Agonist of cGAS-STING signal channel as well as preparation method and application of agonist
By using a framework DNA agonist to regulate the cGAS-STING signaling pathway, the dose-dependent and sequence-specific dependence of existing agonists were resolved, resulting in more efficient cGAS activation and cGAMP synthesis, and enhanced interferon response.
Patent Information
- Application Number
- CN202510262050.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-10-16
- Filing Date
- 2025-03-06
- Publication Date
- 2026-04-17
Smart Images

Figure CN121868326A_ABST
Abstract
Description
[0001] This application claims priority to patent application number 202411446479.1 (the earlier application was filed on October 16, 2024, and is entitled "An agonist of the cGAS-STING signaling pathway, its preparation method and application"). Technical Field
[0002] This invention relates to the field of biotechnology, and in particular to an agonist of the cGAS-STING signaling pathway, its preparation method, and its application. Background Technology
[0003] Cyclic guanosine monophosphate-adenosine synthase (cGAS) is a highly conserved intracellular DNA sensor capable of recognizing a broad spectrum of DNA types. Upon DNA binding, cGAS undergoes a conformational change, promoting dimerization and activation. It catalyzes the synthesis of cyclic guanylate adenosine monophosphate (cGAMP), a second messenger that binds to and activates the STING (interferon gene stimulatory factor) pathway. Recent findings focus on the liquid-liquid phase transition (LLPS) process of cGAS in response to cytoplasmic DNA. DNA with high charge density and complex structure promotes the LLPS process. This powerful phase transition allows cGAS to efficiently detect the presence of DNA in the cytoplasm, ultimately promoting the production of type I interferon.
[0004] Researchers have discovered numerous DNA motifs with cGAS immunostimulatory activity, including Poly(dA:dT), HT-DNA, and G3-YSD. Poly(dA:dT) is a repeating synthetic double-stranded DNA sequence of poly(dA:dT):poly(dA:dT) and a synthetic analogue of B-DNA, containing a specific sequence of DNA fragments that can activate many different types of cytoplasmic DNA sensors (including cGAS and AIM2). HT-DNA, also known as sodium deoxyribonucleic acid derived from herring testes, is a sodium salt form of deoxyribonucleic acid extracted from herring testes and typically does not provide a specific molecular weight. G3-YSD is a 26nt DNA sequence generated by reverse transcription of human immunodeficiency virus RNA. Furthermore, the guanosine overhang of Y-type DNA can significantly promote cGAS-dependent immune activation of dsDNA. Many cGAS-STING pathway agonists have been developed and tested in preclinical studies for the treatment of cancer or infectious diseases, with promising results. As adjuvants, cGAS-STING agonists have demonstrated the potential to activate potent defensive immunity in various diseases, including COVID-19 infection. Activating immune cells within the tumor microenvironment through the cGAS-STING signaling pathway to initiate anti-tumor immune responses has become a research hotspot in recent years. cGAS-STING pathway agonists, alone or in combination with other therapies, have been applied in preclinical studies of various tumors. Agonists of this pathway exhibit good antiviral activity and hold promise for further development into novel antiviral drugs. Most existing commercially available cGAS signaling pathway agonists are dose-dependent, meaning their effectiveness increases with increasing dosage, but they may also reach a saturation point or produce adverse reactions. Furthermore, most existing commercially available cGAS agonists rely on large molecular weights or specific DNA sequences to achieve significant cGAS activation, limiting their widespread application.
[0005] CN116196327A discloses a cGAS-STING pathway agonist ssDNA and its uses. The cGAS-STING pathway agonist is selected from the nucleic acid-circular ssDNA of M13 bacteriophage. It can stimulate the production of IFNβ and cxcl10 and is an effective cGAS-STING pathway agonist that can promote the phagocytosis and presentation of antigens by macrophages. However, its function depends on a specific DNA sequence.
[0006] CN116036129A discloses a novel cGAS-STING agonist and its applications, providing a series of metal cations and anions with cGAS-STING pathway activation capabilities. The cations and anions can be combined in pairs to construct nanomaterials with cGAS-STING pathway activation potential. The resulting novel cGAS-STING pathway activator, manganese molybdate nanoparticles, can effectively kill tumor cells, activate the cGAS-STING pathway, stimulate dendritic cell maturation, and enhance tumor metalloimmunotherapy.
[0007] In summary, how to provide an efficient and widely applicable agonist for the cGAS-STING signaling pathway has become one of the urgent problems to be solved in this field. Summary of the Invention
[0008] To address the aforementioned technical problems, this invention provides an agonist for the cGAS-STING signaling pathway, its preparation method, and its application. This invention applies framework DNA to activate the cGAS-STING signaling pathway, effectively activating cGAS by regulating the strength of cGAS phase separation through dimensional factors. Its activation effect is stronger than that of existing commercial agonists, accelerating the synthesis of cGAMP and promoting the generation of type I interferon downstream of the cGAS-STING signaling pathway.
[0009] To achieve this objective, the present invention adopts the following technical solution:
[0010] In a first aspect, the present invention provides an agonist for the cGAS-STING signaling pathway, the agonist comprising framework DNA.
[0011] This invention uses spatially structured framework DNA (FNAs) as an agonist of the cGAS-STING signaling pathway. Its activation effect is significantly stronger than that of existing commercial agonists (Poly(dA:dT), HT-DNA, G3-YSD, etc.), more effectively enhancing cGAS binding, promoting cGAS dimerization and LLPS. The highly concentrated cGAS accelerates cGAMP synthesis, which is crucial for STING activation and interferon (IFN) response.
[0012] In this invention, framework DNA refers to a structure with a certain shape and size assembled from DNA molecules in one-dimensional to three-dimensional space. In some cases, it can be alternatively referred to as DNA (nano) structure, DNA origami, DNA (nano) material, DNA (nano) carrier, DNA (nano) robot (human), DNA (nano) device, or DNA polyhedron, etc.
[0013] Preferably, the structure of the framework DNA includes at least one of a one-dimensional structure, a two-dimensional structure, or a three-dimensional structure.
[0014] Preferably, the one-dimensional structure comprises at least two linearly tandem double-stranded DNA strands.
[0015] Preferably, the two-dimensional structure includes any one or a combination of at least two of the following: double chain (ab), ring (Circ), shovel (abc), three-way connection (3WJ), triangle (Tr), cross (Cr), quadrilateral (Qu), parallel structure (Qu-2S), or included angle structure (Tr-2S).
[0016] Preferably, the parallel structure comprises two parallel double-stranded DNA strands; the angled structure comprises two double-stranded DNA strands forming an angle greater than 0° and less than 180°.
[0017] Preferably, the three-dimensional structure includes a pyramid shape (Py), a triangular prism shape (Tp), or a tetrahedral shape (TDN, G). n -TDN-G n or any one or at least a combination of two of the following: (or nTDN).
[0018] Preferably, the tetrahedral shape includes any one or a combination of at least two of the following: a regular tetrahedral shape, a tetrahedral shape with a pendant base, or a non-regular tetrahedral shape with an angle less than 60°.
[0019] Preferably, the tetrahedral shape of the dangling base contains at least two dangling chains, each dangling chain contains at least one G base, and the length of the unpaired base end is ≥2nt.
[0020] Preferably, the non-tetrahedral DNA comprises five arms with a length of 20 bp and one arm with a length of 10 bp, 15 bp, 25 bp or 30 bp.
[0021] In this invention, controlling the length of the non-equal arms in a non-regular tetrahedron can further improve the ability to activate cGAS.
[0022] Preferably, the framework DNA also has unpaired base ends.
[0023] Preferably, the distance between the linearly tandem double-stranded DNAs in the one-dimensional structure is ≥0.34 nm.
[0024] Preferably, the distance between the linearly tandem double-stranded DNAs in the one-dimensional structure is ≥0.34nm and ≤14nm.
[0025] Preferably, in the one-dimensional structure, the double-stranded DNA is linked by single-stranded DNA, and the length of the single-stranded DNA is ≥1nt, preferably 1 to 40nt, for example, it can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 36, 37, 38 or 39nt, and more preferably 2 to 20nt.
[0026] Preferably, the one-dimensional structure may include 2, 3, 4, 5 or 6 linearly tandem double-stranded DNA strands.
[0027] In this invention, controlling the number of specific linearly tandem double-stranded DNA strands or the length of single-stranded DNA in a one-dimensional structure can further enhance the ability to activate cGAS.
[0028] Preferably, the distance between the two double-stranded DNA strands in the parallel structure is ≥0.34 nm.
[0029] Preferably, the distance between the two double-stranded DNA strands in the parallel structure is ≥0.34nm and ≤15nm.
[0030] Preferably, in the parallel structure, one end of a double-stranded DNA is connected to the other end of a double-stranded DNA via a single-stranded DNA. The length of the single-stranded DNA is ≥1 nt, preferably 1 to 42 nt, for example, it can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 36, 37, 38, 39, 40 or 41 nt, etc.
[0031] In this invention, controlling the length of single-stranded DNA in parallel structures can further enhance the ability to activate cGAS.
[0032] Preferably, in the angled structure, one end of a double-stranded DNA is connected to another double-stranded DNA via single-stranded DNA, the length of the single-stranded DNA at the angled end is ≥1nt, and the length of the single-stranded DNA at the non-angled end is ≥2nt.
[0033] Preferably, the length of the single-stranded DNA at the angled end is 1–38 nt, for example, it can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 36, or 37 nt. The length of the single-stranded DNA at the non-angled end is 2–40 nt, for example, it can be 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 36, 37, 38, or 39 nt.
[0034] Preferably, the included angle in the included angle structure is ≤68.21°.
[0035] In this invention, controlling the included angle in the included angle structure can further improve the ability to activate cGAS.
[0036] Preferably, the side length of the tetrahedral DNA is ≥15bp.
[0037] Preferably, the side length of the tetrahedral DNA is ≥15bp and ≤40bp, for example, it can be 15, 16, 17, 18, 19, 20, 25, 30, 35, 36, 37, 38, or 39bp.
[0038] Preferably, the DNA at the unpaired base terminus contains at least one G base, and the length of the unpaired base terminus is ≥2nt, preferably 2 to 43nt, for example, it can be 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 36, 37, 38, 39, 40, 41 or 42nt, etc.
[0039] In this invention, the framework DNA with unpaired base ends can be a double helix (ab) and / or a tetrahedral shape with dangling bases (G). n -TDN-G n ).
[0040] In this invention, it was found that the ability of framework DNA to activate cGAS is as follows: angled structure > parallel structure > 1D; under the same 3D structure: non-tetrahedral > tetrahedral; with unpaired base ends > without unpaired base ends.
[0041] The agonist design in this invention is based on multiple types of FNAs that depend on different dimensions (1D, 2D, 3D), including 1D: dsDNA-3S, dsDNA-2S; 2D: ab, abc, 3WJ, Tr, Cr, Qu, etc.; 3D: Py, Tp, TDN (tetrahedral), G... n -TDN-G n (Tetrahedral of pendant bases), nTDN (non-tetrahedral), etc., and not limited to the specific structures listed above, can be any type of FNA with 2D or 3D structure. Furthermore, the sequence composition is flexible; verification through the construction of 132 random nucleoside sequences shows that the nucleic acid composition can be a random nucleic acid sequence. Specific nucleic acid sequences do not limit the scope of this invention. The agonist provided by this invention has great assembly accessibility and multiple application prospects.
[0042] Preferably, the raw materials for preparing the framework DNA include at least two single-stranded DNAs with complementary base pairing regions.
[0043] Preferably, the framework DNA contains at least one base-complementary pairing region.
[0044] Preferably, the framework DNA contains at least one base-complementary pairing region with a length ≥15bp and ≤40bp (e.g., it can be 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, 22bp, 24bp, 26bp, 28bp, 30bp, 32bp, 34bp, 36bp, 38bp, or 40bp, etc.).
[0045] In this invention, the length of the complementary base pairing region is referred to as the arm length.
[0046] Preferably, the complementary base pairing region is formed by annealing at least two single-stranded DNA molecules.
[0047] Preferably, the method for preparing the framework DNA includes: mixing at least two single-stranded DNAs and then annealing them to form at least one complementary base pairing region to obtain the framework DNA.
[0048] Preferably, the single-stranded DNA is mixed in a buffer solution.
[0049] Preferably, the buffer solution contains 10–40 mM (e.g., 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, or 40 mM) Tris-HCl at a pH of 7.5–8 (e.g., 7.5, 7.6, 7.7, 7.8, 7.9, or 8) and 2–5 mM (e.g., 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4 mM, 4.5 mM, or 5 mM) MgCl2.
[0050] Preferably, the annealing temperature is 90-95°C (e.g., 90°C, 91°C, 92°C, 93°C, 94°C, or 95°C), and the annealing time is 10-20 min (e.g., 10 min, 12 min, 14 min, 15 min, 16 min, 18 min, or 20 min).
[0051] Preferably, the annealing process further includes a step of cooling to 2-4°C (e.g., 2°C, 2.5°C, 3°C, 3.5°C, or 4°C) and holding for 20-30 minutes (e.g., 20 minutes, 22 minutes, 24 minutes, 25 minutes, 26 minutes, 28 minutes, or 30 minutes).
[0052] Preferably, the method for preparing the duplex includes: annealing two single-stranded DNA molecules to form a base-complementary pairing region.
[0053] For example, the double strand can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.1 to SEQ ID NO.2.
[0054] SEQ ID NO. 1: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.
[0055] SEQ ID NO. 2: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.
[0056] Preferably, the method for preparing the ring includes: annealing two single-stranded DNA molecules to form a base-complementary pairing region;
[0057] For example, the circular DNA can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.127 to SEQ ID NO.128.
[0058] SEQ ID NO. 127: CTAACACCATCGGTTGATTGGCGCGCGCTTTAACCGCGCGAACTAATAAGCGTGTTAGACAGCGCATGGGTATCCACGGT.
[0059] SEQ ID NO. 128: CGCGCGGTTAAAGCGCGCGCCAATCAACCGATGGTGTTAGACCGTGGATACCCCATGCGCTGTCTAACACGCTTATTAGTT.
[0060] Preferably, the method for preparing the shovel shape includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions intersect at a single point in space and are not coplanar.
[0061] For example, the shovel shape can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.3 to SEQ ID NO.5.
[0062] SEQ ID NO. 3: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.
[0063] SEQ ID NO.4: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCSEQ ID NO.5: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGA AGAAGGCAAC.
[0064] Preferably, the method for preparing the three-way ligation includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions intersect at a point on a plane.
[0065] For example, the three-way linker can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.6 to SEQ ID NO.8.
[0066] SEQ ID NO. 6: TCTAACACCATCGGTTGATTGGCGCGCGCTTTAACCGCGCG.
[0067] SEQ ID NO. 7: TCGCGCGGTTAAAGCGCGCGCAACTAATAAGCGTGTTAGAC.
[0068] SEQ ID NO. 8: TGTCTAACACGCTTATTAGTTCAATCAACCGATGGTGTTAG.
[0069] Preferably, the method for preparing the triangle includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions are the three sides of the triangle.
[0070] For example, the triangle can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.9 to SEQ ID NO.11.
[0071] SEQ ID NO. 9: CTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.
[0072] SEQ ID NO. 10: CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT.
[0073] SEQ ID NO. 11: CGCGCGGTTAAAGCGCGCGC.
[0074] Preferably, the method for preparing the cross shape includes: annealing four single-stranded DNA strands to form four complementary base pairing regions, wherein the four complementary base pairing regions intersect at a point on a plane.
[0075] For example, the cross shape can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.12 to SEQ ID NO.15.
[0076] SEQ ID NO. 12: TCTAACACCATCGGTTGATTGGCGCGCGCTTTAACCGCGCG.
[0077] SEQ ID NO. 13: TAACTAATAAGCGTGTTAGACCAATCAACCGATGGTGTTAG.
[0078] SEQ ID NO. 14: TAGCGCATGGGTATCCACGGTGTCTAACACGCTTATTAGTT.
[0079] SEQ ID NO. 15: TCGCGCGGTTAAAGCGCGCGCACCGTGGATACCCCATGCGCT.
[0080] Preferably, the method for preparing the quadrilateral includes: annealing four single-stranded DNA strands to form four complementary base pairing regions, wherein the four complementary base pairing regions are the four sides of the quadrilateral.
[0081] For example, the quadrilateral can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.16 to SEQ ID NO.19.
[0082] SEQ ID NO. 16: CTAACACCATCGGTTGATTGTTTGCGCGCGCTTTAACCGCGCG.
[0083] SEQ ID NO. 17: AACTAATAAGCGTGTTAGACTTTAGCGCATGGGTATCCACGGT.
[0084] SEQ ID NO. 18: GTCTAACACGCTTATTAGTTTTTCGCGCGGTTAAAGCGCGCGC.
[0085] SEQ ID NO. 19: CAATCAACCGATGGTGTTAGTTTACCGTGGATACCCCATGCGCT.
[0086] Preferably, the method for preparing the pyramid shape includes: annealing five single-stranded DNA strands to form eight complementary base pairing regions, wherein the eight complementary base pairing regions are the eight sides of a quadrangular pyramid.
[0087] For example, the pyramid shape can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.20 to SEQ ID NO.24.
[0088] SEQ ID NO. 20: CTAACTACCATCGGTTGATTGTAACTAATAAGCGTGTTAGCGCATGGGTATCCTTAGACACGGT.
[0089] SEQ ID NO. 21: GTTGCCTTCTTCTGCTATAAGTAAGGACTGTTGTTAGACCGTGTCTA.
[0090] SEQ ID NO. 22: TATGTCCAAGATCCATGCAGAAGAAGGCAACTGGATACCCCATGCGCT.
[0091] SEQ ID NO. 23: AATGACAGAGCGATGTTGGATCTTGGACATATACACGCTTATTAGTT.
[0092] SEQ ID NO. 24: ACAGTCCTTACTTATTCATCGCTCTGTCATTTCAATCAACCGATGGT.
[0093] Preferably, the method for preparing the triangular prism includes: annealing five single-stranded DNA strands to form nine complementary base pairing regions, wherein the nine complementary base pairing regions are the nine sides of the triangular prism.
[0094] For example, the triangular prism shape can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.25 to SEQ ID NO.29.
[0095] SEQ ID NO. 25: CTAACTAGACACGGTACCATCGGTTGATTTAACTAATAAGCGTGTAGCGCATGGGTATC.
[0096] SEQ ID NO. 26: TGGATCTTGGACATTGTTGCCTTCTTCTGTCCGTGTCTAGTTAGTAATGACAGAGCGAT.
[0097] SEQ ID NO. 27: CACGCTTATTAGTTTCAGTCCTTACTTATTATGTCCAAGATCCATTACCGCAGCTTGTA.
[0098] SEQ ID NO. 28: CAGAAGAAGGCAACTATAAGTAAGGACTGTAATCAACCGATGGT.
[0099] SEQ ID NO. 29: GATACCCATGCGCTTTACAAGCTGCGGTATATCGCTCTGTCATT.
[0100] Preferably, the method for preparing the tetrahedral shape includes: annealing four single-stranded DNA strands to form six complementary base pairing regions, wherein the six complementary base pairing regions are the six edges of the tetrahedron.
[0101] Preferably, the six complementary base pairing regions are of equal length, with a length ≥15bp and ≤40bp (e.g., they can be 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, 22bp, 24bp, 26bp, 28bp, 30bp, 32bp, 34bp, 36bp, 38bp, or 40bp, etc.).
[0102] For example, a tetrahedral shape with an arm length of 15 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.30 to SEQ ID NO.33.
[0103] SEQ ID NO. 30: ACTAACACCATCGGTTAGCGCGCGCTTTAACCAAACTAATAAGCGTGT.
[0104] SEQ ID NO. 31: AAACCGATGGTGTTAGAAGCGCATGGGTATCCAGTTGCCTTCTTCTGC.
[0105] SEQ ID NO. 32: AATAAGTAAGGACTGTAGGTTAAAGCGCGCGCAGCAGAAGAAGGCAAC.
[0106] SEQ ID NO. 33: AACAGTCCTTACTTATAGGATACCCCATGCGCTAACACGCTTATTAGTT.
[0107] For example, a tetrahedral shape with an arm length of 18 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.34 to SEQ ID NO.37.
[0108] SEQ ID NO. 34: ACTAACACCATCGGTTGATAGCGCGCGCTTTAACCGCGAAACTAATAAGCGTGTTAG.
[0109] SEQ ID NO. 35: AATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGAGTTGCCTTCTTCTGCGGC.
[0110] SEQ ID NO. 36: AATAAGTAAGGACTGTGTGACGCGGTTAAAGCGCGCGCAGCCGCAGAAGAAGGCAAC.
[0111] SEQ ID NO. 37: ACACACAGTCCTTACTTATACGTGGATACCCATGCGCTACTAACACGCTTATTAGTT.
[0112] For example, a tetrahedral shape with an arm length of 20 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.66 to SEQ ID NO.69.
[0113] SEQ ID NO. 66: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.
[0114] SEQ ID NO. 67: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.
[0115] SEQ ID NO. 68: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAAC.
[0116] SEQ ID NO. 69: ACGCACACAGTCCTTACTTATAACCGTGGATACCCCATGCGCTAGTCTAACACGCTTATTAGTT.
[0117] For example, a tetrahedral shape with an arm length of 25 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.38 to SEQ ID NO.41.
[0118] SEQ ID NO. 38: ACTAACACCATCGGTTGATTGCTCCCAGCGCGCGCTTTAACCGCGCGGAGATAAACTAATAAGCGTGTTAGACCATAA.
[0119] SEQ ID NO. 39: AGGGAGCAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTACCTAAGTTGCCTTCTTCTGCGGCTCGATTA.
[0120] SEQ ID NO. 40: AATAAGTAAGGACTGTGTGCGGATCGAATCTCCGCGCGGTTAAAGCGCGCGCATAATCGAGCCGCAGAAGAAGGCAAC.
[0121] SEQ ID NO. 41: ACGATCCGCACACAGTCCTTACTTATATAGGTACCGTGGATACCCCATGCGCTATTATGGTCTAACACGCTTATTAGTT.
[0122] For example, a tetrahedral shape with an arm length of 32 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.42 to SEQ ID NO.45.
[0123] SEQ ID NO. 42: ACTAACACCATCGGTTGATTGCTCCCAACCGGGAGCGCGCGCTTTAACCGCGCGGAGATATGGACCAAACTAATAAGCGTGTTAGACCATAATAGATAG.
[0124] SEQ ID NO. 43: ACCGGTTGGGAGCAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTGGCTCAGGACAGAGTTGCCTTCTTCTGCGGCTCGGCGCTTACAGA.
[0125] SEQ ID NO.44: AATAAGTAAGGACTGTGTGCGGGTTGGCACAGAAGGTCCATATCTCCGCGCGGTTAAAGCGCGCGCATCTGTAAGCGCCGAGCCGCAGAAGAAGGCAAC。
[0126] SEQ ID NO.45: ATCTGTGCCAACCCGCACACAGTCCTTACTTATACTGTCCTGAGCCACCGTGGATACCCATGCGCTACTATCTATTATGGTCTAACACGCTTATTAGTT。
[0127] For example, a regular tetrahedron with an arm length of 40 bp can be prepared from single-stranded DNA shown by nucleic acid sequences such as SEQ ID NO.46 to SEQ ID NO.49.
[0128] SEQ ID NO.46: ACTAACACCATCGGTTGATTGCTCCCAACCGGGGCCCTCTCAGCGCGCGCTTTAACCGCGCGGAGATATGGACCCATTGAACAAACTAATAAGCGTGTTAGACCATAATAGATAGCCGCTCT T。
[0129] SEQ ID NO.47: AGAGAGGGCCCCGGTTGGGAGCAATCAACCGATGGTGTTAGAAGCGCATGGGT ATCCACGGTGGCTCAGGACAGAGGACCTAAGTTGCCTTCTTCTGCGGCTCGGCGCTTACAGATTACTG CA。
[0130] SEQ ID NO.48: AATAAGTAAGGACTGTGTGCGGGTTGGCACAGAGAGGGGCTAGTTCAATGGGT CCATATCTCCGCGCGGTTAAAGCGCGCGCATGCAGTAATCTGTAAGCGCCGAGCCGCAGAAGAAGGC AAC。
[0131] SEQ ID NO.49: AAGCCCCTCTCTGTGCCAACCCGCACACAGTCCTTACTTATATAGGTCCTCTGTCCTGAGCCACCGTGGATACCCATGCGCTAAAGAGCGGCTATCTATTATGGTCTAACACGCTTATTAGTT。
[0132] Preferably, the dangling chain at the unpaired base end contains at least two, including at least one G base, and the length of the unpaired base end is ≥2nt, for example, it can be 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 36, 37, 38, 39, 40, 41 or 42nt, etc.
[0133] Preferably, the method for preparing the tetrahedral shape of the pendant bases includes: annealing four single-stranded DNA strands to form six complementary base pairing regions, wherein the six complementary base pairing regions are the six sides of a tetrahedron.
[0134] Preferably, the length of the six complementary base pairing regions is ≥15bp and ≤40bp.
[0135] For example, a tetrahedron containing eight GGG base dangling strands can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.129 to SEQ ID NO.132.
[0136] Preferably, the six complementary base pairing regions are of unequal length, and at least one complementary base pairing region has a length ≥15bp and ≤40bp (e.g., it can be 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, 22bp, 24bp, 26bp, 28bp, 30bp, 32bp, 34bp, 36bp, 38bp, or 40bp, etc.).
[0137] For example, a non-tetrahedron with one arm length of 10 bp and the other five arms length of 20 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.50 to SEQ ID NO.53.
[0138] SEQ ID NO. 50: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAG.
[0139] SEQ ID NO. 51: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.
[0140] SEQ ID NO. 52: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAAC.
[0141] SEQ ID NO. 53: ACGCACACAGTCCTTACTTATAACCGTGGATACCCCATGCGCTACTTATTAGTT.
[0142] Preferably, the six complementary base pairing regions are of unequal length, each ≥15bp and ≤40bp (e.g., they can be 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, 22bp, 24bp, 26bp, 28bp, 30bp, 32bp, 34bp, 36bp, 38bp, or 40bp, etc.).
[0143] For example, a non-tetrahedron with three arms of 15 bp and the other three arms of 20 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.54 to SEQ ID NO.57.
[0144] SEQ ID NO. 54: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.
[0145] SEQ ID NO. 55: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCAGTTGCCTTCTTCTGC.
[0146] SEQ ID NO. 56: AATAAGTAAGGACTGTACGCGCGGTTAAAGCGCGCGCAGCAGAAGAAGGCAA C.
[0147] SEQ ID NO. 57: AACAGTCCTTACTTATAGGATACCCCATGCGCTAGTCTAACACGCTTATTAGTT.
[0148] For example, a non-tetrahedron with three arms of 25 bp and the other three arms of 20 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.58 to SEQ ID NO.61.
[0149] SEQ ID NO. 58: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.
[0150] SEQ ID NO. 59: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTACCTAAGTTGCCTTCTTCTGCGGCTCGATTA.
[0151] SEQ ID NO. 60: AATAAGTAAGGACTGTGTGCGGATCGACGCGCGGTTAAAGCGCGCGCATAATCGAGCCGCAGAAGAAGGCAAC.
[0152] SEQ ID NO. 61: ACGATCCGCACACAGTCCTTACTTATATAGGTACCGTGGATACCCCATGCGCTAGTCTAACACGCTTATTAGTT.
[0153] For example, a non-tetrahedron with one arm length of 30 bp and the other five arms length of 20 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.62 to SEQ ID NO.65.
[0154] SEQ ID NO. 62: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGACCTCCCAACCG.
[0155] SEQ ID NO. 63: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.
[0156] SEQ ID NO. 64: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAAC.
[0157] SEQ ID NO. 65: ACGCACACAGTCCTTACTTATAACCGTGGATACCCCATGCGCTACGGTTGGGAGGTCTAACACGCTTATTAGTT.
[0158] Preferably, the one-dimensional structure comprises two linearly tandem double-stranded DNA strands and / or three linearly tandem double-stranded DNA strands.
[0159] Preferably, the method for preparing the two linearly tandem double-stranded DNAs includes: annealing three single-stranded DNAs to form two complementary base-pairing regions.
[0160] For example, two linearly tandem double-stranded DNAs with a single strand length of 2nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.91 to SEQ ID NO.93.
[0161] For example, two linearly tandem double-stranded DNAs with a single strand length of 5 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, and 94.
[0162] For example, two linearly tandem double-stranded DNAs with a single strand length of 10 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, and 95.
[0163] For example, two linearly tandem double-stranded DNAs with a single strand length of 20 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, and 96.
[0164] For example, two linearly tandem double-stranded DNAs with a single-strand length of 40 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, and 97.
[0165] Preferably, the method for preparing the three linearly tandem double-stranded DNAs includes: annealing four single-stranded DNAs to form three complementary base pairing regions.
[0166] For example, a single-stranded DNA with a length of 2nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, 98, 99.
[0167] For example, a double-stranded DNA with a length of 2T can be prepared from a single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, 99, 100.
[0168] For example, a single-stranded DNA with a length of 10 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, 99, 101.
[0169] For example, a single-stranded DNA with a length of 10T can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, 99, 102.
[0170] Preferably, the method for preparing the parallel structure includes: annealing two single-stranded DNAs to form two complementary base pairing regions, wherein the two complementary base pairing regions do not intersect in a plane.
[0171] For example, a parallel structure of single-stranded DNA with a length of 3nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.103~SEQ ID NO.104.
[0172] For example, a parallel structure of single-stranded DNA with a length of 5 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.105~SEQ ID NO.106.
[0173] For example, a parallel structure with a length of 7 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.107~SEQ ID NO.108.
[0174] For example, a parallel structure with a length of 12 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.109 to SEQ ID NO.110.
[0175] For example, a parallel structure with a length of 22 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.111 to SEQ ID NO.112.
[0176] For example, a parallel structure with a length of 32 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.113 to SEQ ID NO.114.
[0177] Preferably, the method for preparing the angled structure includes: annealing two single-stranded DNAs to form two complementary base pairing regions, wherein the two complementary base pairing regions intersect at a point on a plane.
[0178] For example, a 3nt long angled structure of single-stranded DNA with non-angled ends can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.115~SEQ ID NO.116.
[0179] For example, an angled structure with a length of 5nt can be prepared from single-stranded DNA with a non-angled end, as shown in SEQ ID NO.117 to SEQ ID NO.118.
[0180] For example, a 7nt long angled structure of single-stranded DNA with non-angled ends can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.119~SEQ ID NO.120.
[0181] For example, an angled structure with a length of 12nt can be prepared from single-stranded DNA with non-angled ends, as shown in SEQ ID NO.121 to SEQ ID NO.122.
[0182] For example, an angled structure with a length of 22nt can be prepared from single-stranded DNA with non-angled ends, as shown in SEQ ID NO.123 to SEQ ID NO.124.
[0183] For example, an angled structure with a length of 32nt can be prepared from single-stranded DNA with non-angled ends, as shown in SEQ ID NO.125 to SEQ ID NO.126.
[0184] Preferably, the framework DNA with unpaired base ends comprises a double helix and / or a tetrahedral shape with dangling bases;
[0185] Preferably, the method for preparing the duplex includes: annealing two single-stranded DNA molecules to form a base-complementary pairing region.
[0186] For example, the double strand can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.1 to SEQ ID NO.2.
[0187] Preferably, the method for preparing the tetrahedral shape of the pendant bases includes: annealing four single-stranded DNA strands to form six complementary base pairing regions, wherein the six complementary base pairing regions are the six sides of a tetrahedron.
[0188] For example, a tetrahedron containing eight GGG base dangling strands can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.129 to SEQ ID NO.132.
[0189] In a second aspect, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an agonist of the cGAS-STING signaling pathway as described in the first aspect.
[0190] In this invention, the efficient entry of framework DNA into the cytoplasm is crucial for its effect. With the assistance of a carrier, the carrier type can be any of the following capable of efficient cytoplasmic delivery: cationic liposomes, micelles, nanoemulsions, lipid nanoparticles, lipid-like nanoparticles, solid lipid nanoparticles, lipid-polymer hybrid nanoparticles, exosomes, polymer nanoparticles, gold nanoparticles, etc. Furthermore, cytoplasmic delivery of framework nucleic acids can also be achieved using carrier-independent nucleic acid modification strategies. Appropriate modifications to the framework DNA, such as cholesterol modification, cholesterol conjugation, or N-acetylgalactosamine modification, can promote the entry of framework DNA into the cytoplasm and produce similar biological effects.
[0191] Preferably, the carrier comprises cationic liposomes.
[0192] In this invention, the lipid composition (cationic lipids and accessory lipids) of the cationic liposomes can be varied. The cationic lipids are not limited to DOTAP, but can also include 1,2-bis(octadecyl)oxy-3-methylammonium propane chloride (DOTMA), dimethyl di(octadecyl)ammonium bromide (DODAB), 1,2-tetracosoxypropyl-3-dimethyl-hydroxyethylammonium bromide (DMRIE), dimethyl-5-hydroxypentyl-2,3-diolenoyloxypropylammonium bromide (DORIE), didecyl dimethylammonium bromide (DDAB), and ethylphosphatidylcholine (ePC). Lipids with a permanent positive charge, such as dioleoyldimethylammonium chloride (DODAC), are included. Accessory lipids are not limited to cholesterol but also include neutral lipids such as 1,2-distearyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-bis(cis-9-oleoyl)-sn-glycerol-3-phosphate choline (DOPC), 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE), 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine (DSPE), and 2-oleoyl-1-palmitoyl-sn-glycerol-3-phosphate ethanolamine (POPE). The molar ratio of these two types of lipids can range from 5:1 to 1:5.
[0193] In this invention, the cationic liposome loaded with framework DNA (named framework DNA-LPX) is formed by mixing cationic liposomes and framework DNA. When mixing, the N / P ratio of the two can be selected as 10:1-1:10.
[0194] In this invention, the preparation method of cationic liposomes includes, but is not limited to, the membrane hydration method. Taking the membrane hydration method as an example, firstly, cationic lipids (including but not limited to N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP)) and auxiliary lipids (including but not limited to cholesterol) are dissolved separately in an organic solvent (optional solvents include, but are not limited to, anhydrous ethanol). The cationic lipid solution and the auxiliary lipid solution are mixed evenly at a molar ratio of 1:5-5:1 and transferred to a rotary evaporator. The mixture is rotary evaporated at a speed of 10-500 rpm and a temperature of 20-70°C for 10 min-24 h to obtain a lipid membrane. An appropriate amount of aqueous solution (including but not limited to water, PBS, physiological saline, 5% glucose, and 10% sucrose solution, etc.) is added to hydrate the lipid membrane, and the membrane is allowed to stand. The lipid solution was sequentially passed through filter membranes with pore sizes of 200 nm and 100 nm to adjust the particle size of the liposomes. The resulting cationic liposomes had a particle size of 100-500 nm, uniform particle distribution (PDI < 0.5), and good stability (can be stored at 4 °C for more than 1 year).
[0195] In this invention, a type of cationic liposome is prepared that can be used for in vitro and in vivo delivery of framework nucleic acids. Preferably, the cationic liposome is composed of cationic lipid DOTAP and auxiliary lipid cholesterol in a molar ratio of 1:2.
[0196] This invention prepares a specific cationic liposome-loaded framework DNA with good stability, enabling efficient delivery and exhibiting good type I interferon stimulation ability, inducing the activation of immune-related proteins such as IRF3, JAK1, STAT1, and STAT2.
[0197] Preferably, the method for preparing the vector-loaded framework DNA (named framework DNA-LPX) includes: diluting framework DNA with one-dimensional, two-dimensional or three-dimensional structures composed of different sequences to 1 mg / mL, and mixing the diluted framework DNA with cationic liposome solution at an N / P ratio of 1:5-5:1, wherein the mixing can be performed using a pipette.
[0198] Thirdly, the present invention provides a combination therapy, the combination therapy comprising a combination drug and the pharmaceutical composition described in the second aspect.
[0199] Preferably, the combined drug includes at least one of immune checkpoint inhibitors, cell therapy drugs, oncolytic viruses, chemotherapy drugs, or radiotherapy drugs.
[0200] In this invention, the combined therapeutic application of framework DNA-LPX with other therapies includes, but is not limited to, immune checkpoint inhibitors, cell therapy drugs, oncolytic viruses, chemotherapy or radiotherapy.
[0201] Combination therapy of DNA-LPX with immune checkpoint inhibitors: Combination therapy of immune checkpoint inhibitors (ICIs) such as PD-1, PD-L1 and CTLA-4 monoclonal antibodies can improve the prognosis of various tumors by blocking tumor immunosuppressive signals.
[0202] Combination therapy of DNA-LPX with cell therapy drugs: Cell therapy drugs such as chimeric antigen receptor (CAR) T cell therapy are being evaluated in combination to exert synergistic anti-cancer activity.
[0203] Combination therapy of DNA-LPX with chemotherapy: The combination of modified oncolytic adenovirus ONYX-015, cisplatin and 5-fluorouracil (5-FU) enhances the anti-tumor effect.
[0204] Combined treatment with DNA-LPX and radiotherapy: Radiotherapy combined with immunotherapy can modulate and amplify the distant effect. Radiotherapy can promote the presentation of tumor antigens by dendritic cells (DCs), and immunomodulators targeting DCs can amplify this effect, thereby promoting the generation of distant effects.
[0205] Fourthly, the present invention provides the use of the agonist of the cGAS-STING signaling pathway described in the first aspect or the pharmaceutical composition described in the second aspect in the preparation of vaccine adjuvants.
[0206] The framework DNA designed in this invention can be used as a vaccine adjuvant, which can enhance both humoral and cellular immunity. Its applications include, but are not limited to, tumor vaccines and infectious disease vaccines.
[0207] Fifthly, the present invention provides the use of an agonist of the cGAS-STING signaling pathway as described in the first aspect or a pharmaceutical composition as described in the second aspect in the preparation of an agonist of cyclic guanosine monophosphate-adenosine synthase.
[0208] In a sixth aspect, the present invention provides the use of an agonist of the cGAS-STING signaling pathway as described in the first aspect or a pharmaceutical composition as described in the second aspect in the preparation of a type I interferon synthesis agonist.
[0209] Preferably, the type I interferon includes IFN-α and / or IFN-β.
[0210] Preferably, the IFN-α includes any one or a combination of at least two of IFN-α1, IFN-α2, IFN-α4, IFN-α7, or IFN-α14.
[0211] Other specific point values within the range of the above values can be selected, and will not be elaborated on here.
[0212] Compared with the prior art, the present invention has the following beneficial effects:
[0213] (1) The framework DNA (including 1D, 2D, and 3D) provided by this invention can effectively activate cGAS by regulating the strength of cGAS phase separation through dimensional factors. The arm length is ≥15bp and ≤40bp. It can be used as an agonist of the cGAS-STING signaling pathway. It has a stronger cGAS binding ability than existing commercial agonists. By promoting dimerization and LLPS, the highly concentrated cGAS accelerates cGAMP synthesis and enhances the generation of type I interferon downstream of the cGAS-STING signaling pathway.
[0214] (2) The 1D, 2D and 3D framework DNA provided by the present invention are relatively uniform in size and morphology, have strong stability, can be any kind of framework DNA with 2D or 3D structure, and the sequence composition can be random sequence, with great assembly accessibility and multiple application prospects.
[0215] (3) The present invention relates to specific vectors loaded with 1D, 2D and 3D framework DNA with good stability, which can achieve efficient delivery and can be further applied to the preparation of combination therapy drugs and vaccine adjuvants, etc. Attached Figure Description
[0216] Figure 1 This is a structural diagram of the framework DNA prepared in Example 1;
[0217] Figure 2 This is a diagram illustrating the formation process of the framework DNA 3WJ, Tr, Cr, Qu, Py, and Tp in Example 1.
[0218] Figure 3 This is a diagram illustrating the formation process of the framework DNA TDN in Example 2;
[0219] Figure 4 Figure 2 shows the results of atomic force microscopy and dynamic light scattering analysis of TDN in Example 2;
[0220] Figure 5 The above figures show the IFN-β content in the supernatant of RAW 264.7 cells after transfection with framework DNA in Example 2. Figure A shows the IFN-β content in the supernatant of RAW 264.7 cells after transfection with different types of TDN, and Figure B shows the IFN-β content in the supernatant of RAW 264.7 cells after transfection with TDN and its corresponding assembly unit.
[0221] Figure 6 The graph shows the IFN-β content in the supernatant after transfecting different types of RAW 264.7 cells with framework DNA in Example 3.
[0222] Figure 7 This is a graph showing the IFN-β content in the supernatant after transfecting THP-1 cells with framework DNA in Example 4.
[0223] Figure 8 This is a graph showing the IFN-β content in the supernatant after transfecting BMDC cells with framework DNA in Example 4.
[0224] Figure 9 This is a graph showing the IFN-α1 content in the supernatant after transfection of BMDC cells with framework DNA in Example 4.
[0225] Figure 10 This is a graph showing the cGAMP content generated by the activation of cGAS by the framework DNA in Example 5.
[0226] Figure 11 This is a phase separation droplet diagram of the framework DNA and cGAS mixture in Example 6;
[0227] Figure 12 This is a phase separation diagram of different concentrations of framework DNA mixed with cGAS in Example 7;
[0228] Figure 13 This is a representative live cell image of cGAS-DNA spots obtained by confocal microscopy after transfecting GFP-cGAS-reconstructed cGAS-knockout MEF cells with framework DNA from Example 8.
[0229] Figure 14 This is a graph showing the statistical results of the number of spots per 100 cells in Example 8;
[0230] Figure 15 Figure showing the results of cGAS activation by DNA with different dsDNA-2S frameworks;
[0231] Figure 16 Figure showing the results of cGAS activation for DNA with different dsDNA-3S frameworks;
[0232] Figure 17 A comparison of cGAS activation results between dsDNA-2S framework DNA and dsDNA-3S framework DNA.
[0233] Figure 18 Figure showing the results of cGAS activation by DNA from different Qu-2S frameworks;
[0234] Figure 19 Figure showing the results of cGAS activation by DNA from different Tr-2S frameworks;
[0235] Figure 20 Graphs showing the results of cGAS activation for DNA with different nTDN frameworks;
[0236] Figure 21 A diagram showing the results of cGAS activation in framework DNA with unpaired base ends;
[0237] Figure 22Figures showing the hydration particle size, polydispersity index, and changes over time for cationic liposomes with different lipid compositions (lipid types and molar ratios);
[0238] Figure 23 The surface potential of cationic liposomes with different lipid compositions (lipid types and molar ratios) and their changes over time are shown in the figure.
[0239] Figure 24 The graph shows the stability results of cationic liposomes (DOTAP / cholesterol, molar ratio 1:2);
[0240] Figure 25 The surface morphology of cationic liposomes (DOTAP / cholesterol, molar ratio 1:2) is shown.
[0241] Figure 26 The hydration size, polydispersity index, and surface potential of framework DNA-LPX were prepared for two types of cationic liposomes and framework DNA. Figure A shows the hydration size and polydispersity index of DOTAP / cholesterol (1:2), Figure B shows the surface potential of DOTAP / cholesterol (1:2), Figure C shows the hydration size and polydispersity index of DOTAP / DOPE (1:2), and Figure D shows the surface potential of DOTAP / DOPE (1:2).
[0242] Figure 27 The stability results of framework DNA-LPX formed by mixing cationic liposomes (DOTAP / cholesterol, molar ratio 1:2) and framework DNA at N / P = 1:1.6 are shown in the figure.
[0243] Figure 28 The surface morphology of framework DNA-LPX is shown in the image. This is formed by mixing cationic liposomes (DOTAP / cholesterol, molar ratio 1:2) with framework DNA at an N / P ratio of 1:1.6.
[0244] Figure 29A Figure 1 shows the results of type I interferon stimulation assays on two-dimensional and three-dimensional framework DNA.
[0245] Figure 29B Figure 1 shows the comparison results of type I interferon induced by framework DNA of different dimensions (one-dimensional, two-dimensional and three-dimensional). Figure 2a shows the structural diagram of several different framework DNAs, Figure 3b shows the amount of IFNβ secreted by BMDC cells after stimulation by framework DNA of different dimensions, Figure 4c shows the amount of IFNα1 secreted by BMDC cells after stimulation by framework DNA of different dimensions, and Figure 5d shows the amount of IFNβ secreted by THP-1 cells after stimulation by framework DNA of different dimensions.
[0246] Figure 29CThis figure shows the comparison results of framework DNA with unpaired base ends and poly(dA:dT) in inducing type I interferon.
[0247] Figure 29D A comparison of the results of type I interferon induced by framework DNA composed of different sequences;
[0248] Figure 30 Figure 1 shows the results of type I interferon response induced by cationic liposomes with different lipid compositions after delivering framework DNA into RAW-LuciaISG immune cells.
[0249] Figure 31 The results of type I interferon response induced after adding different framework DNA-LPX to RAW-Lucia ISG immune cells;
[0250] Figure 32 The diagram shows the activation results of immune-related proteins such as IRF3, JAK1, STAT1, and STAT2 induced by framework DNA.
[0251] Figure 33 Figure showing the results of in vivo induction of serum type I interferon levels by framework DNA-LPX;
[0252] Figure 34 Figure showing the antibody titer results in vivo 22 days after induction of the framework DNA-LPX group;
[0253] Figure 35 Figure 1 shows the in vivo antibody titer results for the framework DNA-LPX group induced by injection 22 and 29 days ago;
[0254] Figure 36 This is a graph showing the tumor weight results after treatment with vaccines containing different framework DNA-LPX adjuvants in the B16-OVA subcutaneous tumor model.
[0255] Figure 37 The graphs show the tumor growth inhibition effects of vaccines containing different adjuvants in the B16-OVA subcutaneous tumor model. Graphs a and b are tumor growth curves, and graph c is the tumor volume.
[0256] Figure 38 The figures show the activation effects of vaccines containing different adjuvants on T cells in a B16-OVA subcutaneous tumor model. Figure a shows the content of immune cells within the tumor, figure b shows the content of T cells within the tumor, and figure c shows the antigen-specific IFNγ in the spleen. + The proportion of T cells. Detailed Implementation
[0257] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.
[0258] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0259] Reagents:
[0260] CpG and DNA strands were synthesized by Sangon Biotechnology. Dulbecco modified Eagle medium (DMEM; catalog 319-005-CL), fetal bovine serum (FBS; catalog 085-150), and RPMI 1640 medium (catalog C11875500BT) were purchased from Wisent Bio Products. H-151 (catalog inh-h151), poly(dA:dT) (catalog tlrl-patn-1), and luciferase assay kit (catalog rep-qlc4lg1) were supplied by Invivogen. G150 (catalog HY-128583), acyclovir (catalog HY-17422), oseltamivir (catalog HY-13317), and ribavirin (catalog HY-B0434) were supplied by MedChemExpress. Lipo2000 (catalog 11668019) was purchased from Thermo Scientific. Human IFNβ ELISA kit (catalog number DY814-05) was provided by R&D Systems. Mouse IFNα1 ELISA kit (catalog number 447904), purified anti-mouse IFNβ (catalog number 519202), biotinylated anti-mouse IFNβ (catalog number 508105), and recombinant mouse IFNβ (catalog number 581309) were provided by Biolegend. GM-CSF (catalog number 51048-MNAH) and IL-4 (catalog number 51084-MNAE) were purchased from Sino Biological. 2-Mercaptoethanol, cholesterol, and DOTAP were purchased from Sigma.
[0261] cell:
[0262] RAW 264.7, THP-1, A549, and Vero cells were obtained from the Cell Resource Center of Peking Union Medical College. RAW-Lucia ISG cells were donated by Dr. Xueguang Lü from the Institute of Chemistry, Chinese Academy of Sciences. RAW 264.7, Vero, A549, and RAW-Lucia ISG cells were cultured in DMEM medium containing 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 μg / mL streptomycin. THP-1 cells were maintained in RPMI 1640 medium containing 10% FBS, 100 U / mL penicillin, 100 μg / mL streptomycin, and 50 μM 2-mercaptoethanol. All cells were cultured in a humidified incubator at 37°C and 5% CO2, and the results showed no mycoplasma contamination.
[0263] Bone marrow cells (BMDCs) were obtained from 6-8 week old female C57BL / 6 mice. Briefly, bone marrow cells were flushed from the tibia and femur of C57BL / 6 mice and cultured in RPMI 1640 medium containing 10% FBS, 100 U / mL penicillin, 100 μg / mL streptomycin, 20 ng / mL GM-CSF, and 10 ng / mL IL-4. Half of the medium was replaced every 2 days. On day 6, non-adherent and loosely adherent immature dendritic cells were collected for further experiments.
[0264] Mice:
[0265] C57BL / 6 and BALB / c mice (female, 6-8 weeks old) were purchased from Vital River. They were housed in specific pathogen-free and environmentally controlled animal enclosures (temperature 22±2℃, humidity 40-70%, 12-hour light / dark cycle) with free access to food and water.
[0266] Example 1
[0267] This embodiment prepared a framework DNA. The preparation method includes the following steps: an equimolar mixture of raw single-stranded DNA was added to TM buffer (10-40 mM Tris HCl pH 7.5-8.0, 2-5 mM MgCl2). The mixture was vortexed thoroughly to ensure complete mixing. Annealing was performed using a PCR thermal cycler. The annealing program was 90-95℃ for 10-20 min, followed by cooling to 2-4℃ for 20-30 min. The mixture was then stored at -20℃ for later use. The obtained framework DNA with a 2D or 3D structure is shown below. Figure 1 As shown, the formation process of the framework DNA was analyzed using gel electrophoresis, including the formation processes of 3WJ, Tr, Cr, Qu, Py, and Tp. Figure 2 As shown.
[0268] The structure of 1D overframe DNA is as follows: dsDNA-2S consists of three single-stranded DNA molecules that have annealed to form two complementary base pairing regions. Between these complementary base pairing regions, there are also free regions of single-stranded DNA that have not been paired with any bases. dsDNA-3S consists of four single-stranded DNA molecules that have annealed to form three complementary base pairing regions. Between these complementary base pairing regions, there are also free regions of single-stranded DNA that have not been paired with any bases.
[0269] Based on the distance between the linearly tandem double-stranded DNAs in the 1D structure (the length of the single-stranded DNA linking the two strands), dsDNA-2S is further divided into dsDNA-2S-2nt, dsDNA-2S-5nt, dsDNA-2S-10nt, dsDNA-2S-20nt, and dsDNA-2S-40nt. Taking dsDNA-2S-2nt as an example, 2S refers to two double-stranded DNAs, and 2nt refers to the length of the single-stranded DNA linking the two double-stranded DNAs being 2nt (random bases), and so on. All one-dimensional DNA structures, parallel DNA structures, and angled DNA structures mentioned in the text adopt this naming method. dsDNA-3S is further divided into dsDNA-3S-2nt, dsDNA-3S-2T, dsDNA-3S-10nt, and dsDNA-3S-10T, where 2T refers to the length of the single-stranded DNA linking the two double-stranded DNAs being 2 T bases, and so on.
[0270] The structures of framework DNA with 2D structures are as follows: QU-2S consists of two complementary base-pairing regions formed after annealing two single-stranded DNA molecules, located on the same plane and not intersecting; Tr-2S consists of two complementary base-pairing regions formed after annealing two single-stranded DNA molecules, located on the same plane and intersecting at a single point, which is the endpoint of the two complementary base-pairing regions; ab consists of one complementary base-pairing region formed after annealing two single-stranded DNA molecules, and outside the complementary base-pairing region, the single-stranded DNA also has free regions that are not complementary to any bases; Circ consists of one complementary base-pairing region formed after annealing two single-stranded DNA molecules; abc consists of three complementary base-pairing regions formed after annealing three single-stranded DNA molecules, spatially adjacent to each other. The three complementary base pairing regions (C, Q, and Q) intersect at a single point, which is the endpoint of the three complementary base pairing regions, and the three complementary base pairing regions are not coplanar; 3WJ represents three complementary base pairing regions formed after annealing three single-stranded DNA strands, located on the same plane and intersecting at a single point, which is the endpoint of the three complementary base pairing regions; Tr represents three complementary base pairing regions formed after annealing three single-stranded DNA strands, which are the three sides of a triangle, forming a triangle; Cr represents four complementary base pairing regions formed after annealing four single-stranded DNA strands, located on the same plane and intersecting at a single point, which is the endpoint of the four complementary base pairing regions; Qu represents four complementary base pairing regions formed after annealing four single-stranded DNA strands, which are the four sides of a quadrilateral, forming a quadrilateral.
[0271] Specifically, Qu-2S includes Qu-2S-3nt, Qu-2S-5nt, Qu-2S-7nt, Qu-2S-12nt, Qu-2S-22nt, Qu-2S-32nt, and Qu-2S-42nt. Tr-2S includes Tr-2S-3nt, Tr-2S-5nt, Tr-2S-7nt, Tr-2S-12nt, Tr-2S-22nt, and Tr-2S-32nt, with the single-stranded DNA at the corner end being 1nt in length, and the single-stranded DNA at the non-corner end being 3nt, 5nt, 7nt, 12nt, 22nt, and 32nt in length, respectively.
[0272] The structure of a 3D framework DNA is as follows: Py consists of five single-stranded DNA molecules that, after annealing, form eight complementary base pairing regions, which are the eight sides of a square pyramid, forming a square pyramid structure; Tp consists of five single-stranded DNA molecules that, after annealing, form nine complementary base pairing regions, which are the nine sides of a triangular prism, forming a triangular prism structure; TDN consists of four single-stranded DNA molecules that, after annealing, form six complementary base pairing regions, which are the six sides of a tetrahedron, forming a tetrahedral structure.
[0273] The TDN can be a regular tetrahedron with equal side lengths, meaning all six arms are of equal length, each ≥15bp and ≤40bp. Alternatively, it can be a tetrahedron containing unpaired dangling chains (G...).n -TDN-G n It must contain at least two dangling strands, each containing at least one G base, with an unpaired base terminus of ≥2nt length. It can also be a non-tetrahedral DNA (nTDN) with varying side lengths, with at least one arm ≥15bp and ≤40bp in length. For example, it could be one arm of 10bp and the other five arms of 20bp, one arm of 30bp and the other five arms of 20bp, three arms of 15bp and the other three arms of 20bp, or three arms of 25bp and the other three arms of 20bp. Specifically, nTDN includes nTDN-29-10bp, nTDN-47-25bp, nTDN-84-15bp, and nTDN-97-30bp, which are non-tetrahedral DNA with five arms of 20bp and one arm of 10bp, 15bp, 25bp, or 30bp respectively.
[0274] DNA with unpaired base ends can be a diploid (ab), which is a 43nt long single-stranded DNA with unpaired base ends at both ends of a double strand.
[0275] Example 2
[0276] This embodiment determined the ability of randomly sequenced dsDNA to stimulate IFN-β secretion through preliminary experiments. dsDNA sequences with high and low IFN-β secretion levels were selected for constructing TDNs, resulting in three highly active dsDNA-assembled TDNs (HT, named HT1, HT2, and HT3) and three low-activity dsDNA-assembled TDNs (LT, named LT1, LT2, and LT3). The preparation process followed that in Example 1, and the TDN formation process was analyzed by gel electrophoresis. The results are as follows. Figure 3 As shown.
[0277] HT 1 is a tetrahedral framework DNA with an arm length of 20 bp prepared from the single-stranded DNA shown in SEQ ID NO.66 to SEQ ID NO.69.
[0278] SEQ ID NO. 66: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.
[0279] SEQ ID NO. 67: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.
[0280] SEQ ID NO. 68: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAAC.
[0281] SEQ ID NO. 69: ACGCACACAGTCCTTACTTATAACCGTGGATACCCCATGCGCTAGTCTAACACGCTTATTAGTT.
[0282] HT 2 is a tetrahedral framework DNA with an arm length of 20 bp prepared from the single-stranded DNA shown in SEQ ID NO.70 to SEQ ID NO.73.
[0283] SEQ ID NO. 70: CTCCCAACCGGGGCCCTCTCAGAGATATGGACCCATTGAACACATAATAGATAGCCGCTCTTA.
[0284] SEQ ID NO. 71: GGCTCAGGACAGAGGACCTAAGTTCAATGGGTCCATATCTCAGGCGCTTACAGATTACTGCAA.
[0285] SEQ ID NO. 72: GAGAGGGCCCCGGTTGGGAGAGGTTGGCACAGAGAGGGGCTATGCAGTAATCTGTAAGCGCCA.
[0286] SEQ ID NO. 73: TAGGTCCTCTGTCCTGAGCCAAGCCCCTCTCTGTGCCAACCAAAGAGCGGCTATCTATTATGA.
[0287] HT 3 is a tetrahedral framework DNA with an arm length of 20 bp, prepared from the single-stranded DNA shown in SEQ ID NO.74 to SEQ ID NO.77.
[0288] SEQ ID NO. 74: AAAGGGAAAGGGAAAGGGAAAAGCACGCGCCTTTAGCTTGCGACCTTTCTGACTCATGCTCGC.
[0289] SEQ ID NO. 75: ATTCCCTTTCCCTTTCCCTTAGCACGCGCCTTTCGCTTGCGAGATCGGTTGGTGCGCAAGAA.
[0290] SEQ ID NO. 76: ACGGGCAGTGACTTATTCGTGACGCAAGCGAAAGGCGCGTGCAGCGAGCATGASEQ ID NO. 77: ACACGAATAAGTCACTGCCCGACGCAAGCTAAAGGCGCGTGCATTCTTGCGCACCAACCGATC.
[0291] LT 1 is a tetrahedral framework DNA with an arm length of 20 bp prepared from the single-stranded DNA shown in SEQ ID NO.78 to SEQ ID NO.81.
[0292] SEQ ID NO. 78: ACGATAGGTAAAAATATATGCAGTATTTACCTATTTCTATCGATACCCATTTAACCGTTAAGG.
[0293] SEQ ID NO. 79: AGCATATATTTTACCTATCGATCACCGAGGCGGTCGAGGATAGCACACACCTATCGCTTTCG.
[0294] SEQ ID NO. 80: ACCACCGGCTCGTCACCGTATAATCCTCGACCGCCTCGGTGAACCTTAACGGTTAAATGGGTA.
[0295] SEQ ID NO. 81: AATACGGTGACGAGCCGGTGGACGATAGAAATAGGTAAATACACGAAAGCGATAGGTGTGTGC.
[0296] LT 2 is a tetrahedral framework DNA with an arm length of 20 bp prepared from the single-stranded DNA shown in SEQ ID NO.82 to SEQ ID NO.85.
[0297] SEQ ID NO. 82: AACCGGAGACCCGTGAGTCTTAACGCCGATATGGATAATATTAGCACACACCTTTCGCTTTCG.
[0298] SEQ ID NO. 83: AAAGACTCACGGGTCTCCGGTAGAGGCTCAGTGAGCTTCTGAAGTATATACCTATTTCTATCG.
[0299] SEQ ID NO. 84: ACTTAACCCGTAAATGGGTAATCAGAAGCTCACTGAGCCTCACGAAAGCGAAAGGTGTGTGC.
[0300] SEQ ID NO. 85: ATACCCATTTACGGGTTAAGGAAATATTATCCATATCGGCGTACGATAGAAATAGGTATATAC.
[0301] LT 3 is a tetrahedral framework DNA with an arm length of 20 bp prepared from the single-stranded DNA shown in SEQ ID NO.86 to SEQ ID NO.89.
[0302] SEQ ID NO. 86: ATCGCTTCGAATCTATACGAGAATGCCTATTAGCCTTGAACGAGCACACTCCTTTAGCTATCG.
[0303] SEQ ID NO. 87: ACTCGTATAGATTCGAAGCGAACGACACGGCGCTAAATATATAGACTTAGCAGTACCTCTACG.
[0304] SEQ ID NO. 88: ACGATAGCGAAAGGAGTGTGCAATATATTTAGCGCCGTGTCGACGATAGCTAAAGGAGTGTGC.
[0305] SEQ ID NO. 89: AGCACACTCCTTTCGCTATCGACGTTCAAGGCTAATAGGCATACGTAGAGGTACTGCTAAGTC.
[0306] The morphology and size of each HT and LT were analyzed using atomic force microscopy (AFM) and dynamic light scattering (DLS), such as... Figure 4 As shown, the generated TDNs have relatively uniform size and morphology.
[0307] RAW 264.7 cells were transfected with HT 1, HT 2, HT 3, LT 1, LT 2, and LT 3 at concentrations of 2 μg / mL, with the commercially available agonist Poly(dA:dT) as a control. The IFN-β content in the supernatant was detected by ELISA after 24 hours. Results are as follows: Figure 5As shown in Figure A, the TDN prepared in this invention has a better ability to stimulate IFN-β synthesis. RAW264.7 cells were transfected with HT and LT at a concentration of 2 μg / mL and their corresponding assembly units (HT dsDNA mixture and LT dsDNA mixture). The IFN-β content in the supernatant was detected by ELISA after 24 h. The results are as follows... Figure 5 As shown in Figure B, the ability of dsDNA to stimulate IFN-β synthesis is significantly enhanced after assembling into TDN. Furthermore, Figure 5 This study demonstrated that the activation ability of TDN is independent of the nucleic acid sequence. In the dsDNA mixture, the activation ability of the HTs dsDNA mixture was significantly higher than that of the LTs dsDNA mixture, while there was no significant difference between HT and LT after the formation of TDN.
[0308] Example 3
[0309] In this example, four different types of RAW 264.7 cells (wild-type WT, cGAS, and Tr) were transfected with 3WJ, Tr, Cr, Qu, Py, Tp at a concentration of 2 μg / mL and TDN with an arm length of 20 bp. - / - Sting - / - and Tlr 9 - / - The framework DNA preparation process was performed according to Example 1. The control groups included commercially available cGAS agonist HT DNA (a natural double-stranded DNA sequence derived from herring testes) and G3-YSD (HIV-1-derived GGG-terminated Y-type 26-mer DNA), and the experimental group included dsDNA mix (HTdsDNA mixture from Example 2). After 24 hours, the IFN-β content in the supernatant was detected using ELISA. Results are as follows: Figure 6 As shown, framework DNA can increase the IFN-β content in the supernatant. When cGAS or Sting is missing, the IFN-β content in the supernatant does not change because the cGAS-STING signaling pathway is blocked. When Tlr9 is missing, framework DNA can increase the IFN-β content in the supernatant, which proves that framework DNA does not promote the secretion of IFN-β by immune cells through TLR9, but rather increases the IFN-β content in the supernatant by activating the cGAS-STING signaling pathway.
[0310] Example 4
[0311] In this embodiment, THP-1 cells were transfected with TDN, 3WJ, Tr, Cr, Qu, ab, and abc at a concentration of 2 μg / mL. The framework DNA preparation process was carried out in accordance with Example 1. Blank cells and commercial cGAS agonist G3-YSD were used as control groups. The IFN-β content in the supernatant was detected by ELISA after 24 h. Among them, the 10bp nTDN is a non-tetrahedron with one arm of length 10bp and the other five arms of length 20bp; the 15bp nTDN is a non-tetrahedron with three arms of length 15bp and the other three arms of length 20bp; the 25bp nTDN is a non-tetrahedron with three arms of length 25bp and the other three arms of length 20bp; the 30bp nTDN is a non-tetrahedron with one arm of length 30bp and the other five arms of length 20bp; and the 7bp TDN, 15bp TDN, 18bp TDN, 20bp TDN, 25bp TDN, 32bp TDN, and 40bp TDN are regular tetrahedrons with arm lengths of 7bp, 15bp, 18bp, 20bp, 25bp, 32bp, and 40bp, respectively. The results are as follows: Figure 7 As shown, at least one framework DNA with an arm length ≥15bp and ≤40bp provided by the present invention has the ability to increase IFN-β content.
[0312] In this embodiment, BMDC cells were transfected with TDN, 3WJ, Tr, Cr, Qu, ab, and abc at a concentration of 2 μg / mL. The framework DNA preparation process followed that in Example 1. HT DNA, the commercial agonist Poly(dA:dT), and G3-YSD were used as control groups. After 24 hours, the levels of IFN-β and IFN-α1 in the supernatant were detected using ELISA. The 7bp, 15bp, 20bp, and 25bp TDNs were tetrahedral with arm lengths of 7bp, 15bp, 20bp, and 25bp, respectively. The IFN-β content detection results are as follows: Figure 8 As shown, the detection results of IFN-α1 content are as follows: Figure 9 As shown, the framework DNA provided by this invention has the ability to increase the levels of IFN-β and IFN-α1 in various cells.
[0313] Example 5
[0314] In this embodiment, 2 μM cGAS was mixed with 1 μg TDN and 3 WJ, respectively. The framework DNA preparation process was performed according to Example 1. HT DNA and 20 bp dsDNA mix (HT dsDNA mix in Example 2) were used as control groups. The cGAMP content was measured after 1 hour. The 7 bp TDN, 15 bp TDN, 20 bp TDN, and 25 bp TDN were tetrahedral with arm lengths of 7 bp, 15 bp, 20 bp, and 25 bp, respectively. The results are as follows: Figure 10 As shown, the framework DNA provided by this invention has the ability to activate cGAS, thereby promoting cGAMP synthesis.
[0315] Example 6
[0316] In this embodiment, 500 nM cGAS (3% Alexa Fluor 488 labeled) was mixed with 38 ng / μL TDN, 3 WJ, and ab, respectively. The framework DNA preparation process was performed according to Example 1, with ds20 mix (HT dsDNA mixture in Example 2) as a control. After mixing for 10 min, cGAS phase-separated droplet images were obtained using an inverted fluorescence microscope. T7, T15, T20, and T25 were tetrahedrals with arm lengths of 7 bp, 15 bp, 20 bp, and 25 bp, respectively. The results are as follows: Figure 11 As shown, the framework DNA provided by this invention has the ability to induce cGAS phase separation in vitro in a dimension-dependent and arm-length-determined manner.
[0317] Example 7
[0318] In this embodiment, 500 nM cGAS was mixed with different concentrations of TDN, 3WJ, ab, and abc, respectively. The framework DNA preparation process was performed according to Example 1. T7, T15, T20, and T25 were tetrahedral cells with arm lengths of 7 bp, 15 bp, 20 bp, and 25 bp, respectively. ds20 mix (HT dsDNA mixture from Example 2) was used as a control group. After mixing for 10 min, the phase separation results are shown in the figure below. Figure 12 As shown, the framework DNA provided by this invention has an enhanced ability to induce phase separation of cGAS as the dimensionality increases.
[0319] Example 8
[0320] MEF cells reconstructed from GFP-cGAS and knocked out were transfected with ab, 3WJ, and TDN at concentrations of 2 μg / mL, respectively. A 20 bp dsDNA (HT dsDNA mixture from Example 2) was used as a control. Representative live-cell images of cGAS-DNA spots were obtained by confocal microscopy 4 hours later. The 7 bp TDN and 20 bp TDN were tetrahedral with arms of 7 bp and 20 bp, respectively. Cell images are shown below. Figure 13 As shown, the statistical results of the number of spots per 100 cells are as follows: Figure 14 As shown, the framework DNA provided by this invention has the ability to regulate cGAS phase separation in a dimension- and arm-length-dependent manner within cells.
[0321] 2 μM cGAS was mixed with 1 μg dsDNA-2S-2nt, dsDNA-2S-5nt, dsDNA-2S-10nt, dsDNA-2S-20nt, and dsDNA-2S-40nt in buffer (20 mM Hepes pH 7.2-8.0, 3 mM MgCl2, 150 mM NaCl2, 2 μM ATP, 2 μM GTP), with dsDNA as the control. The mixture was reacted at 37 °C for 1 h and then denatured at 95 °C for 10 min. The cGAMP yield was detected using a cGAMP ELISA Kit (Cayman). dsDNA-2S-2nt, dsDNA-2S-5nt, dsDNA-2S-10nt, dsDNA-2S-20nt, and dsDNA-2S-40nt were tandem double-stranded DNA with single-strand lengths of 2 nt, 5 nt, 10 nt, 20 nt, and 40 nt, respectively.
[0322] dsDNA was prepared from the single-stranded DNA shown in SEQ ID NO.90 to SEQ ID NO.91.
[0323] dsDNA-2S-2nt was prepared from single-stranded DNA as shown in SEQ ID NO.91 to SEQ ID NO.93.
[0324] dsDNA-2S-5nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, and 94.
[0325] dsDNA-2S-10nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, and 95.
[0326] dsDNA-2S-20nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, and 96.
[0327] dsDNA-2S-40nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, and 97.
[0328] SEQ ID NO. 90: AACTAATAAGCGTGTTAGAC.
[0329] SEQ ID NO. 91: GTCTAACACGCTTATTAGTT.
[0330] SEQ ID NO.92:
[0331] CTAACACCATCGGTTGATTGAGAACTAATAAGCGTGTTAGAC.
[0332] SEQ ID NO. 93: CAATCAACCGATGGTGTTAG.
[0333] SEQ ID NO.94:
[0334] CTAACACCATCGGTTGATTGAGCGCAACTAATAAGCGTGTTAGAC.
[0335] SEQ ID NO.95:
[0336] CTAACACCATCGGTTGATTGAGCGCATGGGAACTAATAAGCGTGTTAGAC.
[0337] SEQ ID NO.96:
[0338] CTAACACCATCGGTTGATTGAGCGCATGGGTATCCACGGTAACTAATAAGCGTGTTAGAC.
[0339] SEQ ID NO.97:
[0340] CTAACACCATCGGTTGATTGAGCGCATGGGTATCCACGGTATAAGTAAGGACTGTGTGCGAACTAATAAGCGTGTTAGAC.
[0341] The results are as follows Figure 15 As shown, the two linear tandem double-stranded DNAs provided by the present invention (the distance between the two double-stranded DNAs is ≤13.6 nm or the length of the single-stranded DNA is 1-40 nt) have the ability to activate cGAS, thereby promoting cGAMP synthesis.
[0342] 2 μM cGAS was mixed with 1 μg dsDNA-3S-2nt, dsDNA-3S-2T, dsDNA-3S-10nt, and dsDNA-3S-10T in buffer (20 mM Hepes pH 7.2-8.0, 2-5 mM MgCl2, 150 mM NaCl2, 2 μM ATP, 2 μM MTP), with dsDNA as the control group. The reaction was carried out at 37 °C for 1 h, followed by denaturation at 95 °C for 10 min. The cGAMP yield was detected using a cGAMP ELISA Kit (Cayman). dsDNA-3S-2nt, dsDNA-3S-2T, dsDNA-3S-10nt, and dsDNA-3S-10T were tandem double-stranded DNA with single-strand lengths of 2 nt (two random bases), 2T (two T bases), 10 nt (ten random bases), and 10T (ten T bases), respectively.
[0343] dsDNA-3S-2nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, 98, and 99.
[0344] dsDNA-3S-2T was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, 99, and 100.
[0345] dsDNA-3S-10nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, 99, and 101.
[0346] dsDNA-3S-10T was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, 99, and 102.
[0347] SEQ ID NO.98:
[0348] CTAACACCATCGGTTGATTGAGAACTAATAAGCGTGTTAGACAT.
[0349] SEQ ID NO.99:
[0350] GTTGCCTTCTTCTGCGGCTCGAGCCGCAGAAGAAGGCAAC.
[0351] SEQ ID NO.100:
[0352] CTAACACCATCGGTTGATTGTTAACTAATAAGCGTGTTAGACTTGTTGCCTTCTTCTGCGGCTC.
[0353] SEQ ID NO.101:
[0354] CTAACACCATCGGTTGATTGAGCGCATGGGAACTAATAAGCGTGTTAGACATAAGTAAGGGTTGCCTTCTTCTGCGGCTC.
[0355] SEQ ID NO.102:
[0356] CTAACACCATCGGTTGATTGTTTTTTTTTTAACTAATAAGCGTGTTAGACTTTTTTTTTTGTTGCCTTCTTCTGCGGCTC.
[0357] The results are as follows Figure 16 As shown, the ability of the three linear tandem double-stranded DNAs provided by the present invention to activate cGAS increases as the distance between the two double-stranded DNAs is ≤3.4nm or the length of the single-stranded DNA is 1-10nt.
[0358] Further comparison of dsDNA-3S and dsDNA-2S yielded the following results: Figure 17 As shown, the three linear tandem double-stranded DNAs provided by this invention have a stronger ability to activate cGAS than two linear tandem double-stranded DNAs.
[0359] 2 μM cGAS was mixed with 1 μg of Qu-2S-3nt, Qu-2S-5nt, Qu-2S-7nt, Qu-2S-12nt, Qu-2S-22nt, and Qu-2S-32nt and added to buffer (20 mM Hepes pH 7.2-8.0, 3 mM MgCl2, 150 mM NaCl2, 2 μM ATP, 2 μM GTP). The mixture was reacted at 37 °C for 1 h and then denatured at 95 °C for 10 min. The cGAMP yield was detected using a cGAMP ELISA Kit (Cayman). Qu-2S-3nt, Qu-2S-5nt, Qu-2S-7nt, Qu-2S-12nt, Qu-2S-22nt, and Qu-2S-32nt were parallel double-stranded DNA with single-strand lengths of 3nt, 5nt, 7nt, 12nt, 22nt, and 32nt, respectively.
[0360] Qu-2S-3nt was prepared from the single-stranded DNA shown in SEQ ID NO.103 to SEQ ID NO.104.
[0361] Qu-2S-5nt was prepared from the single-stranded DNA shown in SEQ ID NO.105 to SEQ ID NO.106.
[0362] Qu-2S-7nt was prepared from the single-stranded DNA shown in SEQ ID NO.107 to SEQ ID NO.108.
[0363] Qu-2S-12nt was prepared from the single-stranded DNA shown in SEQ ID NO.109 to SEQ ID NO.110.
[0364] Qu-2S-22nt was prepared from the single-stranded DNA shown in SEQ ID NO.111 to SEQ ID NO.112.
[0365] Qu-2S-32nt was prepared from the single-stranded DNA shown in SEQ ID NO.113 to SEQ ID NO.114.
[0366] SEQ ID NO.103:
[0367] AACTAATAAGCGTGTTAGACATACTAACACCATCGGTTGATTG.
[0368] SEQ ID NO.104:
[0369] GTCTAACACGCTTTAGTTAGACAATCAACCGATGGTGTTTAG.
[0370] SEQ ID NO.105:
[0371] AACTAATAAGCGTGTTAGACAGGTACTAACACCATCGGTTGATTG.
[0372] SEQ ID NO.106:
[0373] GTCTAACACGCTTTAGTTAGCGACAATCAACCGATGGTGTTAG.
[0374] SEQ ID NO.107:
[0375] AACTAATAAGCGTGTTAGACAACGGTACTAACACCATCGGTTGATTG.
[0376] SEQ ID NO.108:
[0377] GTCTAACACGCTTTAGTTAGTGCGACAATCAACCGATGGTGTTAG.
[0378] SEQ ID NO.109:
[0379] AACTAATAAGCGTGTTAGACATATCCACGGTACTAACACCATCGGTTGATTG.
[0380] SEQ ID NO.110:
[0381] GTCTAACACGCTTATTAGTTAACTGTGTGCGACAATCAACCGATGGTGTTAG.
[0382] SEQ ID NO.111:
[0383] AACTAATAAGCGTGTTAGACAAGCGCATGGGTATCCACGGTACTAACACCATCGGTTGATTG.
[0384] SEQ ID NO.112:
[0385] GTCTAACACGCTTATTAGTTAATAAGTAAGGACTGTGTGCGACAATCAACCGATGGTGTTAG.
[0386] SEQ ID NO.113:
[0387] AACTAATAAGCGTGTTAGACAAGCGCATGGGTATCCACGGTATAAGTAAGGACTAACACCATCGGTTGATTG.
[0388] SEQ ID NO.114:
[0389] GTCTAACACGCTTATTAGTTAATAAGTAAGGACTGTGTGCGGGCGCTTACAACAATCAACCGATGGTGTTAG.
[0390] The results are as follows Figure 18 As shown, the two parallel double-stranded DNAs provided by the present invention can effectively activate cGAS, and the ability to activate cGAS is enhanced as the distance between the two parallel double-stranded DNAs is ≤2.38nm or the length of the single-stranded DNA is 1 to 7nt.
[0391] 2 μM cGAS was mixed with 1 μg of Tr-2S-3nt, Tr-2S-5nt, Tr-2S-7nt, Tr-2S-12nt, Tr-2S-22nt, and Tr-2S-32nt, respectively, and added to buffer (20 mM Hepes pH 7.2-8.0, 2-5 mM MgCl2, 150 mM NaCl2, 2 μM ATP, 2 μM GTP). The mixture was reacted at 37°C for 1 h, followed by denaturation at 95°C for 10 min. The resulting product was then analyzed using a cGAMP ELISA. The kit (Cayman) was used to detect cGAMP production. The single-stranded DNA at the corner ends of the Tr-2S-3nt, Tr-2S-5nt, Tr-2S-7nt, Tr-2S-12nt, Tr-2S-22nt, and Tr-2S-32nt were 1nt in length, while the single-stranded DNA at the non-corner ends were 3nt, 5nt, 7nt, 12nt, 22nt, and 32nt, respectively, which were double-stranded DNA at the corner ends.
[0392] Tr-2S-3nt was prepared from the single-stranded DNA shown in SEQ ID NO.115 to SEQ ID NO.116.
[0393] Tr-2S-5nt was prepared from the single-stranded DNA shown in SEQ ID NO.117 to SEQ ID NO.118.
[0394] Tr-2S-7nt was prepared from the single-stranded DNA shown in SEQ ID NO.119 to SEQ ID NO.120.
[0395] Tr-2S-12nt was prepared from the single-stranded DNA shown in SEQ ID NO.121 to SEQ ID NO.122.
[0396] Tr-2S-22nt was prepared from the single-stranded DNA shown in SEQ ID NO.123 to SEQ ID NO.124.
[0397] Tr-2S-32nt was prepared from the single-stranded DNA shown in SEQ ID NO.125 to SEQ ID NO.126.
[0398] SEQ ID NO.115:
[0399] CTAACACCATCGGTTGATTGATAAACTAATAAGCGTGTTAGAC.
[0400] SEQ ID NO.116:
[0401] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT。
[0402] SEQ ID NO.117:
[0403] CTAACACCATCGGTTGATTGAGGTAAACTAATAAGCGTGTTAGAC。
[0404] SEQ ID NO.118:
[0405] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT。
[0406] SEQ ID NO.119:
[0407] CTAACACCATCGGTTGATTGAACGGTAAACTAATAAGCGTGTTAGAC。
[0408] SEQ ID NO.120:
[0409] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT。
[0410] SEQ ID NO.121:
[0411] CTAACACCATCGGTTGATTGATATCCACGGTAAACTAATAAGCGTGTTAGAC。
[0412] SEQ ID NO.122:
[0413] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT。
[0414] SEQ ID NO.123:
[0415] CTAACACCATCGGTTGATTGAAGCGCATGGGTATCCACGGTAAACTAATAAGCGTGTTAGAC。
[0416] SEQ ID NO.124:
[0417] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT。
[0418] SEQ ID NO.125:
[0419] CTAACACCATCGGTTGATTGAAGCGCATGGGTATCCACGGTATAAGTAAGGAAACTAATAAGCGTGTTAGAC.
[0420] SEQ ID NO.126:
[0421] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT.
[0422] The results are as follows Figure 19 As shown, the double-stranded DNA with two angled ends (the angle between the two double-stranded DNAs is ≤68.21°) provided by the present invention has an enhanced ability to activate cGAS as the angle decreases and the length of the single-stranded DNA at the non-angled ends decreases.
[0423] 2 μM cGAS was mixed with 1 μg nTDN-29-10bp, nTDN-47-25bp, nTDN-84-15bp, and nTDN-97-30bp in buffer (20 mM Hepes pH 7.2-8.0, 3 mM MgCl2, 150 mM NaCl2, 2 μM ATP, 2 μM GTP), with TDN-20bp (20 bp tetrahedral DNA) as the control. The reaction was carried out at 37 °C for 1 h, followed by denaturation at 95 °C for 10 min. The cGAMP yield was detected using a cGAMP ELISA Kit (Cayman). nTDN-29-10bp, nTDN-84-15bp, nTDN-47-25bp, and nTDN-97-30bp consisted of five 20 bp arms, with one non-tetrahedral DNA arm containing 10 bp, 15 bp, 25 bp, and 30 bp DNA, respectively.
[0424] nTDN-29-10bp was prepared from the single-stranded DNA shown in SEQ ID NO.50 to SEQ ID NO.53.
[0425] SEQ ID NO. 50: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAG.
[0426] SEQ ID NO. 51: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.
[0427] SEQ ID NO.52: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAAC。
[0428] SEQ ID NO.53: ACGCACACAGTCCTTACTTATAACCGTGGATACCCATGCGCTACTTATTAGTT。
[0429] nTDN-47-25bp is prepared from single-stranded DNAs shown in SEQ ID NO.58 to SEQ ID NO.61.
[0430] SEQ ID NO.58: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC。
[0431] SEQ ID NO.59: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTACCTAAGTTGCCTTCTTCTGCGGCTCGATTA。
[0432] SEQ ID NO.60: AATAAGTAAGGACTGTGTGCGGATCGACGCGCGGTTAAAGCGCGCGCATAATCGAGCCGCAGAAGAAGGCAAC。
[0433] SEQ ID NO.61: ACGATCCGCACACAGTCCTTACTTATATAGGTACCGTGGATACCCATGCGCTAGTCTAACACGCTTATTAGTT。
[0434] nTDN-84-15bp is prepared from single-stranded DNAs shown in SEQ ID NO.54 to SEQ ID NO.57.
[0435] SEQ ID NO.54: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC。
[0436] SEQ ID NO.55: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCAGTTGCCTTCTTCTGC。
[0437] SEQ ID NO. 56: AATAAGTAAGGACTGTACGCGCGGTTAAAGCGCGCGCAGCAGAAGAAGGCAA C.
[0438] SEQ ID NO. 57: AACAGTCCTTACTTATAGGATACCCCATGCGCTAGTCTAACACGCTTATTAGTT.
[0439] nTDN-97-30bp was prepared from the single-stranded DNA shown in SEQ ID NO.62 to SEQ ID NO.65.
[0440] SEQ ID NO. 62: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGACCTCCCAACCG.
[0441] SEQ ID NO. 63: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.
[0442] SEQ ID NO. 64: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAAC.
[0443] SEQ ID NO. 65: ACGCACACAGTCCTTACTTATAACCGTGGATACCCCATGCGCTACGGTTGGGAGGTCTAACACGCTTATTAGTT.
[0444] The results are as follows Figure 20 As shown, the non-tetrahedral DNA (at least one non-tetrahedral shape with an angle less than 60°) provided by the present invention has a stronger ability to activate cGAS than the tetrahedral DNA.
[0445] In this invention, the double-stranded DNA (ab) is a framework DNA with unpaired base ends. 2 μM cGAS and 1 μg of the double-stranded DNA (ab) were mixed and added to a buffer solution (20 mM Hepes pH 7.2-8.0, 3 mM MgCl2, 150 mM NaCl2, 2 μM ATP, 2 μM GTP). dsDNA was used as a control group. The reaction was carried out at 37°C for 1 h, followed by denaturation at 95°C for 10 min. cGAMP production was detected using a cGAMP ELISA Kit (Cayman). The double-stranded DNA (ab) is a 43 nt long single-stranded DNA with unpaired base ends at both ends of the double-stranded DNA.
[0446] The results are as follows Figure 21 As shown, the framework DNA with unpaired base ends provided by this invention has a stronger ability to activate cGAS than double-stranded DNA.
[0447] The method for preparing circular framework DNA includes: annealing two single-stranded DNAs to form a base-complementary pairing region; and preparing the circular DNA from single-stranded DNA with nucleic acid sequences as shown in SEQ ID NO.127 to SEQ ID NO.128.
[0448] The method for preparing the tetrahedral shape of the pendant bases includes: annealing four single-stranded DNAs to form six complementary base pairing regions, wherein the six complementary base pairing regions are the six sides of the tetrahedron.
[0449] Example 9
[0450] This embodiment utilizes a vector to load framework DNA to prepare a drug composition.
[0451] The carrier is a cationic liposome, and the preparation method of the cationic liposome includes, but is not limited to, the membrane hydration method. Taking the membrane hydration method as an example, firstly, the cationic lipid (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP) or DOTMA) and the auxiliary lipid (DOPE or cholesterol) are dissolved separately in anhydrous ethanol. The cationic lipid solution and the auxiliary lipid solution are mixed evenly at a molar ratio of 1:2-2:1 and transferred to a rotary evaporator. The mixture is rotary evaporated at 60 rpm and 40°C for 1 hour to obtain a lipid membrane. An appropriate amount of sterile water is added to hydrate the lipid membrane, and it is allowed to stand. The lipid solution is then extruded through a filter membrane with a pore size of 200 nm to adjust the particle size of the liposomes.
[0452] The particle size, polydispersity index, and surface potential of cationic liposomes with different lipid compositions (lipid types and molar ratios) and their changes over time are shown in the following figures. Figure 22 and Figure 23As shown, the particle sizes of these 12 cationic liposomes are in the range of 130 nm - 170 nm, the zeta potentials are 50 mV - 60 mV, and the PDI values are all less than 0.2, indicating that they are all positively charged nanoparticles with good monodispersity and good stability. The particle sizes and zeta potentials did not change significantly within 24 days.
[0453] Further analysis of the stability of the cationic liposome (DOTAP / cholesterol, molar ratio 1:2) gave the results as Figure 24 and Figure 25 shown. After storage at 4 °C for 1 year, the particle size, polydispersity coefficient and surface potential of the cationic liposome did not change significantly, indicating its good stability.
[0454] The preparation method of the carrier-loaded framework DNA (named framework DNA-LPX) includes: diluting the framework DNA with one-dimensional, two-dimensional or three-dimensional structures composed of different sequences to 1 mg / mL, and mixing the diluted framework DNA with the cationic liposome solution at an N / P ratio of 1:5 - 5:1. The mixing method can be carried out using a pipette.
[0455] Analyzing the hydrated particle size, polydispersity coefficient and surface potential of the prepared framework DNA-LPX, two cationic liposomes (DOTMA / DOPE, molar ratio 1:2; DOTAP / cholesterol, molar ratio 1:2) were mixed with the framework DNA (taking a DNA tetrahedron with a side length of 20 bp as an example) at different nitrogen-phosphorus ratios. The results of the hydrated particle size, polydispersity coefficient and surface potential of the obtained framework DNA-LPX are as Figure 26 shown. At positively charged N / P ratios (N / P = 5:1 and 4:1), the particles have larger sizes (~400 nm) and carry extremely high positive charges (about 60 mV). At slightly positively charged or neutral N / P ratios (for DOTMA / DOPE (1:2) liposomes, 1:1.4 < N / P < 4:1; for DOTAP / cholesterol (1:2) liposomes, 1:1.2 < N / P < 4:1), precipitation occurs after mixing the framework DNA and the cationic liposome. While the negatively charged N / P ratios (for DOTMA / DOPE (1:2) liposomes, N / P < 1:1.2; for DOTAP / cholesterol (1:2) liposomes, N / P < 1:1) of the TDN-LPX are usually uniform (PDI < 0.2) nanoparticles with a particle size of about 200 nm and a potential of about -50 mV.
[0456] Exemplary showing the stability results of the framework DNA-LPX formed after mixing the cationic liposome (DOTAP / cholesterol, molar ratio 1:2) with the framework DNA (taking a DNA tetrahedron with a side length of 20 bp as an example) at N / P = 1:1.6, as Figure 27As shown, after storage at 4°C for one week, the particle size, polydispersity index, and surface potential of the framework DNA-LPX did not change significantly, indicating its good stability. Surface morphology is shown in the figure. Figure 28 As shown.
[0457] RAW264.7 cells were seeded in 96-well plates. Framework DNA was mixed with the commercially available vector lipo2000 (Invitrogen) and added to the cells at a dose of 2 μg / mL. Alternatively, 2D and 3D framework DNA were added directly to the cells at a dose of 2 μg / mL (without mixing with lipo2000). After culturing for 24 h, the supernatant was collected, and the IFNβ content was measured using an ELISA kit (Biolegend). The results are shown below. Figure 29A As shown, the two-dimensional and three-dimensional framework DNA provided by this invention can only exhibit type I interferon stimulation ability in the presence of a vector.
[0458] BMDC and THP-1 cells were seeded in 96-well plates. After cell adhesion and a density of approximately 80%, one-dimensional DNA (ds20 mix), two-dimensional framework DNA (DNA triaxial linkages (3WJ), triangles (Tr), crosses (Cr), and quadrilaterals (Qu)), and three-dimensional framework DNA (DNA pyramids (Py), DNA triangular prisms (Tp), and DNA tetrahedrons with a side length of 20 bp (T20)) were transfected into the cells using a lipo2000 (Invitrogen) transfectant. The supernatant was collected 24 hours later. The levels of IFNβ and IFNα1 in the cell supernatant were detected using an ELISA kit.
[0459] Comparison results of DNA-induced type I interferon in different dimensions (one-dimensional, two-dimensional, and three-dimensional) are as follows: Figure 29B As shown, DNA of different dimensions has different inducibility for type I interferon, exhibiting a 3D > 2D > 1D pattern. This dimension-dependent inducibility of type I interferon is observed in human THP-1 cells (…). Figure 29B (Figure d) and mouse-derived BMDC ( Figure 29B This has been proven in both Figure b and Figure c.
[0460] RAW 264.7 cells were seeded in 96-well plates. After the cells adhered and reached a density of approximately 80%, four DNA tetrahedra with different sequence compositions and unpaired base ends (named G3-HT1-G3, G3-HT2-G3, G3-LT1-G3, and G3-LT2-G3, respectively) and poly(dA:dT) (an immunostimulatory DNA) were transfected into the cells using a lipo2000 (Invitrogen). The supernatant was collected 24 hours later. The IFNβ content in the RAW 264.7 cell supernatant was detected using an ELISA kit. G3-HT1-G3, G3-HT2-G3, G3-LT1-G3, and G3-LT2-G3 were tetrahedral DNAs containing eight GGG base hangers.
[0461] G3-HT1-G3 was prepared from the single-stranded DNA shown in SEQ ID NO.129 to SEQ ID NO.132.
[0462] SEQ ID NO. 129: GGGACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTTAGACGGG.
[0463] SEQ ID NO. 130: GGGACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTCGGG.
[0464] SEQ ID NO. 131: GGGAATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAACGGG.
[0465] SEQ ID NO. 132: GGGACGCACACAGTCCTTACTTATAACCGTGGATACCCCATGCGCTAGTCTAACACGCTTATTAGTTGGG.
[0466] G3-HT2-G3 was prepared from the single-stranded DNA shown in SEQ ID NO.133 to SEQ ID NO.136.
[0467] SEQ ID NO. 133: GGGCTCCCAACCGGGGCCCTCTCAGAGATATGGACCCATTGAACACATAATAGATAGCCGCTCTTAGGG.
[0468] SEQ ID NO.134: GGGGGCTCAGGACAGAGGACCTAAGTTCAATGGGTCCATATCTCAGGCGCTTACAGATTACTGCAAGGG。
[0469] SEQ ID NO.135: GGGAGAGGGCCCCGGTTGGGAGAGGTTGGCACAGAGAGGGGCTATGCAGTAATCTGTAAGCGCCAGGG。
[0470] SEQ ID NO.136: GGGTAGGTCCTCTGTCCTGAGCCAAGCCCCTCTCTGTGCCAACCAAAGAGCGGCTATCTATTATGAGGG。
[0471] G3-LT1-G3 is prepared from single-stranded DNAs shown in SEQ ID NO.137 to SEQ ID NO.140.
[0472] SEQ ID NO.137: GGGACGATAGGTAAAAATATATGCAGTATTTACCTATTTCTATCGATACCCATTTAACCGTTAAGGGGG。
[0473] SEQ ID NO.138: GGGAGCATATATTTTTACCTATCGATCACCGAGGCGGTCGAGGATAGCACACACCTATCGCTTTCGGGG。
[0474] SEQ ID NO. : GGGACCACCGGCTCGTCACCGTATAATCCTCGACCGCCTCGGTGAACCTTAACGGTTAAATGGGTAGGG。
[0475] SEQ ID NO.140: GGGAATACGGTGACGAGCCGGTGGACGATAGAAATAGGTAAATACACGAAAGCGATAGGTGTGTGCGGG。
[0476] G3-LT2-G3 is prepared from single-stranded DNAs shown in SEQ ID NO.141 to SEQ ID NO.144.
[0477] SEQ ID NO. 141: GGGAACCGGAGACCCGTGAGTCTTAACGCCGATATGGATAATATTAGCACACACCTTTCGCTTTCGGGG.
[0478] SEQ ID NO. 142: GGGAAAGACTCACGGGTCTCCGGTAGAGGCTCAGTGAGCTTCTGAAGTATATACCTATTTCTATCGGGG.
[0479] SEQ ID NO. 143: GGGACCTTAACCCGTAAATGGGTAATCAGAAGCTCACTGAGCCTCACGAAAGCGAAAGGTGTGTGCGGG.
[0480] SEQ ID NO. 144: GGGATACCCATTTACGGGTTAAGGAAATATTATCCATATCGGCGTACGATAGAAATAGGTATATACGGG.
[0481] Figure 29C The figure shows the results of framework DNA with unpaired base ends and poly(dA:dT) in inducing type I interferon. It can be seen that framework DNA with unpaired base ends is a potent type I interferon inducer, and its type I interferon induction ability is significantly higher than that of commercially available immunostimulatory DNA—poly(dA:dT).
[0482] RAW-Lucia ISG and THP-1 cells were seeded in 96-well plates. After cell adhesion and a density of approximately 80%, six DNA tetrahedra with different sequence compositions (HT1, HT2, HT3, LT1, LT2, and LT3) and poly(dA:dT) were transfected into the cells using a lipo2000 (Invitrogen) transfection kit. The supernatant was collected 24 hours later. The IFNβ content in the THP-1 cell supernatant was detected using an ELISA kit; the luciferase activity in the RAW-Lucia ISG cell supernatant was detected using the QUANTI-Luc 4Lucia reagent. The luciferase activity of each group was standardized using the blank group (containing only an equal volume of culture medium) to obtain the relative activation intensity of the type I interferon pathway in each group.
[0483] Figure 29DThis image compares the induction of type I interferon by framework DNA with different sequence compositions. From left to right, the figures show the amount of type I interferon secreted after immunostimulation in two different cell types: RAW-Lucia ISG and THP-1. Framework DNA with different sequence compositions can efficiently induce type I interferon production in various cell types, and the inducible amount of type I interferon is higher than that of commercially available immunostimulatory DNA—poly(dA:dT). This indicates that framework DNA is an excellent type I interferon inducer, and its effect is independent of specific sequences and binding... Figure 29B As a result, it can be concluded that the factors affecting the type I interferon induction ability of framework DNA are mainly dimensional, rather than sequence.
[0484] Cationic lipids (DOTMA or DOTAP, Sigma-Aldrich) and auxiliary lipids (DOPE or cholesterol, Sigma-Aldrich) were dissolved separately in anhydrous ethanol (final concentration 10 mg / mL). The cationic and auxiliary lipid solutions were mixed thoroughly at the specified molar ratio and transferred to a rotary evaporator. Evaporation was performed at 80 rpm and 40°C for 1 h to obtain a lipid film. Sterile water was added to hydrate the lipid film (approximately 6 mM concentration), and the mixture was allowed to stand overnight. The hydrated lipid solution was extruded through a 200 nm pore size polycarbonate membrane 10 times to obtain the final cationic liposomes. Lipid quantification was performed using HPLC. DNA tetrahedra with a side length of 20 bp were mixed with cationic liposomes at three different N / P ratios: 1:5, 1:1, and 5:1. The resulting DNA tetrahedra-LPX were added to RAW-Lucia ISG cells at doses of 2 μg / mL or 5 μg / mL. After 24 hours, the supernatant was collected, QUANTI-Luc reagent (Invivogen) was added, and the luminescence intensity was immediately detected using a microplate reader.
[0485] The strength of the type I interferon response induced by cationic liposomes with different lipid compositions (lipid types and molar ratios) after delivering framework DNA into RAW-Lucia ISG immune cells is as follows: Figure 30 As shown, framework DNA delivered via liposomes with different formulations upregulated type I interferon responses. Among these, the DOTMA / DOPE (1:2) and DOTAP / cholesterol (1:2) formulations exhibited the optimal activation of the type I interferon pathway (at an N / P ratio of 5:1). Cationic liposomes DOTMA / DOPE (molar ratio 1:2) and DOTAP / cholesterol (molar ratio 1:2) were prepared using a membrane hydration method. Different N / P ratios (specific ratios are shown in the figure below) were used. Figure 31(As shown) DNA tetrahedra with a side length of 20 bp were mixed with cationic liposomes. The resulting DNA tetrahedra-LPX were added to RAW-Lucia ISG cells at a dose of 2 μg / mL or 5 μg / mL. After 24 h, the supernatant was collected, QUANTI-Luc reagent (Invivogen) was added, and the luminescence intensity was immediately detected using a microplate reader.
[0486] Two cationic liposomes (DOTMA / DOPE, molar ratio 1:2; DOTAP / cholesterol, molar ratio 1:2) were mixed with framework DNA (20 bp tetrahedral DNA) at different nitrogen-phosphorus ratios. The resulting framework DNA-LPX was added to RAW-Lucia ISG immune cells, and the strength of the induced type I interferon response was as follows: Figure 31 As shown, N / P = 5:1 indicates the optimal activation level of the type I interferon pathway (IRF), while DOTAP / cholesterol (1:2) cationic liposomes are more effective than DOTMA / DOPE (1:2) cationic liposomes.
[0487] THP-1 cells were seeded in 6-well plates and PMA (Sigma-Aldrich) was added to facilitate adhesion. After 48 h, cGAS inhibitor G150 (10 μM, MedChemExpress) or an equal volume of DMSO was added. After 3 h of culture, a 20 bp tetrahedron of DNA was mixed with the commercial vector lipo2000 (Invitrogen) and added to the cells at a dose of 2 μg / mL, or an equal volume of culture medium (Mock control) was added. After 10 h of further culture, total protein was extracted from the cells, and the expression levels of p-IRF3, IRF3, p-JAK1, JAK1, p-STAT1, STAT1, p-STAT2, STAT2, and GAPDH were detected by Western blot.
[0488] The results are as follows Figure 32 As shown, framework DNA (a 20bp tetrahedron of DNA) induces the activation (phosphorylation) of immune-related proteins such as IRF3, JAK1, STAT1, and STAT2.
[0489] Example 10
[0490] This embodiment provides a combination therapy, which includes a combination drug and a drug composition (framework DNA-LPX). The combination drug includes at least one of immune checkpoint inhibitors, cell therapy drugs, oncolytic viruses, chemotherapy drugs, or radiotherapy drugs.
[0491] Combination therapy of DNA-LPX with immune checkpoint inhibitors: Combination therapy of immune checkpoint inhibitors (ICIs) such as PD-1, PD-L1 and CTLA-4 monoclonal antibodies can improve the prognosis of various tumors by blocking tumor immunosuppressive signals.
[0492] Combination therapy of DNA-LPX with cell therapy drugs: Cell therapy drugs such as chimeric antigen receptor (CAR) T cell therapy are being evaluated in combination to exert synergistic anti-cancer activity.
[0493] Combination therapy of DNA-LPX with chemotherapy: The combination of modified oncolytic adenovirus ONYX-015, cisplatin and 5-fluorouracil (5-FU) enhances the anti-tumor effect.
[0494] Combined treatment with DNA-LPX and radiotherapy: Radiotherapy combined with immunotherapy can modulate and amplify the distant effect. Radiotherapy can promote the presentation of tumor antigens by dendritic cells (DCs), and immunomodulators targeting DCs can amplify this effect, thereby promoting the generation of distant effects.
[0495] Example 11
[0496] In this embodiment, the drug composition (framework DNA-LPX) was used as a vaccine adjuvant.
[0497] Cationic liposomes DOTAP / cholesterol (molar ratio 1:2) were prepared by thin-film hydration. DNA tetrahedra with a side length of 20 bp were mixed with cationic liposomes at N / P ratios of 1:1.2, 1:1.4, and 1:1.6. The resulting DNA tetrahedra-LPX were administered to C57BL / 6 mice (6-8 weeks old, female) at a dose of 15 μg / mouse via subcutaneous (sc) or intravenous (iv) injection. Six hours later, mouse serum was collected, and IFNα1 levels were detected using an ELISA kit (Biolegend). Results are as follows: Figure 33 As shown, framework DNA-LPX can induce higher serum interferon type I levels in vivo. SC refers to subcutaneous injection, IV refers to intravenous injection.
[0498] Cationic liposomes (DOTAP / cholesterol, molar ratio 1:2) were mixed with framework DNA (20 bp tetrahedral DNA) at N / P ratios of 1:1.2, 1:1.4, and 1:1.6 to form framework DNA-LPX. Framework DNA-LPX was used as an adjuvant, mixed with the OVA antigen protein, and administered intravenously, with an equal volume of a commercially available adjuvant as a control. Antibody titers in serum were measured after 22 days. Results are as follows: Figure 34 As shown, the framework DNA-LPX group induced extremely high antibody titers, which were 83.0 times higher than the unadjuvanted group, 3.60 times higher than the commercially available adjuvant MF59 group, and 3.94 times higher than the CpG group.
[0499] The antibody titers induced in vivo by vaccines containing different adjuvants on days 22 and 29 post-immunization were statistically analyzed. Results are as follows: Figure 35 As shown, the efficacy of vaccines containing the commercial adjuvants CpG and MF59 decreased over time, while the efficacy of vaccines containing framework DNA-LPX increased slightly. When comparing antibody titers on day 29 with those on day 22, it was found that the antibody titer decreased by 40.0% in the CpG adjuvant group, by 26.8% in the MF59 adjuvant group, and increased by 15.9% in the framework DNA-LPX group.
[0500] In the B16-OVA subcutaneous tumor model, the weight of tumors after treatment with vaccines containing different framework DNA-LPX adjuvants was measured, and the results were as follows: Figure 36 As shown, different framework DNA-LPX adjuvant groups all significantly inhibited tumor growth, indicating that cationic liposomes are universal as carriers of framework DNA and can be compatible with framework DNA of different conformations and sizes.
[0501] In a B16-OVA subcutaneous tumor model, the inhibitory effects of vaccines containing different adjuvants on tumor growth were analyzed. Cationic liposomes (DOTAP / cholesterol, molar ratio 1:2) were mixed with framework DNA (20 bp DNA tetrahedrons) at an N / P ratio of 1:1.6 to form framework DNA-LPX. Framework DNA-LPX was then mixed with the OVA antigen protein and administered intravenously. Tumor growth curves ( Figure 37 (Figures a and b) and tumor volume ( Figure 37 The results (Figure c) indicate that vaccines containing framework DNA-LPX adjuvants are more effective at inhibiting tumor growth than vaccines containing the commercial adjuvant CpG.
[0502] Female C57BL / 6 mice (6-8 weeks old) were subcutaneously inoculated with B16-OVA cells (5 × 10⁻⁶ cells per ... 5 / mouse). On days 4 and 7 after tumor inoculation, mice were administered PBS, OVA, CpG (20-25 μg / time / mouse) + OVA, or T20-LPX (20-25 μg / time / mouse) + OVA via subcutaneous injection or tail vein injection, respectively. The OVA dose for each group was 50 μg / time / mouse.
[0503] Flow cytometry: At the experimental endpoint, tumors were collected and minced in cold PBS. Tumors were incubated in 5 mL of digestion medium (RPMI 1640, containing 1.5% FBS, 0.5 mg / mL collagenase IV, 0.5 mg / mL collagenase I, and 0.04 mg / mL DNase I) at 37°C with shaking at 200 rpm for 20 min. The dispersed cells were filtered through a 70 μm cell filter to obtain a single-cell suspension. To minimize nonspecific Fc receptor binding, cells were blocked for 30 min with anti-CD16 / CD32 antibody (Biolegend). To analyze the tumor-infiltrating T cell population, cells were stained with violetFluor 450-anti-CD45 (Cell Signaling Technology) and APC / Cy7-anti-CD3 (Cell Signaling Technology) antibodies. Fluorescence signals were analyzed using an Attune NxT flow cytometer (Thermo). All flow cytometry data were analyzed using FlowJo 10.8.1.
[0504] ELISApot assay: At the end of the experiment, spleen cells were isolated and analyzed at a concentration of 1×10⁻⁶. 5 Cells were seeded at a density of 10 cells / well in 96-well plates coated with anti-IFNγ antibody and incubated for 18 h with OVA protein (10 μg / mL) or iomycin (as a positive control). Biotin-conjugated anti-IFNγ antibody was added, followed by incubation with streptavidin conjugated with alkaline phosphatase and AEC substrate solution. Spot photography and automated quantification were performed by Dakowei Biotechnology Co., Ltd.
[0505] The results are as follows Figure 38 As shown, compared with vaccines containing the commercial adjuvant CpG, vaccines containing framework DNA-LPX adjuvant significantly increased the number of intratumoral immune cells (CD45) after treatment. + cell, Figure 38 (Figure a) and T cells (CD45) + CD3 + , Figure 38 The content of (Figure b) and the proportion of antigen-specific IFNγ+ T cells in the spleen (Figure b) Figure 38 (Figure C in the middle)
[0506] In summary, this invention utilizes framework DNA with 2D or 3D structures to activate cGAS, resulting in a novel cGAS-STING signaling pathway agonist. It accelerates cGAMP synthesis, enhances the generation of type I interferon downstream of the cGAS-STING signaling pathway, exhibits relatively uniform size and morphology, and strong stability. It can be any type of framework DNA with 2D or 3D structures, and its sequence composition can be random. Its cGAS activation effect is significantly stronger than existing commercial agonists, demonstrating broad application prospects.
[0507] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.
Claims
1. An agonist of the cGAS-STING signaling pathway, characterized in that, The agonist includes framework DNA.
2. The agonist of the cGAS-STING signaling pathway according to claim 1, characterized in that, The framework DNA has a structure that includes at least one of a one-dimensional structure, a two-dimensional structure, or a three-dimensional structure.
3. The agonist of the cGAS-STING signaling pathway according to claim 2, characterized in that, The one-dimensional structure comprises at least two linearly tandem double-stranded DNA strands; Preferably, the two-dimensional structure includes any one or a combination of at least two of the following: double-stranded, ring-shaped, shovel-shaped, three-way connection, triangle, cross-shaped, quadrilateral, parallel structure, or angled structure; the parallel structure includes two parallel double-stranded DNA strands; the angled structure includes two double-stranded DNA strands forming an angle greater than 0° and less than 180°. Preferably, the three-dimensional structure includes any one or a combination of at least two of the following: pyramidal, triangular prism, or tetrahedral shapes. Preferably, the tetrahedral shape includes any one or a combination of at least two of the following: a regular tetrahedral shape, a tetrahedral shape with a pendant base, or at least a non-regular tetrahedral shape with an angle less than 60°. Preferably, the framework DNA also has unpaired base ends.
4. The agonist of the cGAS-STING signaling pathway according to claim 3, characterized in that, In the one-dimensional structure, double-stranded DNA is linked by single-stranded DNA, and the length of the single-stranded DNA is ≥1 nt; preferably 1 to 40 nt. Preferably, the distance between the linearly tandem double-stranded DNAs in the one-dimensional structure is ≥0.34 nm; Preferably, the distance between the linearly tandem double-stranded DNAs in the one-dimensional structure is ≥0.34nm and ≤14nm; Preferably, in the parallel structure, one end of a double-stranded DNA is connected to the other end of a double-stranded DNA via single-stranded DNA, and the length of the single-stranded DNA is ≥1 nt; preferably 1 to 42 nt. Preferably, the distance between the two double-stranded DNA strands in the parallel structure is ≥0.34 nm; Preferably, the distance between the two double-stranded DNA strands in the parallel structure is ≥0.34nm and ≤15nm; Preferably, in the angled structure, one end of a double-stranded DNA is connected to the other end of a double-stranded DNA via single-stranded DNA, the length of the single-stranded DNA at the angled end is ≥1nt, and the length of the single-stranded DNA at the non-angled end is ≥2nt. Preferably, the length of the single-stranded DNA at the angled end is 1–38 nt, and the length of the single-stranded DNA at the non-angled end is 2–40 nt. Preferably, the side length of the tetrahedral DNA is ≥15bp; Preferably, the side length of the tetrahedral DNA is ≥15bp and ≤40bp; Preferably, the length of the unpaired base ends in the DNA is ≥2 nt, and it contains at least one G base; Preferably, the length of the unpaired base terminus in the DNA is 2 to 43 nt, and it contains at least one G base.
5. The agonist of the cGAS-STING signaling pathway according to any one of claims 1 to 4, characterized in that, The raw materials for preparing the framework DNA include at least two single-stranded DNAs with complementary base pairing regions. Preferably, the framework DNA contains at least one base-complementary pairing region; Preferably, the framework DNA contains at least one base-complementary pairing region with a length ≥15bp and ≤40bp; Preferably, the complementary base pairing region is formed by annealing at least two single-stranded DNA molecules; The method for preparing the framework DNA includes: mixing at least two single-stranded DNAs and then annealing them to form at least one complementary base pairing region, thereby obtaining the framework DNA; Preferably, the single-stranded DNA is mixed in a buffer solution; Preferably, the buffer solution contains 10–40 mM Tris-HCl and 2–5 mM MgCl2 with a pH of 7.5–8; Preferably, the annealing temperature is 90-95°C, and the annealing time is 10-20 minutes; Preferably, the annealing process further includes a step of cooling to 2-4°C and holding for 20-30 minutes; The method for preparing the duplex includes: annealing two single-stranded DNAs to form a base-complementary pairing region; Preferably, the method for preparing the ring includes: annealing two single-stranded DNA molecules to form a base-complementary pairing region; Preferably, the method for preparing the shovel shape includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions intersect at a point in space and are not coplanar; Preferably, the method for preparing the three-way ligation includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions intersect at a point on a plane; Preferably, the method for preparing the triangle includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions are the three sides of the triangle; Preferably, the method for preparing the cross shape includes: annealing four single-stranded DNA strands to form four complementary base pairing regions, wherein the four complementary base pairing regions intersect at a point on a plane; Preferably, the method for preparing the quadrilateral includes: annealing four single-stranded DNA strands to form four complementary base pairing regions, wherein the four complementary base pairing regions are the four sides of the quadrilateral; Preferably, the method for preparing the pyramid shape includes: annealing five single-stranded DNA strands to form eight complementary base pairing regions, wherein the eight complementary base pairing regions are the eight sides of a square pyramid; Preferably, the method for preparing the triangular prism includes: annealing five single-stranded DNA strands to form nine complementary base pairing regions, wherein the nine complementary base pairing regions are the nine sides of the triangular prism; Preferably, the method for preparing the tetrahedral shape includes: annealing four single-stranded DNA strands to form six complementary base pairing regions, wherein the six complementary base pairing regions are the six edges of the tetrahedron; Preferably, the six complementary base pairing regions are of equal length, with a length ≥15bp and ≤40bp; Preferably, the method for preparing the tetrahedral shape of the pendant bases includes: annealing four single-stranded DNA strands to form six complementary base pairing regions, wherein the six complementary base pairing regions are the six sides of a tetrahedron; Preferably, the length of the six complementary base pairing regions is ≥15bp and ≤40bp; Preferably, the method for preparing the non-tetrahedral shape includes: annealing four single-stranded DNA strands to form six complementary base pairing regions, wherein the six complementary base pairing regions are the six edges of a tetrahedron; Preferably, the six complementary base pairing regions are of unequal length, and at least one complementary base pairing region has a length ≥15bp and ≤40bp. Preferably, the six complementary base pairing regions are of unequal length, each having a length ≥15bp and ≤40bp; Preferably, the one-dimensional structure comprises two linearly tandem double-stranded DNA strands and / or three linearly tandem double-stranded DNA strands; Preferably, the method for preparing the two linearly tandem double-stranded DNAs includes: annealing three single-stranded DNAs to form two complementary base-pairing regions; Preferably, the method for preparing the three linearly tandem double-stranded DNAs includes: annealing four single-stranded DNAs to form three complementary base pairing regions; Preferably, the method for preparing the parallel structure includes: annealing two single-stranded DNAs to form two complementary base pairing regions, wherein the two complementary base pairing regions do not intersect in the plane; Preferably, the method for preparing the angled structure includes: annealing two single-stranded DNAs to form two complementary base pairing regions, wherein the two complementary base pairing regions intersect at a point on a plane; Preferably, the framework DNA with unpaired base ends comprises a double helix and / or a tetrahedral shape with dangling bases.
6. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a pharmaceutically acceptable carrier and an agonist of the cGAS-STING signaling pathway as described in any one of claims 1 to 4; Preferably, the carrier comprises cationic liposomes.
7. A combination therapy, characterized in that, The combined therapeutic agent includes a combination of drugs and the pharmaceutical composition of claim 6; The combined drugs include at least one of immune checkpoint inhibitors, cell therapy drugs, oncolytic viruses, chemotherapy drugs, or radiotherapy drugs.
8. The use of the cGAS-STING signaling pathway agonist according to any one of claims 1 to 4 or the pharmaceutical composition according to claim 6 in the preparation of vaccine adjuvants.
9. The use of the cGAS-STING signaling pathway agonist as described in any one of claims 1 to 4 or the pharmaceutical composition as described in claim 6 in the preparation of an agonist of cyclic guanosine monophosphate-adenosine synthase.
10. The use of the cGAS-STING signaling pathway agonist as described in any one of claims 1 to 4 or the pharmaceutical composition as described in claim 6 in the preparation of a type I interferon synthesis agonist; Preferably, the type I interferon includes IFN-α and / or IFN-β; Preferably, the IFN-α includes any one or a combination of at least two of IFN-α1, IFN-α2, IFN-α4, IFN-α7, or IFN-α14.