressive Basis Assessment of Cognitive Function), and International Classification of Functioning, Disability and Health (ICF). ③ Serum Vanin-1 and depression-related indicator detection: Serum Vanin-1 levels were measured. Results showed that serum Vanin-1 levels were significantly decreased in patients with depression (as shown in Figure 41), suggesting that Vanin-1 is an effective candidate molecular marker for depression.
Claims
1. A biomarker for diagnosing depression, characterized in that, The biomarker is Vanin-1 protein.
2. The use of the biomarker according to claim 1 in the preparation of a diagnostic reagent or kit for depression.
3. The application according to claim 2, characterized in that, The diagnosis includes early screening for depression, clinical auxiliary diagnosis, or assessment of disease progression.
4. Application of Vanin-1 protein in the preparation of drugs for treating depression.
5. The application according to any one of claims 2-4, characterized in that, The depression mentioned is severe depression.