Agonist of cGAS-STING signal channel as well as preparation method and application of agonist

Abstract

The invention relates to a cGAS-STING signal pathway agonist and a preparation method and application thereof, the agonist comprises a framework DNA, and the structure of the framework DNA comprises at least one of a one-dimensional structure, a two-dimensional structure or a three-dimensional structure. The framework DNA provided by the invention regulates and controls the phase separation strength of cGAS through dimension factors, effectively activates cGAS, can be used as a cGAS-STING signal pathway agonist, has an activation effect better than that of an existing commercial agonist, accelerates the synthesis of cGAMP, and promotes the generation of I-type interferon at the downstream of the cGAS-STING signal pathway.

Description

[0001] This application claims priority to patent application number 202411446479.1 (the earlier application was filed on October 16, 2024, and is entitled "An agonist of the cGAS-STING signaling pathway, its preparation method and application"). Technical Field

[0002] This invention relates to the field of biotechnology, and in particular to an agonist of the cGAS-STING signaling pathway, its preparation method, and its application. Background Technology

[0003] Cyclic guanosine monophosphate-adenosine synthase (cGAS) is a highly conserved intracellular DNA sensor capable of recognizing a broad spectrum of DNA types. Upon DNA binding, cGAS undergoes a conformational change, promoting dimerization and activation. It catalyzes the synthesis of cyclic guanylate adenosine monophosphate (cGAMP), a second messenger that binds to and activates the STING (interferon gene stimulatory factor) pathway. Recent findings focus on the liquid-liquid phase transition (LLPS) process of cGAS in response to cytoplasmic DNA. DNA with high charge density and complex structure promotes the LLPS process. This powerful phase transition allows cGAS to efficiently detect the presence of DNA in the cytoplasm, ultimately promoting the production of type I interferon.

[0004] Researchers have discovered numerous DNA motifs with cGAS immunostimulatory activity, including Poly(dA:dT), HT-DNA, and G3-YSD. Poly(dA:dT) is a repeating synthetic double-stranded DNA sequence of poly(dA:dT):poly(dA:dT) and a synthetic analogue of B-DNA, containing a specific sequence of DNA fragments that can activate many different types of cytoplasmic DNA sensors (including cGAS and AIM2). HT-DNA, also known as sodium deoxyribonucleic acid derived from herring testes, is a sodium salt form of deoxyribonucleic acid extracted from herring testes and typically does not provide a specific molecular weight. G3-YSD is a 26nt DNA sequence generated by reverse transcription of human immunodeficiency virus RNA. Furthermore, the guanosine overhang of Y-type DNA can significantly promote cGAS-dependent immune activation of dsDNA. Many cGAS-STING pathway agonists have been developed and tested in preclinical studies for the treatment of cancer or infectious diseases, with promising results. As adjuvants, cGAS-STING agonists have demonstrated the potential to activate potent defensive immunity in various diseases, including COVID-19 infection. Activating immune cells within the tumor microenvironment through the cGAS-STING signaling pathway to initiate anti-tumor immune responses has become a research hotspot in recent years. cGAS-STING pathway agonists, alone or in combination with other therapies, have been applied in preclinical studies of various tumors. Agonists of this pathway exhibit good antiviral activity and hold promise for further development into novel antiviral drugs. Most existing commercially available cGAS signaling pathway agonists are dose-dependent, meaning their effectiveness increases with increasing dosage, but they may also reach a saturation point or produce adverse reactions. Furthermore, most existing commercially available cGAS agonists rely on large molecular weights or specific DNA sequences to achieve significant cGAS activation, limiting their widespread application.

[0005] CN116196327A discloses a cGAS-STING pathway agonist ssDNA and its uses. The cGAS-STING pathway agonist is selected from the nucleic acid-circular ssDNA of M13 bacteriophage. It can stimulate the production of IFNβ and cxcl10 and is an effective cGAS-STING pathway agonist that can promote the phagocytosis and presentation of antigens by macrophages. However, its function depends on a specific DNA sequence.

[0006] CN116036129A discloses a novel cGAS-STING agonist and its applications, providing a series of metal cations and anions with cGAS-STING pathway activation capabilities. The cations and anions can be combined in pairs to construct nanomaterials with cGAS-STING pathway activation potential. The resulting novel cGAS-STING pathway activator, manganese molybdate nanoparticles, can effectively kill tumor cells, activate the cGAS-STING pathway, stimulate dendritic cell maturation, and enhance tumor metalloimmunotherapy.

[0007] In summary, how to provide an efficient and widely applicable agonist for the cGAS-STING signaling pathway has become one of the urgent problems to be solved in this field. Summary of the Invention

[0008] To address the aforementioned technical problems, this invention provides an agonist for the cGAS-STING signaling pathway, its preparation method, and its application. This invention applies framework DNA to activate the cGAS-STING signaling pathway, effectively activating cGAS by regulating the strength of cGAS phase separation through dimensional factors. Its activation effect is stronger than that of existing commercial agonists, accelerating the synthesis of cGAMP and promoting the generation of type I interferon downstream of the cGAS-STING signaling pathway.

[0009] To achieve this objective, the present invention adopts the following technical solution:

[0010] In a first aspect, the present invention provides the use of framework DNA in the preparation of agents for the treatment of pathogen infection.

[0011] This invention utilizes spatially structured framework DNA (FNAs) as an agonist of the cGAS-STING signaling pathway. Its activation effect is significantly stronger than existing commercial agonists (Poly(dA:dT), HT-DNA, G3-YSD, etc.), more effectively enhancing cGAS binding, promoting cGAS dimerization and LLPS, and the highly concentrated cGAS accelerates cGAMP synthesis, which is crucial for STING activation and interferon (IFN) response. Furthermore, it has been found that framework DNA can be used to treat pathogen infections such as tumors, bacterial infections, viral infections (including DNA and RNA viruses), and parasitic infections.

[0012] In this invention, framework DNA refers to a structure with a certain shape and size assembled from DNA molecules in one-dimensional to three-dimensional space. In some cases, it can be alternatively referred to as DNA (nano) structure, DNA origami, DNA (nano) material, DNA (nano) carrier, DNA (nano) robot (human), DNA (nano) device, or DNA polyhedron, etc.

[0013] Preferably, the pathogen includes at least one of bacteria, viruses, or parasites.

[0014] Preferably, the agonist comprises framework DNA.

[0015] Preferably, the structure of the framework DNA includes at least one of a one-dimensional structure, a two-dimensional structure, or a three-dimensional structure.

[0016] Preferably, the one-dimensional structure comprises at least two linearly tandem double-stranded DNA strands.

[0017] Preferably, the two-dimensional structure includes any one or a combination of at least two of the following: double chain (ab), ring (Circ), shovel (abc), three-way connection (3WJ), triangle (Tr), cross (Cr), quadrilateral (Qu), parallel structure (Qu-2S), or included angle structure (Tr-2S).

[0018] Preferably, the parallel structure comprises two parallel double-stranded DNA strands; the angled structure comprises two double-stranded DNA strands forming an angle greater than 0° and less than 180°.

[0019] Preferably, the three-dimensional structure includes any one or a combination of at least two of the following: pyramidal (Py), triangular prism (Tp), or tetrahedral (TDN or nTDN).

[0020] Preferably, the tetrahedral shape includes a regular tetrahedral shape and / or at least one non-regular tetrahedral shape with an angle less than 60°.

[0021] Preferably, the non-tetrahedral DNA comprises five arms with a length of 20 bp and one arm with a length of 10 bp, 15 bp, 25 bp or 30 bp.

[0022] In this invention, controlling the length of the non-equal arms in a non-regular tetrahedron can further improve the ability to activate cGAS.

[0023] Preferably, the framework DNA also has unpaired base ends.

[0024] Preferably, the double-stranded DNA in the one-dimensional structure is linked by single-stranded DNA, and the length of the single-stranded DNA is ≥1 nt; more preferably 1 to 40 nt, for example, it can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 36, 37, 38 or 39 nt, and more preferably 2 to 20 nt.

[0025] Preferably, the one-dimensional structure may include 2, 3, 4, 5 or 6 linearly tandem double-stranded DNA strands.

[0026] In this invention, controlling the number of specific linearly tandem double-stranded DNA strands or the length of single-stranded DNA in a one-dimensional structure can further enhance the ability to activate cGAS.

[0027] Preferably, in the parallel structure, one end of a double-stranded DNA is connected to the other end of a double-stranded DNA via a single-stranded DNA, and the length of the single-stranded DNA is ≥1 nt; preferably 1 to 42 nt, for example, it can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 36, 37, 38, 39, 40 or 41 nt, etc.

[0028] In this invention, controlling the length of single-stranded DNA in parallel structures can further enhance the ability to activate cGAS.

[0029] Preferably, in the angled structure, one end of a double-stranded DNA is connected to another double-stranded DNA via single-stranded DNA, the length of the single-stranded DNA at the angled end is ≥1nt, and the length of the single-stranded DNA at the non-angled end is ≥2nt.

[0030] Preferably, the length of the single-stranded DNA at the angled end is 1–38 nt, for example, it can be 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 36, or 37 nt. The length of the single-stranded DNA at the non-angled end is 2–40 nt, for example, it can be 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 36, 37, 38, or 39 nt.

[0031] Preferably, the included angle in the included angle structure is ≤68.21°.

[0032] In this invention, controlling the included angle in the included angle structure can further improve the ability to activate cGAS.

[0033] Preferably, the side length of the tetrahedral DNA is ≥15bp.

[0034] Preferably, the side length of the tetrahedral DNA is ≥15bp and ≤40bp, for example, it can be 15, 16, 17, 18, 19, 20, 25, 30, 35, 36, 37, 38, or 39bp.

[0035] Preferably, the length of the unpaired base terminus in the DNA is ≥2 nt, and it contains at least one G base.

[0036] Preferably, the length of the unpaired base terminus in the DNA is 2 to 43 nt, and it contains at least one G base, such as 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 36, 37, 38, 39, 40, 41 or 42 nt.

[0037] In this invention, the framework DNA with unpaired base ends can be a double strand (ab).

[0038] In this invention, it was found that the ability of framework DNA to activate cGAS is as follows: angled structure > parallel structure > 1D; under the same 3D structure: non-tetrahedral > tetrahedral; with unpaired base ends > without unpaired base ends.

[0039] The agonist design in this invention is based on various types of FNAs depending on different dimensions (1D, 2D, 3D), including 1D: dsDNA-3S, dsDNA-2S; 2D: ab, abc, 3WJ, Tr, Cr, Qu, etc.; 3D: Py, Tp, TDN (tetrahedral), nTDN (non-tetrahedral), etc., and is not limited to the specific structures listed above, but can be any type of FNA with 2D or 3D structures. Furthermore, the sequence composition is flexible; verification through the construction of 132 random nucleoside sequences shows that the nucleic acid composition can be a random nucleic acid sequence. Specific nucleic acid sequences do not limit the scope of this invention. The agonist provided by this invention has high assembly accessibility and multiple application prospects.

[0040] Preferably, the raw materials for preparing the framework DNA include at least two single-stranded DNAs with complementary base pairing regions.

[0041] Preferably, the framework DNA contains at least one complementary base pairing region.

[0042] Preferably, the framework DNA contains at least one base-complementary pairing region with a length ≥15bp and ≤40bp (e.g., it can be 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, 22bp, 24bp, 26bp, 28bp, 30bp, 32bp, 34bp, 36bp, 38bp, or 40bp, etc.).

[0043] In this invention, the length of the complementary base pairing region is referred to as the arm length.

[0044] Preferably, the complementary base pairing region is formed by annealing at least two single-stranded DNA molecules.

[0045] Preferably, the method for preparing the framework DNA includes: mixing at least two single-stranded DNAs and then annealing them to form at least one complementary base pairing region to obtain the framework DNA.

[0046] Preferably, the single-stranded DNA is mixed in a buffer solution.

[0047] Preferably, the buffer solution contains 10–40 mM (e.g., 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, or 40 mM) Tris-HCl at a pH of 7.5–8 (e.g., 7.5, 7.6, 7.7, 7.8, 7.9, or 8) and 2–5 mM (e.g., 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4 mM, 4.5 mM, or 5 mM) MgCl2.

[0048] Preferably, the annealing temperature is 90-95°C (e.g., 90°C, 91°C, 92°C, 93°C, 94°C, or 95°C), and the annealing time is 10-20 min (e.g., 10 min, 12 min, 14 min, 15 min, 16 min, 18 min, or 20 min).

[0049] Preferably, the annealing process further includes a step of cooling to 2-4°C (e.g., 2°C, 2.5°C, 3°C, 3.5°C, or 4°C) and holding for 20-30 minutes (e.g., 20 minutes, 22 minutes, 24 minutes, 25 minutes, 26 minutes, 28 minutes, or 30 minutes).

[0050] Preferably, the method for preparing the duplex includes: annealing two single-stranded DNA molecules to form a base-complementary pairing region.

[0051] For example, the double strand can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.1 to SEQ ID NO.2.

[0052] SEQ ID NO. 1: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.

[0053] SEQ ID NO. 2: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.

[0054] Preferably, the method for preparing the ring includes: annealing two single-stranded DNA molecules to form a base-complementary pairing region.

[0055] For example, the circular DNA can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.127 to SEQ ID NO.128.

[0056] SEQ ID NO. 127: CTAACACCATCGGTTGATTGGCGCGCGCTTTAACCGCGCGAACTAATAAGCGTGTTAGACAGCGCATGGGTATCCACGGT.

[0057] SEQ ID NO. 128: CGCGCGGTTAAAGCGCGCGCCAATCAACCGATGGTGTTAGACCGTGGATACCCCATGCGCTGTCTAACACGCTTATTAGTT.

[0058] Preferably, the method for preparing the shovel shape includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions intersect at a single point in space and are not coplanar.

[0059] For example, the shovel shape can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.3 to SEQ ID NO.5.

[0060] SEQ ID NO. 3: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.

[0061] SEQ ID NO. 4: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.

[0062] SEQ ID NO. 5: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAAC.

[0063] Preferably, the method for preparing the three-way ligation includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions intersect at a point on a plane.

[0064] For example, the three-way linker can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.6 to SEQ ID NO.8.

[0065] SEQ ID NO. 6: TCTAACACCATCGGTTGATTGGCGCGCGCTTTAACCGCGCG.

[0066] SEQ ID NO. 7: TCGCGCGGTTAAAGCGCGCGCAACTAATAAGCGTGTTAGAC.

[0067] SEQ ID NO. 8: TGTCTAACACGCTTATTAGTTCAATCAACCGATGGTGTTAG.

[0068] Preferably, the method for preparing the triangle includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions are the three sides of the triangle.

[0069] For example, the triangle can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.9 to SEQ ID NO.11.

[0070] SEQ ID NO. 9: CTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.

[0071] SEQ ID NO. 10: CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT.

[0072] SEQ ID NO. 11: CGCGCGGTTAAAGCGCGCGC.

[0073] Preferably, the method for preparing the cross shape includes: annealing four single-stranded DNA strands to form four complementary base pairing regions, wherein the four complementary base pairing regions intersect at a point on a plane.

[0074] For example, the cross shape can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.12 to SEQ ID NO.15.

[0075] SEQ ID NO. 12: TCTAACACCATCGGTTGATTGGCGCGCGCTTTAACCGCGCG.

[0076] SEQ ID NO. 13: TAACTAATAAGCGTGTTAGACCAATCAACCGATGGTGTTAG.

[0077] SEQ ID NO. 14: TAGCGCATGGGTATCCACGGTGTCTAACACGCTTATTAGTT.

[0078] SEQ ID NO.15: TCGCGCGGTTAAAGCGCGCGCACCGTGGATACCCATGCGCT. Preferably, the method for preparing the quadrilateral includes: annealing four single-stranded DNA strands to form four complementary base pairing regions, wherein the four complementary base pairing regions are the four sides of the quadrilateral.

[0079] For example, the quadrilateral can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.16 to SEQ ID NO.19.

[0080] SEQ ID NO. 16: CTAACACCATCGGTTGATTGTTTGCGCGCGCTTTAACCGCGCG.

[0081] SEQ ID NO. 17: AACTAATAAGCGTGTTAGACTTTAGCGCATGGGTATCCACGGT.

[0082] SEQ ID NO. 18: GTCTAACACGCTTATTAGTTTTTCGCGCGGTTAAAGCGCGCGC.

[0083] SEQ ID NO. 19: CAATCAACCGATGGTGTTAGTTTACCGTGGATACCCCATGCGCT.

[0084] Preferably, the method for preparing the pyramid shape includes: annealing five single-stranded DNA strands to form eight complementary base pairing regions, wherein the eight complementary base pairing regions are the eight sides of a quadrangular pyramid.

[0085] For example, the pyramid shape can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.20 to SEQ ID NO.24.

[0086] SEQ ID NO. 20: CTAACTACCATCGGTTGATTGTAACTAATAAGCGTGTTAGCGCATGGGTATCCTTAGACACGGT.

[0087] SEQ ID NO. 21: GTTGCCTTCTTCTGCTATAAGTAAGGACTGTTGTTAGACCGTGTCTA.

[0088] SEQ ID NO. 22: TATGTCCAAGATCCATGCAGAAGAAGGCAACTGGATACCCCATGCGCT.

[0089] SEQ ID NO. 23: AATGACAGAGCGATGTTGGATCTTGGACATATACACGCTTATTAGTT.

[0090] SEQ ID NO. 24: ACAGTCCTTACTTATTCATCGCTCTGTCATTTCAATCAACCGATGGT.

[0091] Preferably, the method for preparing the triangular prism includes: annealing five single-stranded DNA strands to form nine complementary base pairing regions, wherein the nine complementary base pairing regions are the nine sides of the triangular prism.

[0092] For example, the triangular prism shape can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.25 to SEQ ID NO.29.

[0093] SEQ ID NO. 25: CTAACTAGACACGGTACCATCGGTTGATTTAACTAATAAGCGTGTAGCGCATGGGTATC.

[0094] SEQ ID NO. 26: TGGATCTTGGACATTGTTGCCTTCTTCTGTCCGTGTCTAGTTAGTAATGACAGAGCGAT.

[0095] SEQ ID NO. 27: CACGCTTATTAGTTTCAGTCCTTACTTATTATGTCCAAGATCCATTACCGCAGCTTGTA.

[0096] SEQ ID NO. 28: CAGAAGAAGGCAACTATAAGTAAGGACTGTAATCAACCGATGGT.

[0097] SEQ ID NO. 29: GATACCCATGCGCTTTACAAGCTGCGGTATATCGCTCTGTCATT.

[0098] Preferably, the method for preparing the tetrahedral shape includes: annealing four single-stranded DNA strands to form six complementary base pairing regions, wherein the six complementary base pairing regions are the six edges of the tetrahedron.

[0099] Preferably, the six complementary base pairing regions are of equal length, with a length ≥15bp and ≤40bp (e.g., they can be 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, 22bp, 24bp, 26bp, 28bp, 30bp, 32bp, 34bp, 36bp, 38bp, or 40bp, etc.).

[0100] For example, a tetrahedral shape with an arm length of 15 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.30 to SEQ ID NO.33.

[0101] SEQ ID NO. 30: ACTAACACCATCGGTTAGCGCGCGCTTTAACCAAACTAATAAGCGTGT.

[0102] SEQ ID NO. 31: AAACCGATGGTGTTAGAAGCGCATGGGTATCCAGTTGCCTTCTTCTGC.

[0103] SEQ ID NO. 32: AATAAGTAAGGACTGTAGGTTAAAGCGCGCGCAGCAGAAGAAGGCAAC.

[0104] SEQ ID NO. 33: AACAGTCCTTACTTATAGGATACCCCATGCGCTAACACGCTTATTAGTT.

[0105] For example, a tetrahedral shape with an arm length of 18 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.34 to SEQ ID NO.37.

[0106] SEQ ID NO. 34: ACTAACACCATCGGTTGATAGCGCGCGCTTTAACCGCGAAACTAATAAGCGTGTTAG.

[0107] SEQ ID NO. 35: AATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGAGTTGCCTTCTTCTGCGGC.

[0108] SEQ ID NO. 36: AATAAGTAAGGACTGTGTGACGCGGTTAAAGCGCGCGCAGCCGCAGAAGAAGGCAAC.

[0109] SEQ ID NO. 37: ACACACAGTCCTTACTTATACGTGGATACCCATGCGCTACTAACACGCTTATTAGTT.

[0110] For example, a tetrahedral shape with an arm length of 20 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.66 to SEQ ID NO.69.

[0111] SEQ ID NO. 66: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.

[0112] SEQ ID NO. 67: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.

[0113] SEQ ID NO. 68: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAAC.

[0114] SEQ ID NO. 69: ACGCACACAGTCCTTACTTATAACCGTGGATACCCCATGCGCTAGTCTAACACGCTTATTAGTT.

[0115] For example, a tetrahedral shape with an arm length of 25 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.38 to SEQ ID NO.41.

[0116] SEQ ID NO. 38: ACTAACACCATCGGTTGATTGCTCCCAGCGCGCGCTTTAACCGCGCGGAGATAAACTAATAAGCGTGTTAGACCATAA.

[0117] SEQ ID NO. 39: AGGGAGCAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTACCTAAGTTGCCTTCTTCTGCGGCTCGATTA.

[0118] SEQ ID NO. 40: AATAAGTAAGGACTGTGTGCGGATCGAATCTCCGCGCGGTTAAAGCGCGCGCATAATCGAGCCGCAGAAGAAGGCAAC.

[0119] SEQ ID NO. 41: ACGATCCGCACACAGTCCTTACTTATATAGGTACCGTGGATACCCCATGCGCTATTATGGTCTAACACGCTTATTAGTT.

[0120] For example, a tetrahedral shape with an arm length of 32 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.42 to SEQ ID NO.45.

[0121] SEQ ID NO. 42: ACTAACACCATCGGTTGATTGCTCCCAACCGGGAGCGCGCGCTTTAACCGCGCGGAGATATGGACCAAACTAATAAGCGTGTTAGACCATAATAGATAG.

[0122] SEQ ID NO. 43: ACCGGTTGGGAGCAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTGGCTCAGGACAGAGTTGCCTTCTTCTGCGGCTCGGCGCTTACAGA.

[0123] SEQ ID NO. 44: AATAAGTAAGGACTGTGTGCGGGTTGGCACAGAAGGTCCATATCTCCGCGCGGTTAAAGCGCGCGCATCTGTAAGCGCCGAGCCGCAGAAGAAGGCAAC.

[0124] SEQ ID NO. 45: ATCTGTGCCAACCCGCACACAGTCCTTACTTATACTGTCCTGAGCCACCGTGGATACCCCATGCGCTACTATCTATTATGGTCTAACACGCTTATTAGTT.

[0125] For example, a tetrahedral shape with an arm length of 40 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.46 to SEQ ID NO.49.

[0126] SEQ ID NO. 46: ACTAACACCATCGGTTGATTGCCTCCCAACCGGGGCCCTCTCAGCGCGCGCTTTAACCGCGCGGAGATATGGACCCATTGAACAAACTAATAAGCGTGTTAGACCATAATAGATAGCCGCTCT T.

[0127] SEQ ID NO. 47: AGAGAGGGCCCCGGTTGGGAGCAATCAACCGATGGTGTTAGAAGCGCATGGGT ATCCACGGTGGCTCAGGACAGAGGACCTAAGTTGCCTTCTTCTGCGGCTCGGCGCTTACAGATTACTG CA.

[0128] SEQ ID NO. 48: AATAAGTAAGGACTGTGTGCGGGTTGGCACAGAGAGGGGCTAGTTCAATGGGT CCATATCTCCGCGCGGTTAAAGCGCGCGCATGCAGTAATCTGTAAGCGCCGAGCCGCAGAAGAAGGC AAC.

[0129] SEQ ID NO. 49: AAGCCCCTCTCTGTGCCAACCCGCACACAGTCCTTACTTATATAGGTCCTCTGTCCTGAGCCACCGTGGATACCCCATGCGCTAAAGAGCGGCTATCTATTATGGTCTAACACGCTTATTAGTT.

[0130] Preferably, the six complementary base pairing regions are of unequal length, and at least one complementary base pairing region has a length ≥15bp and ≤40bp (e.g., it can be 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, 22bp, 24bp, 26bp, 28bp, 30bp, 32bp, 34bp, 36bp, 38bp, or 40bp, etc.).

[0131] For example, a non-tetrahedron with one arm length of 10 bp and the other five arms length of 20 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.50 to SEQ ID NO.53.

[0132] SEQ ID NO. 50: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAG.

[0133] SEQ ID NO. 51: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.

[0134] SEQ ID NO. 52: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAAC.

[0135] SEQ ID NO. 53: ACGCACACAGTCCTTACTTATAACCGTGGATACCCCATGCGCTACTTATTAGTT.

[0136] Preferably, the six complementary base pairing regions are of unequal length, each ≥15bp and ≤40bp (e.g., they can be 15bp, 16bp, 17bp, 18bp, 19bp, 20bp, 22bp, 24bp, 26bp, 28bp, 30bp, 32bp, 34bp, 36bp, 38bp, or 40bp, etc.).

[0137] For example, a non-tetrahedron with three arms of 15 bp and the other three arms of 20 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.54 to SEQ ID NO.57.

[0138] SEQ ID NO. 54: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.

[0139] SEQ ID NO. 55: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCAGTTGCCTTCTTCTGC.

[0140] SEQ ID NO. 56: AATAAGTAAGGACTGTACGCGCGGTTAAAGCGCGCGCAGCAGAAGAAGGCAA C.

[0141] SEQ ID NO. 57: AACAGTCCTTACTTATAGGATACCCCATGCGCTAGTCTAACACGCTTATTAGTT.

[0142] For example, a non-tetrahedron with three arms of 25 bp and the other three arms of 20 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.58 to SEQ ID NO.61.

[0143] SEQ ID NO. 58: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.

[0144] SEQ ID NO. 59: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTACCTAAGTTGCCSEQ ID NO. 60: AATAAGTAAGGACTGTGTGCGGATCGACGCGCGGTTAAAGCGCGCGCATAATCGAGCCGCAGAAGAAGGCAAC.

[0145] SEQ ID NO. 61: ACGATCCGCACACAGTCCTTACTTATATAGGTACCGTGGATACCCCATGCGCTAGTCTAACACGCTTATTAGTT.

[0146] For example, a non-tetrahedron with one arm length of 30 bp and the other five arms length of 20 bp can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.62 to SEQ ID NO.65.

[0147] SEQ ID NO. 62: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGACCTCCCAACCG.

[0148] SEQ ID NO. 63: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.

[0149] SEQ ID NO. 64: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAAC.

[0150] SEQ ID NO. 65: ACGCACACAGTCCTTACTTATAACCGTGGATACCCCATGCGCTACGGTTGGGAGGTCTAACACGCTTATTAGTT.

[0151] Preferably, the one-dimensional structure comprises two linearly tandem double-stranded DNA strands and / or three linearly tandem double-stranded DNA strands.

[0152] Preferably, the method for preparing the two linearly tandem double-stranded DNAs includes: annealing three single-stranded DNAs to form two complementary base-pairing regions.

[0153] For example, two linearly tandem double-stranded DNAs with a single strand length of 2nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.91 to SEQ ID NO.93.

[0154] For example, two linearly tandem double-stranded DNAs with a single strand length of 5 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, and 94.

[0155] For example, two linearly tandem double-stranded DNAs with a single strand length of 10 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, and 95.

[0156] For example, two linearly tandem double-stranded DNAs with a single strand length of 20 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, and 96.

[0157] For example, two linearly tandem double-stranded DNAs with a single-strand length of 40 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, and 97.

[0158] Preferably, the method for preparing the three linearly tandem double-stranded DNAs includes: annealing four single-stranded DNAs to form three complementary base pairing regions.

[0159] For example, three linearly tandem double-stranded DNA strands with a single strand length of 2 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, 98, and 99.

[0160] For example, three linearly tandem double-stranded DNA strands with a single strand length of 2T can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, 99, 100.

[0161] For example, three linearly tandem double-stranded DNA strands with a single strand length of 10 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, 99, 101.

[0162] For example, three linearly tandem double-stranded DNA strands with a single strand length of 10T can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO. 91, 93, 99, 102.

[0163] Preferably, the method for preparing the parallel structure includes: annealing two single-stranded DNAs to form two complementary base pairing regions, wherein the two complementary base pairing regions do not intersect in a plane.

[0164] For example, a parallel structure of single-stranded DNA with a length of 3nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.103~SEQ ID NO.104.

[0165] For example, a parallel structure of single-stranded DNA with a length of 5 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.105~SEQ ID NO.106.

[0166] For example, a parallel structure with a length of 7 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.107~SEQ ID NO.108.

[0167] For example, a parallel structure with a length of 12 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.109 to SEQ ID NO.110.

[0168] For example, a parallel structure with a length of 22 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.111 to SEQ ID NO.112.

[0169] For example, a parallel structure with a length of 32 nt can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.113 to SEQ ID NO.114.

[0170] Preferably, the method for preparing the angled structure includes: annealing two single-stranded DNAs to form two complementary base pairing regions, wherein the two complementary base pairing regions intersect at a point on a plane.

[0171] For example, a 3nt long angled structure of single-stranded DNA with non-angled ends can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.115~SEQ ID NO.116.

[0172] For example, an angled structure with a length of 5nt can be prepared from single-stranded DNA with non-angled ends, as shown in SEQ ID NO.117 to SEQ ID NO.118.

[0173] For example, a 7nt long angled structure of single-stranded DNA with non-angled ends can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.119~SEQ ID NO.120.

[0174] For example, an angled structure with a length of 12nt can be prepared from single-stranded DNA with non-angled ends, as shown in SEQ ID NO.121 to SEQ ID NO.122.

[0175] For example, an angled structure with a length of 22nt can be prepared from single-stranded DNA with non-angled ends, as shown in SEQ ID NO.123 to SEQ ID NO.124.

[0176] For example, an angled structure with a length of 32nt can be prepared from single-stranded DNA with non-angled ends, as shown in SEQ ID NO.125 to SEQ ID NO.126.

[0177] Preferably, the method for preparing the framework DNA with unpaired base ends includes: annealing two single-stranded DNAs to form a complementary base pairing region.

[0178] For example, framework DNA with unpaired base ends can be prepared from single-stranded DNA with nucleic acid sequences such as SEQ ID NO.1 to SEQ ID NO.2.

[0179] Preferably, the framework DNA is loaded in a pharmaceutically acceptable vector.

[0180] In this invention, efficient entry of framework DNA into the cytoplasm is crucial for its antipathogenic effect. With the assistance of a carrier, the carrier type can be any of the following capable of efficient cytoplasmic delivery: cationic liposomes, micelles, nanoemulsions, lipid nanoparticles, lipid-like nanoparticles, solid lipid nanoparticles, lipid-polymer hybrid nanoparticles, exosomes, polymer nanoparticles, gold nanoparticles, etc. Furthermore, cytoplasmic delivery of framework nucleic acids can also be achieved using carrier-independent nucleic acid modification strategies. Appropriate modifications to the framework DNA, such as cholesterol modification, cholesterol conjugation, or N-acetylgalactosamine modification, can promote framework DNA entry into the cytoplasm and produce similar biological effects.

[0181] Preferably, the carrier comprises cationic liposomes.

[0182] In this invention, the lipid composition (cationic lipids and accessory lipids) of the cationic liposomes can be varied. The cationic lipids are not limited to DOTAP, but can also include 1,2-bis(octadecyl)oxy-3-methylammonium propane chloride (DOTMA), dimethyl di(octadecyl)ammonium bromide (DODAB), 1,2-tetracosoxypropyl-3-dimethyl-hydroxyethylammonium bromide (DMRIE), dimethyl-5-hydroxypentyl-2,3-diolenoyloxypropylammonium bromide (DORIE), didecyl dimethylammonium bromide (DDAB), and ethylphosphatidylcholine (ePC). Lipids with a permanent positive charge, such as dioleoyldimethylammonium chloride (DODAC), are included. Accessory lipids are not limited to cholesterol but also include neutral lipids such as 1,2-distearyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-bis(cis-9-oleoyl)-sn-glycerol-3-phosphate choline (DOPC), 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE), 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine (DSPE), and 2-oleoyl-1-palmitoyl-sn-glycerol-3-phosphate ethanolamine (POPE). The molar ratio of these two types of lipids can range from 5:1 to 1:5.

[0183] In this invention, the cationic liposome loaded with framework DNA (named framework DNA-LPX) is formed by mixing cationic liposomes and framework DNA. When mixing, the N / P ratio of the two can be selected as 10:1-1:10.

[0184] In this invention, the preparation method of cationic liposomes includes, but is not limited to, the membrane hydration method. Taking the membrane hydration method as an example, firstly, cationic lipids (including but not limited to N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP)) and auxiliary lipids (including but not limited to cholesterol) are dissolved separately in an organic solvent (optional solvents include, but are not limited to, anhydrous ethanol). The cationic lipid solution and the auxiliary lipid solution are mixed evenly at a molar ratio of 1:5-5:1 and transferred to a rotary evaporator. The mixture is rotary evaporated at a speed of 10-500 rpm and a temperature of 20-70°C for 10 min-24 h to obtain a lipid membrane. An appropriate amount of aqueous solution (including but not limited to water, PBS, physiological saline, 5% glucose, and 10% sucrose solution, etc.) is added to hydrate the lipid membrane, and the membrane is allowed to stand. The lipid solution was sequentially passed through filter membranes with pore sizes of 200 nm and 100 nm to adjust the particle size of the liposomes. The resulting cationic liposomes had a particle size of 100-500 nm, uniform particle distribution (PDI < 0.5), and good stability (can be stored at 4 °C for more than 1 year).

[0185] In this invention, a type of cationic liposome was prepared that can be used for in vitro and in vivo delivery of framework nucleic acids. Preferably, the cationic liposome is composed of cationic lipid DOTAP and auxiliary lipid cholesterol in a molar ratio of 1:2.

[0186] This invention prepares a specific cationic liposome-loaded framework DNA with good stability, enabling efficient delivery and exhibiting good type I interferon stimulation ability, inducing the activation of immune-related proteins such as IRF3, JAK1, STAT1, and STAT2.

[0187] Preferably, the method for preparing the vector-loaded framework DNA (named framework DNA-LPX) includes: diluting framework DNA with one-dimensional, two-dimensional or three-dimensional structures composed of different sequences to 1 mg / mL, and mixing the diluted framework DNA with cationic liposome solution at an N / P ratio of 1:5-5:1, wherein the mixing can be performed using a pipette.

[0188] In a second aspect, the present invention provides the use of the framework DNA as described in the first aspect in the preparation of agonists of cyclic guanosine-adenosine synthase.

[0189] Thirdly, the present invention provides the use of the framework DNA as described in the first aspect in the preparation of type I interferon synthesis agonists.

[0190] Preferably, the type I interferon includes IFN-α and / or IFN-β.

[0191] Preferably, the IFN-α includes any one or a combination of at least two of IFN-α1, IFN-α2, IFN-α4, IFN-α7, or IFN-α14.

[0192] Other specific point values ​​within the range of the above values ​​can be selected, and will not be elaborated on here.

[0193] Compared with the prior art, the present invention has the following beneficial effects:

[0194] (1) The framework DNA (including 1D, 2D, and 3D) provided by this invention can effectively activate cGAS by regulating the strength of cGAS phase separation through dimensional factors. The arm length is ≥15bp and ≤40bp. It can be used as an agonist of the cGAS-STING signaling pathway. It has a stronger cGAS binding ability than existing commercial agonists. By promoting dimerization and LLPS, the highly concentrated cGAS accelerates cGAMP synthesis, enhances the generation of type I interferon downstream of the cGAS-STING signaling pathway, and can be used to treat pathogen infections such as tumors, bacterial infections, viral (including DNA and RNA viruses) infections, and parasitic infections.

[0195] (2) The 1D, 2D and 3D framework DNA provided by the present invention are relatively uniform in size and morphology, and have strong stability. They can be any kind of framework DNA with 1D, 2D or 3D structure, and the sequence composition can be random sequence. They have great assembly accessibility and a variety of application prospects. Attached Figure Description

[0196] Figure 1 This is a structural diagram of the framework DNA prepared in Example 1;

[0197] Figure 2 This is a diagram illustrating the formation process of the framework DNA 3WJ, Tr, Cr, Qu, Py, and Tp in Example 1.

[0198] Figure 3 This is a diagram illustrating the formation process of the framework DNATDN in Example 2;

[0199] Figure 4 Figure 2 shows the results of atomic force microscopy and dynamic light scattering analysis of TDN in Example 2;

[0200] Figure 5 The above figures show the IFN-β content in the supernatant of RAW 264.7 cells after transfection with framework DNA in Example 2. Figure A shows the IFN-β content in the supernatant of RAW 264.7 cells after transfection with different types of TDN, and Figure B shows the IFN-β content in the supernatant of RAW 264.7 cells after transfection with TDN and its corresponding assembly unit.

[0201] Figure 6 The graph shows the IFN-β content in the supernatant after transfecting different types of RAW 264.7 cells with framework DNA in Example 3.

[0202] Figure 7 This is a graph showing the IFN-β content in the supernatant after transfecting THP-1 cells with framework DNA in Example 4.

[0203] Figure 8 This is a graph showing the IFN-β content in the supernatant after transfecting BMDC cells with framework DNA in Example 4.

[0204] Figure 9 This is a graph showing the IFN-α1 content in the supernatant after transfection of BMDC cells with framework DNA in Example 4.

[0205] Figure 10 This is a graph showing the cGAMP content generated by the activation of cGAS by the framework DNA in Example 5.

[0206] Figure 11 This is a phase separation droplet diagram of the framework DNA and cGAS mixture in Example 6;

[0207] Figure 12 This is a phase separation diagram of different concentrations of framework DNA mixed with cGAS in Example 7;

[0208] Figure 13 This is a representative live cell image of cGAS-DNA spots obtained by confocal microscopy after transfecting GFP-cGAS-reconstructed cGAS-knockout MEF cells with framework DNA from Example 8.

[0209] Figure 14 This is a graph showing the statistical results of the number of spots per 100 cells in Example 8;

[0210] Figure 15 Figure 1 shows the comparison results of the ability of framework DNA with different dimensions and side lengths to prevent HSV-EGFP virus infection. Figure 2a shows a representative photograph of HSV-EGFP virus amplification 24 hours after infection, with a scale bar of 100 μm; Figure 3b shows the quantitative statistics of EGFP fluorescence intensity in Figure 2a; Figure 4c shows a representative photograph of HSV-EGFP virus amplification 48 hours after infection, with a scale bar of 100 μm; Figure 5d shows the quantitative statistics of EGFP fluorescence intensity in Figure 4c.

[0211] Figure 16 Figure 1 shows a comparison of the therapeutic effects of framework DNA with different dimensions and side lengths after HSV-EGFP virus infection. Figure 2a shows a representative photograph of HSV-EGFP virus amplification 24 hours after treatment, with a scale bar of 100 μm. Figure 3b shows the quantitative statistics of EGFP fluorescence intensity in Figure 2a. Figure 4c shows a representative photograph of HSV-EGFP virus amplification 48 hours after treatment, with a scale bar of 100 μm. Figure 5d shows the quantitative statistics of EGFP fluorescence intensity in Figure 4c.

[0212] Figure 17 Comparison of the ability of framework DNA composed of different sequences to prevent H5N1 influenza virus infection. Figure a shows the experimental procedure; Figure b shows the results of preventing H5N1 virus infection in A549 cells by plaque assay; Figure c shows the results of preventing H5N1 virus infection in A549 cells by immunoblotting assay; Figure d shows the results of preventing H5N1 virus infection in THP-1 cells by plaque assay.

[0213] Figure 18Figure 1 shows the results of a study on the mechanism by which framework DNA prevents HSV-EGFP virus infection. Figure 2a shows a representative image of HSV-EGFP virus amplification 24 hours after infection following inhibition of the cGAS-STING pathway (scale bar: 100 μm). Figure 3b shows the quantitative statistics of EGFP fluorescence intensity in Figure 2a. Figure 4c shows a representative image of HSV-EGFP virus amplification 48 hours after infection following inhibition of the cGAS-STING pathway (scale bar: 100 μm). Figure 5d shows the quantitative statistics of EGFP fluorescence intensity in Figure 4c.

[0214] Figure 19 The results show the ability of framework DNA as an adjuvant to enhance antibody responses against SARS-CoV-2 RBD protein. Figure a shows the IgG levels against recombinant RBD protein at different serum dilutions (expressed as absorbance at 450 nm), and Figure b shows the IgG levels measured by ELISA at a 1:50 dilution (expressed as absorbance at 450 nm). Detailed Implementation

[0215] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0216] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0217] Reagents:

[0218] CpG and DNA strands were synthesized by Sangon Biotechnology. Dulbecco modified Eagle medium (DMEM; catalog 319-005-CL), fetal bovine serum (FBS; catalog 085-150), and RPMI 1640 medium (catalog C11875500BT) were purchased from Wisent Bio Products. H-151 (catalog inh-h151), poly(dA:dT) (catalog tlrl-patn-1), and luciferase assay kit (catalog rep-qlc4lg1) were supplied by Invivogen. G150 (catalog HY-128583), acyclovir (catalog HY-17422), oseltamivir (catalog HY-13317), and ribavirin (catalog HY-B0434) were supplied by MedChemExpress. Lipo2000 (catalog 11668019) was purchased from Thermo Scientific. Human IFNβ ELISA kit (catalog number DY814-05) was provided by R&D Systems. Mouse IFNα1 ELISA kit (catalog number 447904), purified anti-mouse IFNβ (catalog number 519202), biotinylated anti-mouse IFNβ (catalog number 508105), and recombinant mouse IFNβ (catalog number 581309) were provided by Biolegend. GM-CSF (catalog number 51048-MNAH) and IL-4 (catalog number 51084-MNAE) were purchased from Sino Biological. 2-Mercaptoethanol, cholesterol, and DOTAP were purchased from Sigma.

[0219] cell:

[0220] RAW 264.7, THP-1, A549, and Vero cells were obtained from the Cell Resource Center of Peking Union Medical College. RAW-Lucia ISG cells were donated by Dr. Xueguang Lü from the Institute of Chemistry, Chinese Academy of Sciences. RAW 264.7, Vero, A549, and RAW-Lucia ISG cells were cultured in DMEM medium containing 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 μg / mL streptomycin. THP-1 cells were maintained in RPMI 1640 medium containing 10% FBS, 100 U / mL penicillin, 100 μg / mL streptomycin, and 50 μM 2-mercaptoethanol. All cells were cultured in a humidified incubator at 37°C and 5% CO2, and the results showed no mycoplasma contamination.

[0221] Bone marrow cells (BMDCs) were obtained from 6-8 week old female C57BL / 6 mice. Briefly, bone marrow cells were flushed from the tibia and femur of C57BL / 6 mice and cultured in RPMI 1640 medium containing 10% FBS, 100 U / mL penicillin, 100 μg / mL streptomycin, 20 ng / mL GM-CSF, and 10 ng / mL IL-4. Half of the medium was replaced every 2 days. On day 6, non-adherent and loosely adherent immature dendritic cells were collected for further experiments.

[0222] Mice:

[0223] C57BL / 6 and BALB / c mice (female, 6-8 weeks old) were purchased from Vital River. They were housed in specific pathogen-free and environmentally controlled animal enclosures (temperature 22±2℃, humidity 40-70%, 12-hour light / dark cycle) with free access to food and water.

[0224] Example 1

[0225] This embodiment prepared a framework DNA. The preparation method includes the following steps: an equimolar mixture of raw single-stranded DNA was added to TM buffer (10-40 mM Tris HCl pH 7.5-8.0, 2-5 mM MgCl2). The mixture was vortexed thoroughly to ensure complete mixing. Annealing was performed using a PCR thermal cycler. The annealing program was 90-95℃ for 10-20 min, followed by cooling to 2-4℃ for 20-30 min. The mixture was then stored at -20℃ for later use. The obtained framework DNA with 1D, 2D, or 3D structures is shown below. Figure 1 As shown, the formation process of the framework DNA was analyzed using gel electrophoresis, including the formation processes of 3WJ, Tr, Cr, Qu, Py, and Tp. Figure 2 As shown.

[0226] The structure of 1D overframe DNA is as follows: dsDNA-2S consists of three single-stranded DNA molecules that have annealed to form two complementary base pairing regions. Between these complementary base pairing regions, there are also free regions of single-stranded DNA that have not been paired with any bases. dsDNA-3S consists of four single-stranded DNA molecules that have annealed to form three complementary base pairing regions. Between these complementary base pairing regions, there are also free regions of single-stranded DNA that have not been paired with any bases.

[0227] Based on the distance between the linearly tandem double-stranded DNAs in the 1D structure (the length of the single-stranded DNA linking the two strands), dsDNA-2S is further divided into dsDNA-2S-2nt, dsDNA-2S-5nt, dsDNA-2S-10nt, dsDNA-2S-20nt, and dsDNA-2S-40nt. Taking dsDNA-2S-2nt as an example, 2S refers to two double-stranded DNAs, and 2nt refers to the length of the single-stranded DNA linking the two double-stranded DNAs being 2nt (random bases), and so on. All one-dimensional DNA structures, parallel DNA structures, and angled DNA structures mentioned in the text adopt this naming method. dsDNA-3S is further divided into dsDNA-3S-2nt, dsDNA-3S-2T, dsDNA-3S-10nt, and dsDNA-3S-10T, where 2T refers to the length of the single-stranded DNA linking the two double-stranded DNAs being 2 T bases, and so on.

[0228] The structures of framework DNA with 2D structures are as follows: QU-2S consists of two complementary base-pairing regions formed after annealing two single-stranded DNA molecules, located on the same plane and not intersecting; Tr-2S consists of two complementary base-pairing regions formed after annealing two single-stranded DNA molecules, located on the same plane and intersecting at a single point, which is the endpoint of the two complementary base-pairing regions; ab consists of one complementary base-pairing region formed after annealing two single-stranded DNA molecules, and outside the complementary base-pairing region, the single-stranded DNA also has free regions that are not complementary to any bases; Circ consists of one complementary base-pairing region formed after annealing two single-stranded DNA molecules; abc consists of three complementary base-pairing regions formed after annealing three single-stranded DNA molecules, spatially adjacent to each other. The three complementary base pairing regions (C, Q, and Q) intersect at a single point, which is the endpoint of the three complementary base pairing regions, and the three complementary base pairing regions are not coplanar; 3WJ represents three complementary base pairing regions formed after annealing three single-stranded DNA strands, located on the same plane and intersecting at a single point, which is the endpoint of the three complementary base pairing regions; Tr represents three complementary base pairing regions formed after annealing three single-stranded DNA strands, which are the three sides of a triangle, forming a triangle; Cr represents four complementary base pairing regions formed after annealing four single-stranded DNA strands, located on the same plane and intersecting at a single point, which is the endpoint of the four complementary base pairing regions; Qu represents four complementary base pairing regions formed after annealing four single-stranded DNA strands, which are the four sides of a quadrilateral, forming a quadrilateral.

[0229] Specifically, Qu-2S includes Qu-2S-3nt, Qu-2S-5nt, Qu-2S-7nt, Qu-2S-12nt, Qu-2S-22nt, Qu-2S-32nt, and Qu-2S-42nt. Tr-2S includes Tr-2S-3nt, Tr-2S-5nt, Tr-2S-7nt, Tr-2S-12nt, Tr-2S-22nt, and Tr-2S-32nt, with the single-stranded DNA at the corner end being 1nt in length, and the single-stranded DNA at the non-corner end being 3nt, 5nt, 7nt, 12nt, 22nt, and 32nt in length, respectively.

[0230] The structure of a 3D framework DNA is as follows: Py consists of five single-stranded DNA molecules that, after annealing, form eight complementary base pairing regions, which are the eight sides of a square pyramid, forming a square pyramid structure; Tp consists of five single-stranded DNA molecules that, after annealing, form nine complementary base pairing regions, which are the nine sides of a triangular prism, forming a triangular prism structure; TDN consists of four single-stranded DNA molecules that, after annealing, form six complementary base pairing regions, which are the six sides of a tetrahedron, forming a tetrahedral structure.

[0231] The TDN can be a regular tetrahedron with equal side lengths, meaning all six arms are of equal length, ≥15bp and ≤40bp. It can also be a non-regular tetrahedron (nTDN) with unequal side lengths, where at least one arm is ≥15bp and ≤40bp. For example, it could be a 10bp arm with five 20bp arms, a 30bp arm with five 20bp arms, three 15bp arms with three 20bp arms, or three 25bp arms with three 20bp arms. Specifically, nTDN includes nTDN-29-10bp, nTDN-47-25bp, nTDN-84-15bp, and nTDN-97-30bp, which are non-regular tetrahedral DNAs with five 20bp arms and one arm of 10bp, 15bp, 25bp, or 30bp lengths respectively.

[0232] DNA with unpaired base ends can be a diploid (ab), which is a 43nt long single-stranded DNA with unpaired base ends at both ends of a double strand.

[0233] Example 2

[0234] This embodiment determined the ability of randomly sequenced dsDNA to stimulate IFN-β secretion through preliminary experiments. dsDNA sequences with high and low IFN-β secretion levels were selected for constructing TDNs, resulting in three highly active dsDNA-assembled TDNs (HT, named HT1, HT2, and HT3) and three low-activity dsDNA-assembled TDNs (LT, named LT1, LT2, and LT3). The preparation process followed that in Example 1, and the TDN formation process was analyzed by gel electrophoresis. The results are as follows. Figure 3 As shown.

[0235] HT 1 is a tetrahedral framework DNA with an arm length of 20 bp prepared from the single-stranded DNA shown in SEQ ID NO.66 to SEQ ID NO.69.

[0236] SEQ ID NO. 66: ACTAACACCATCGGTTGATTGAGCGCGCGCTTTAACCGCGCGAAACTAATAAGCGTGTTAGAC.

[0237] SEQ ID NO. 67: ACAATCAACCGATGGTGTTAGAAGCGCATGGGTATCCACGGTAGTTGCCTTCTTCTGCGGCTC.

[0238] SEQ ID NO. 68: AATAAGTAAGGACTGTGTGCGACGCGCGGTTAAAGCGCGCGCAGAGCCGCAGAAGAAGGCAAC.

[0239] SEQ ID NO. 69: ACGCACACAGTCCTTACTTATAACCGTGGATACCCCATGCGCTAGTCTAACACGCTTATTAGTT.

[0240] HT 2 is a tetrahedral framework DNA with an arm length of 20 bp prepared from the single-stranded DNA shown in SEQ ID NO.70 to SEQ ID NO.73.

[0241] SEQ ID NO. 70: CTCCCAACCGGGGCCCTCTCAGAGATATGGACCCATTGAACACATAATAGATAGCCGCTCTTA.

[0242] SEQ ID NO. 71: GGCTCAGGACAGAGGACCTAAGTTCAATGGGTCCATATCTCAGGCGCTTACAGATTACTGCAA.

[0243] SEQ ID NO. 72: GAGAGGGCCCCGGTTGGGAGAGGTTGGCACAGAGAGGGGCTATGCAGTAATCTGTAAGCGCCA.

[0244] SEQ ID NO. 73: TAGGTCCCTGTCCTGAGCCAAGCCCCTCTCTGTGCCAACCAAAGAGCGGCTATCTATTATGA.

[0245] HT 3 is a tetrahedral framework DNA with an arm length of 20 bp, prepared from the single-stranded DNA shown in SEQ ID NO.74 to SEQ ID NO.77.

[0246] SEQ ID NO. 74: AAAGGGAAAGGGAAAGGGAAAAGCACGCGCCTTTAGCTTGCGACCTTTCTGACTCATGCTCGC.

[0247] SEQ ID NO. 75: ATTCCCTTTCCCTTTCCCTTAGCACGCGCCTTTCGCTTGCGAGATCGGTTGGTGCGCAAGAA.

[0248] SEQ ID NO. 76: ACGGGCAGTGACTTATTCGTGACGCAAGCGAAAGGCGCGTGCAGCGAGCATGAGTCAGAAAGG.

[0249] SEQ ID NO. 77: ACACGAATAAGTCACTGCCCGACGCAAGCTAAAGGCGCGTGCATTCTTGCGCACCAACCGATC.

[0250] LT 1 is a tetrahedral framework DNA with an arm length of 20 bp prepared from the single-stranded DNA shown in SEQ ID NO.78 to SEQ ID NO.81.

[0251] SEQ ID NO. 78: ACGATAGGTAAAAATATATGCAGTATTTACCTATTTCTATCGATACCCATTTAACCGTTAAGG.

[0252] SEQ ID NO. 79: AGCATATATTTTACCTATCGATCACCGAGGCGGTCGAGGATAGCACACACCTATCGCTTTCG.

[0253] SEQ ID NO. 80: ACCACCGGCTCGTCACCGTATAATCCTCGACCGCCTCGGTGAACCTTAACGGTTAAATGGGTA.

[0254] SEQ ID NO. 81: AATACGGTGACGAGCCGGTGGACGATAGAAATAGGTAAATACACGAAAGCGATAGGTGTGTGC.

[0255] LT 2 is a tetrahedral framework DNA with an arm length of 20 bp prepared from the single-stranded DNA shown in SEQ ID NO.82 to SEQ ID NO.85.

[0256] SEQ ID NO. 82: AACCGGAGACCCGTGAGTCTTAACGCCGATATGGATAATATTAGCACACACCTTTCGCTTTCG.

[0257] SEQ ID NO. 83: AAAGACTCACGGGTCTCCGGTAGAGGCTCAGTGAGCTTCTGAAGTATATACCTATTTCTATCG.

[0258] SEQ ID NO. 84: ACTTAACCCGTAAATGGGTAATCAGAAGCTCACTGAGCCTCACGAAAGCGAAAGGTGTGTGC.

[0259] SEQ ID NO. 85: ATACCCATTTACGGGTTAAGGAAATATTATCCATATCGGCGTACGATAGAAATAGGTATATAC.

[0260] LT 3 is a tetrahedral framework DNA with an arm length of 20 bp prepared from the single-stranded DNA shown in SEQ ID NO.86 to SEQ ID NO.89.

[0261] SEQ ID NO. 86: ATCGCTTCGAATCTATACGAGAATGCCTATTAGCCTTGAACGAGCACACTCCTTTAGCTATCG.

[0262] SEQ ID NO. 87: ACTCGTATAGATTCGAAGCGAACGACACGGCGCTAAATATATAGACTTAGCAGTACCTCTACG.

[0263] SEQ ID NO. 88: ACGATAGCGAAAGGAGTGTGCAATATATTTAGCGCCGTGTCGACGATAGCTAAAGGAGTGTGC.

[0264] SEQ ID NO. 89: AGCACACTCCTTTCGCTATCGACGTTCAAGGCTAATAGGCATACGTAGAGGTACTGCTAAGTC.

[0265] The morphology and size of each HT and LT were analyzed using atomic force microscopy (AFM) and dynamic light scattering (DLS), such as... Figure 4 As shown, the generated TDNs have relatively uniform size and morphology.

[0266] RAW 264.7 cells were transfected with HT 1, HT 2, HT 3, LT 1, LT 2, and LT 3 at concentrations of 2 μg / mL, with the commercially available agonist Poly(dA:dT) as a control. The IFN-β content in the supernatant was detected by ELISA after 24 hours. Results are as follows: Figure 5 As shown in Figure A, the TDN prepared in this invention has a better ability to stimulate IFN-β synthesis. RAW 264.7 cells were transfected with HT and LT at a concentration of 2 μg / mL, with their corresponding 20 bp assembly units (HT dsDNA mixture and LT dsDNA mixture) serving as controls. The IFN-β content in the supernatant was detected by ELISA after 24 h. The results are as follows... Figure 5 As shown in Figure B, the ability of dsDNA to stimulate IFN-β synthesis is significantly enhanced after assembling into TDN. Furthermore, Figure 5 This study demonstrated that the activation ability of TDN is independent of the nucleic acid sequence. In the dsDNA mixture, the activation ability of the HTs dsDNA mixture was significantly higher than that of the LTs dsDNA mixture, while there was no significant difference between HT and LT after the formation of TDN.

[0267] Example 3

[0268] In this example, four different types of RAW 264.7 cells (wild-type WT, cGAS, and Tr) were transfected with 3WJ, Tr, Cr, Qu, Py, Tp at a concentration of 2 μg / mL and TDN with an arm length of 20 bp. - / - Sting - / - and Tlr 9 - / -The framework DNA preparation process was performed according to Example 1. Commercially available cGAS agonist HT DNA (a natural double-stranded DNA sequence derived from herring testes) and G3-YSD (HIV-1-derived GGG-terminated Y-type 26-mer DNA), along with a 20 bp dsDNA mix, were used as control groups. After 24 hours, the IFN-β content in the supernatant was detected using ELISA. Results are as follows: Figure 6 As shown, framework DNA can increase the IFN-β content in the supernatant. When cGAS or Sting is missing, the IFN-β content in the supernatant does not change because the cGAS-STING signaling pathway is blocked. When Tlr9 is missing, framework DNA can increase the IFN-β content in the supernatant, which proves that framework DNA does not promote the secretion of IFN-β by immune cells through TLR9, but rather increases the IFN-β content in the supernatant by activating the cGAS-STING signaling pathway.

[0269] Example 4

[0270] In this embodiment, THP-1 cells were transfected with TDN, 3WJ, Tr, Cr, Qu, ab, and abc at a concentration of 2 μg / mL. The framework DNA preparation process was carried out in accordance with Example 1. Blank cells and commercial cGAS agonist G3-YSD were used as control groups. The IFN-β content in the supernatant was detected by ELISA after 24 h. Among them, the 10bp nTDN is a non-tetrahedron with one arm of length 10bp and the other five arms of length 20bp; the 15bp nTDN is a non-tetrahedron with three arms of length 15bp and the other three arms of length 20bp; the 25bp nTDN is a non-tetrahedron with three arms of length 25bp and the other three arms of length 20bp; the 30bp nTDN is a non-tetrahedron with one arm of length 30bp and the other five arms of length 20bp; and the 7bp TDN, 15bp TDN, 18bp TDN, 20bp TDN, 25bp TDN, 32bp TDN, and 40bp TDN are regular tetrahedrons with arm lengths of 7bp, 15bp, 18bp, 20bp, 25bp, 32bp, and 40bp, respectively. The results are as follows: Figure 7 As shown, at least one framework DNA with an arm length ≥15bp and ≤40bp provided by the present invention has the ability to increase IFN-β content.

[0271] In this embodiment, BMDC cells were transfected with TDN, 3WJ, Tr, Cr, Qu, ab, and abc at a concentration of 2 μg / mL. The framework DNA preparation process followed that in Example 1. HT DNA, the commercial agonist Poly(dA:dT), and G3-YSD were used as control groups. After 24 hours, the levels of IFN-β and IFN-α1 in the supernatant were detected using ELISA. The 7bp, 15bp, 20bp, and 25bp TDNs were tetrahedral with arm lengths of 7bp, 15bp, 20bp, and 25bp, respectively. The IFN-β content detection results are as follows: Figure 8 As shown, the detection results of IFN-α1 content are as follows: Figure 9 As shown, the framework DNA provided by this invention has the ability to increase the levels of IFN-β and IFN-α1 in various cells.

[0272] Example 5

[0273] In this embodiment, 2 μM cGAS was mixed with 1 μg TDN and 3 WJ, respectively. The framework DNA preparation process was performed according to Example 1. HT DNA and dsDNA mix with a side length of 20 bp were used as control groups. The cGAMP content was measured after 1 hour. The 7 bp TDN, 15 bp TDN, 20 bp TDN, and 25 bp TDN were tetrahedral with arm lengths of 7 bp, 15 bp, 20 bp, and 25 bp, respectively. The results are as follows: Figure 10 As shown, the framework DNA provided by this invention has the ability to activate cGAS, thereby promoting cGAMP synthesis.

[0274] Example 6

[0275] In this embodiment, 500 nM cGAS (3% Alexa Fluor 488 labeled) was mixed with 38 ng / μL TDN, 3WJ, and ab, respectively. The framework DNA preparation process was performed according to Example 1. A 20 bp side length ds20 mix was used as a control group. After mixing for 10 min, cGAS phase-separated droplet images were obtained using an inverted fluorescence microscope. T7, T15, T20, and T25 were tetrahedrals with arm lengths of 7 bp, 15 bp, 20 bp, and 25 bp, respectively. The results are as follows: Figure 11 As shown, the framework DNA provided by this invention has the ability to induce cGAS phase separation in vitro in a dimension-dependent and arm-length-determined manner.

[0276] Example 7

[0277] In this embodiment, 500 nM cGAS was mixed with different concentrations of TDN, 3WJ, ab, and abc, respectively. The framework DNA preparation process was performed according to Example 1. T7, T15, T20, and T25 were tetrahedrons with arm lengths of 7 bp, 15 bp, 20 bp, and 25 bp, respectively. ds20 mix with a side length of 20 bp served as a control group. After mixing for 10 minutes, the phase separation results are shown in the figure below. Figure 12 As shown, the framework DNA provided by this invention has an enhanced ability to induce phase separation of cGAS as the dimensionality increases.

[0278] Example 8

[0279] In this embodiment, GFP-cGAS reconstructed cGAS knockout MEF cells were transfected with ab, 3WJ, and TDN at a concentration of 2 μg / mL, respectively. A 20 bp dsDNA was used as a control group. Representative live-cell images of cGAS-DNA spots were obtained by confocal microscopy 4 hours later. The 7 bp TDN and 20 bp TDN were tetrahedral with arms of 7 bp and 20 bp, respectively. Cell images are shown below. Figure 13 As shown, the statistical results of the number of spots per 100 cells are as follows: Figure 14 As shown, the framework DNA provided by this invention has the ability to regulate cGAS phase separation in a dimension- and arm-length-dependent manner within cells.

[0280] 2 μM cGAS was mixed with 1 μg dsDNA-2S-2nt, dsDNA-2S-5nt, dsDNA-2S-10nt, dsDNA-2S-20nt, and dsDNA-2S-40nt in buffer (20 mM Hepes pH 7.2-8.0, 3 mM MgCl2, 150 mM NaCl2, 2 μM ATP, 2 μM GTP), with dsDNA as the control. The mixture was reacted at 37 °C for 1 h and then denatured at 95 °C for 10 min. The cGAMP yield was detected using a cGAMP ELISA Kit (Cayman). dsDNA-2S-2nt, dsDNA-2S-5nt, dsDNA-2S-10nt, dsDNA-2S-20nt, and dsDNA-2S-40nt were tandem double-stranded DNA with single-strand lengths of 2 nt, 5 nt, 10 nt, 20 nt, and 40 nt, respectively.

[0281] dsDNA was prepared from the single-stranded DNA shown in SEQ ID NO.90 to SEQ ID NO.91.

[0282] dsDNA-2S-2nt was prepared from single-stranded DNA as shown in SEQ ID NO.91 to SEQ ID NO.93.

[0283] dsDNA-2S-5nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, and 94.

[0284] dsDNA-2S-10nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, and 95.

[0285] dsDNA-2S-20nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, and 96.

[0286] dsDNA-2S-40nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, and 97.

[0287] SEQ ID NO. 90: AACTAATAAGCGTGTTAGAC.

[0288] SEQ ID NO. 91: GTCTAACACGCTTATTAGTT.

[0289] SEQ ID NO.92:

[0290] CTAACACCATCGGTTGATTGAGAACTAATAAGCGTGTTAGAC.

[0291] SEQ ID NO. 93: CAATCAACCGATGGTGTTAG.

[0292] SEQ ID NO.94:

[0293] CTAACACCATCGGTTGATTGAGCGCAACTAATAAGCGTGTTAGAC.

[0294] SEQ ID NO.95:

[0295] CTAACACCATCGGTTGATTGAGCGCATGGGAACTAATAAGCGTGTTAGAC.

[0296] SEQ ID NO.96:

[0297] CTAACACCATCGGTTGATTGAGCGCATGGGTATCCACGGTAACTAATAAGCGTGTTAGAC.

[0298] SEQ ID NO.97:

[0299] CTAACACCATCGGTTGATTGAGCGCATGGGTATCCACGGTATAAGTAAGGACTGTGTGCGAACTAATAAGCGTGTTAGAC.

[0300] 2 μM cGAS was mixed with 1 μg dsDNA-3S-2nt, dsDNA-3S-2T, dsDNA-3S-10nt, and dsDNA-3S-10T in buffer (20 mM Hepes pH 7.2-8.0, 2-5 mM MgCl2, 150 mM NaCl2, 2 μM ATP, 2 μM MTP). dsDNA with a side length of 20 bp was used as the control group. The reaction was carried out at 37 °C for 1 h, followed by denaturation at 95 °C for 10 min. cGAMP production was detected using a cGAMP ELISA Kit (Cayman). dsDNA-3S-2nt, dsDNA-3S-2T, dsDNA-3S-10nt, and dsDNA-3S-10T were tandem double-stranded DNA with single-strand lengths of 2 nt (two random bases), 2T (two T bases), 10 nt (ten random bases), and 10T (ten T bases), respectively.

[0301] dsDNA-3S-2nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, 98, and 99.

[0302] dsDNA-3S-2T was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, 99, and 100.

[0303] dsDNA-3S-10nt was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, 99, and 101.

[0304] dsDNA-3S-10T was prepared from single-stranded DNA as shown in SEQ ID NO. 91, 93, 99, and 102.

[0305] SEQ ID NO.98:

[0306] CTAACACCATCGGTTGATTGAGAACTAATAAGCGTGTTAGACAT.

[0307] SEQ ID NO.99:

[0308] GTTGCCTTCTTCTGCGGCTCGAGCCGCAGAAGAAGGCAAC.

[0309] SEQ ID NO.100:

[0310] CTAACACCATCGGTTGATTGTTAACTAATAAGCGTGTTAGACTTGTTGCCTTCTTCTGCGGCTC.

[0311] SEQ ID NO.101:

[0312] CTAACACCATCGGTTGATTGAGCGCATGGGAACTAATAAGCGTGTTAGACATAAGTAAGGGTTGCCTTCTTCTGCGGCTC.

[0313] SEQ ID NO.102:

[0314] CTAACACCATCGGTTGATTGTTTTTTTTTTAACTAATAAGCGTGTTAGACTTTTTTTTTTGTTGCCTTCTTCTGCGGCTC.

[0315] 2 μM cGAS was mixed with 1 μg of Qu-2S-3nt, Qu-2S-5nt, Qu-2S-7nt, Qu-2S-12nt, Qu-2S-22nt, and Qu-2S-32nt and added to buffer (20 mM Hepes pH 7.2-8.0, 3 mM MgCl2, 150 mM NaCl2, 2 μM ATP, 2 μM GTP). The mixture was reacted at 37 °C for 1 h and then denatured at 95 °C for 10 min. The cGAMP yield was detected using the cGAMP ELISA Kit (Cayman). Qu-2S-3nt, Qu-2S-5nt, Qu-2S-7nt, Qu-2S-12nt, Qu-2S-22nt, and Qu-2S-32nt were parallel double-stranded DNA with single-strand lengths of 3nt, 5nt, 7nt, 12nt, 22nt, and 32nt, respectively.

[0316] Qu-2S-3nt was prepared from the single-stranded DNA shown in SEQ ID NO.103 to SEQ ID NO.104.

[0317] Qu-2S-5nt was prepared from the single-stranded DNA shown in SEQ ID NO.105 to SEQ ID NO.106.

[0318] Qu-2S-7nt was prepared from the single-stranded DNA shown in SEQ ID NO.107 to SEQ ID NO.108.

[0319] Qu-2S-12nt was prepared from the single-stranded DNA shown in SEQ ID NO.109 to SEQ ID NO.110.

[0320] Qu-2S-22nt was prepared from the single-stranded DNA shown in SEQ ID NO.111 to SEQ ID NO.112.

[0321] Qu-2S-32nt was prepared from the single-stranded DNA shown in SEQ ID NO.113 to SEQ ID NO.114.

[0322] SEQ ID NO.103:

[0323] AACTAATAAGCGTGTTAGACATACTAACACCATCGGTTGATTG.

[0324] SEQ ID NO.104:

[0325] GTCTAACACGCTTTAGTTAGACAATCAACCGATGGTGTTTAG.

[0326] SEQ ID NO.105:

[0327] AACTAATAAGCGTGTTAGACAGGTACTAACACCATCGGTTGATTG.

[0328] SEQ ID NO.106:

[0329] GTCTAACACGCTTTAGTTAGCGACAATCAACCGATGGTGTTTAG.

[0330] SEQ ID NO.107:

[0331] AACTAATAAGCGTGTTAGACAACGGTACTAACACCATCGGTTGATTG.

[0332] SEQ ID NO.108:

[0333] GTCTAACACGCTTTAGTTAGTGCGACAATCAACCGATGGTGTTAG.

[0334] SEQ ID NO.109:

[0335] AACTAATAAGCGTGTTAGACATATCCACGGTACTAACACCATCGGTTGATTG.

[0336] SEQ ID NO.110:

[0337] GTCTAACACGCTTATTAGTTAACTGTGTGCGACAATCAACCGATGGTGTTAG。

[0338] SEQ ID NO.111:

[0339] AACTAATAAGCGTGTTAGACAAGCGCATGGGTATCCACGGTACTAACACCATCGGTTGATTG。

[0340] SEQ ID NO.112:

[0341] GTCTAACACGCTTATTAGTTAATAAGTAAGGACTGTGTGCGACAATCAACCGATGGTGTTAG。

[0342] SEQ ID NO.113:

[0343] AACTAATAAGCGTGTTAGACAAGCGCATGGGTATCCACGGTATAAGTAAGGACTAACACCATCGGTTGATTG。

[0344] SEQ ID NO.114:

[0345] GTCTAACACGCTTATTAGTTAATAAGTAAGGACTGTGTGCGGGCGCTTACAACAATCAACCGATGGTGTTAG。

[0346] 2 μM cGAS was mixed with 1 μg of Tr-2S-3nt, Tr-2S-5nt, Tr-2S-7nt, Tr-2S-12nt, Tr-2S-22nt, and Tr-2S-32nt respectively and added to buffer (20 mM Hepes pH 7.2-8.0, 2-5 mM MgCl2, 150 mM NaCl2, 2 μM ATP, 2 μM GTP). The mixture was reacted at 37°C for 1 h, followed by denaturation at 95°C for 10 min, and then analyzed using cGAMP. The ELISA Kit (Cayman) was used to detect cGAMP production. The single-stranded DNA at the corner ends of the Tr-2S-3nt, Tr-2S-5nt, Tr-2S-7nt, Tr-2S-12nt, Tr-2S-22nt, and Tr-2S-32nt were 1nt in length, while the single-stranded DNA at the non-corner ends were 3nt, 5nt, 7nt, 12nt, 22nt, and 32nt, respectively, which were double-stranded DNA at the corner ends.

[0347] Tr-2S-3nt was prepared from the single-stranded DNA shown in SEQ ID NO.115 to SEQ ID NO.116.

[0348] Tr-2S-5nt was prepared from the single-stranded DNA shown in SEQ ID NO.117 to SEQ ID NO.118.

[0349] Tr-2S-7nt was prepared from the single-stranded DNA shown in SEQ ID NO.119 to SEQ ID NO.120.

[0350] Tr-2S-12nt was prepared from the single-stranded DNA shown in SEQ ID NO.121 to SEQ ID NO.122.

[0351] Tr-2S-22nt was prepared from the single-stranded DNA shown in SEQ ID NO.123 to SEQ ID NO.124.

[0352] Tr-2S-32nt was prepared from the single-stranded DNA shown in SEQ ID NO.125 to SEQ ID NO.126.

[0353] SEQ ID NO.115:

[0354] CTAACACCATCGGTTGATTGATAAACTAATAAGCGTGTTAGAC.

[0355] SEQ ID NO.116:

[0356] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT。

[0357] SEQ ID NO.117:

[0358] CTAACACCATCGGTTGATTGAGGTAAACTAATAAGCGTGTTAGAC。

[0359] SEQ ID NO.118:

[0360] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT。

[0361] SEQ ID NO.119:

[0362] CTAACACCATCGGTTGATTGAACGGTAAACTAATAAGCGTGTTAGAC。

[0363] SEQ ID NO.120:

[0364] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT。

[0365] SEQ ID NO.121:

[0366] CTAACACCATCGGTTGATTGATATCCACGGTAAACTAATAAGCGTGTTAGAC。

[0367] SEQ ID NO.122:

[0368] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT。

[0369] SEQ ID NO.123:

[0370] CTAACACCATCGGTTGATTGAAGCGCATGGGTATCCACGGTAAACTAATAAGCGTGTTAGAC。

[0371] SEQ ID NO.124:

[0372] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT。

[0373] SEQ ID NO.125:

[0374] CTAACACCATCGGTTGATTGAAGCGCATGGGTATCCACGGTATAAGTAAGGAAACTAATAAGCGTGTTAGAC.

[0375] SEQ ID NO.126:

[0376] CAATCAACCGATGGTGTTAGAGTCTAACACGCTTATTAGTT.

[0377] 2 μM cGAS was mixed with 1 μg nTDN-29-10bp, nTDN-47-25bp, nTDN-84-15bp, and nTDN-97-30bp in buffer (20 mM Hepes pH 7.2-8.0, 3 mM MgCl2, 150 mM NaCl2, 2 μM ATP, 2 μM GTP), with TDN-20bp (20 bp tetrahedral DNA) as the control. The reaction was carried out at 37 °C for 1 h, followed by denaturation at 95 °C for 10 min. The cGAMP yield was detected using a cGAMP ELISA Kit (Cayman). nTDN-29-10bp, nTDN-84-15bp, nTDN-47-25bp, and nTDN-97-30bp consisted of five 20 bp arms, with one non-tetrahedral DNA arm containing 10 bp, 15 bp, 25 bp, and 30 bp DNA, respectively.

[0378] nTDN-29-10bp was prepared from the single-stranded DNA shown in SEQ ID NO.50 to SEQ ID NO.53.

[0379] nTDN-47-25bp was prepared from the single-stranded DNA shown in SEQ ID NO.58 to SEQ ID NO.61.

[0380] nTDN-84-15bp was prepared from the single-stranded DNA shown in SEQ ID NO.54 to SEQ ID NO.57.

[0381] nTDN-97-30bp was prepared from the single-stranded DNA shown in SEQ ID NO.62 to SEQ ID NO.65.

[0382] The method for preparing the ring includes: annealing two single-stranded DNAs to form a base-complementary pairing region; and preparing the ring from single-stranded DNA with nucleic acid sequences as shown in SEQ ID NO.127 to SEQ ID NO.128.

[0383] Example 9

[0384] This embodiment tests the DNA framework to prevent herpes simplex virus (HSV) infection in a dimension-dependent manner.

[0385] EGFP-modified HSV virus (HSV-EGFP) was purchased from Brinkes. THP-1 cells were seeded in 24-well plates and treated with PMA (Sigma) for 48–72 hours to promote cell adhesion. Control group (20 bp dsDNA, ds20mix), two-dimensional framework DNA (3WJ), and three-dimensional framework DNA (DNA tetrahedra with side lengths of 7 bp (T7), 15 bp (T15), 20 bp (T20), and 25 bp (T25)) were transfected into the cells using a lipo2000 transfectant. Alternatively, cells were treated with 2 μM lymphavirlin (RV). After 18 hours, to infect THP-1 cells, the supernatant was aspirated, and serum-free medium containing HSV-EGFP (MOI = 5) was added. After 1 hour of viral infection, the supernatant was discarded, and the cells were placed in an incubator for further culture. Representative fluorescence images were captured 24 or 48 hours later, and the amplification of HSV virus was assessed by the intensity of EGFP fluorescence.

[0386] The results are as follows Figure 15 As shown, the protective effect of framework DNA against HSV virus is related to its dimension, exhibiting a 3D > 2D > 1D pattern. Furthermore, the protective effect of framework DNA against HSV virus has a side length threshold (~15 bp); DNA tetrahedra with a side length of 7 bp (T7) have no protective effect. Three-dimensional framework DNA with a side length ≥15 bp (T15, T20, and T25) has a strong protective effect against HSV virus, making the virus almost undetectable after 24 or 48 hours. Its protective effect is significantly superior to the broad-spectrum antiviral drug lymphavirlin.

[0387] Example 10

[0388] In this embodiment, the DNA framework was tested to exert a therapeutic effect on herpes simplex virus (HSV) in a dimension-dependent manner.

[0389] THP-1 cells were seeded in 24-well plates and treated with PMA (Sigma) for 48-72 hours to promote cell adhesion. To infect THP-1 cells, the supernatant was aspirated, and serum-free medium containing HSV-EGFP (MOI=5) was added. After 1 hour of viral infection, the supernatant was discarded, and the cells were cultured in an incubator. Six hours later, control group (20 bp dsDNA, ds20 mix), two-dimensional framework DNA (3WJ), and three-dimensional framework DNA (DNA tetrahedra with side lengths of 7 bp (T7), 15 bp (T15), 20 bp (T20), and 25 bp (T25)) were transfected into the cells using a lipo2000 transfectant. Alternatively, cells were treated with 2 μM acyclovir (ACV). Representative fluorescence images were captured after 24 or 48 hours, and HSV viral amplification was assessed by EGFP fluorescence intensity.

[0390] The results are as follows Figure 16 As shown, the therapeutic effect of framework DNA against HSV virus is related to its dimension, exhibiting a 3D > 2D > 1D pattern. Furthermore, the therapeutic effect of framework DNA against HSV virus has a side length threshold (~15 bp); DNA tetrahedra with a side length of 7 bp (T7) do not have a therapeutic effect. Three-dimensional framework DNA with a side length ≥15 bp (T15, T20, and T25) has a strong therapeutic effect against HSV virus, and its therapeutic effect is not significantly different from that of acyclovir, a first-line treatment for HSV.

[0391] Example 11

[0392] In this embodiment, the test framework DNA was used to prevent influenza virus (H5N1) infection in a sequence-independent manner.

[0393] H5N1 was kindly provided by Researcher He Hongxuan of the Institute of Zoology, Chinese Academy of Sciences. THP-1 or A549 cells were seeded in 6-well plates and treated with PMA for 48-72 hours to promote THP-1 cell adhesion. Different DNA tetrahedra (HT1, HT2, LT1, and LT2) were transfected into the cells using a lipo2000 transfectant. Alternatively, cells were treated with 2 μM acyclovir (ACV), 3 μM lymphavirlin (RV), and 6 μM oseltamivir (OS). After 18 hours, the supernatant was aspirated, and serum-free medium containing H5N1 was added. After 1 hour of viral infection, the supernatant was discarded, and the cells were cultured in an incubator. After 24 hours, viral titers were detected by plaque assay or Western blotting. For plaque assay, the supernatant containing H5N1 virus was serially diluted and used to infect Vero cells. After culturing at 37°C for 2 days, the cells were stained with crystal violet, photographed, and the visible plaques were recorded. For immunoblotting, cell lysates are collected, and nucleoprotein (NP) proteins are used as biomarkers to assess viral transmission dynamics.

[0394] The results are as follows Figure 17 As shown, the three-dimensional DNA tetrahedron almost completely resisted the replication of H5N1 virus in both cell types, significantly outperforming the antiviral drugs acyclovir, ribavirin, and oseltamivir. Figure 17 Figure c shows that the viral preventive effect of framework DNA is sequence-independent; three-dimensional DNA tetrahedra composed of different sequences all exhibit strong preventive effects. Furthermore, since H5N1 is an RNA virus, combined with the preventive and therapeutic effects against the DNA virus HSV described in Examples 9 and 10, it can be concluded that framework DNA is a broad-spectrum antiviral agent with both preventive and therapeutic effects against DNA and RNA viruses.

[0395] Example 12

[0396] In this embodiment, the test framework DNA prevents HSV virus infection in a cGAS-STING-dependent manner.

[0397] THP-1 cells were seeded in 24-well plates and treated with PMA for 48-72 hours to promote cell adhesion. THP-1 cells were pretreated for 3 hours with DMSO, the STING inhibitor H-151 (5 μM), or the cGAS inhibitor G150 (10 μM), followed by transfection of 20 bp DNA tetrahedra (T20) into the cells using a lipo2000 transfectant or by treating the cells with an equal volume of culture medium (Mock). After 18 hours, to infect THP-1 cells, the supernatant was aspirated, and serum-free medium containing HSV-EGFP (MOI = 5) was added. After 1 hour of viral infection, the supernatant was discarded, and the cells were cultured in an incubator. Representative fluorescence images were captured after 24 or 48 hours, and the amplification of HSV virus was assessed by the intensity of EGFP fluorescence.

[0398] The results are as follows Figure 18 As shown, compared to the untreated group, treatment with DNA tetrahedrons (T20) significantly prevented HSV virus invasion; however, inhibition of cGAS and STING led to the loss of the therapeutic effect of DNA tetrahedrons (T20). These results indicate that the protective effect of framework DNA against viruses depends on the cGAS-STING pathway.

[0399] Example 13

[0400] In this embodiment, the test framework DNA, as an adjuvant, can induce specific antibodies against the SARS-CoV-2 RBD protein (RBD).

[0401] To utilize framework DNA as an adjuvant in vivo, a 20 bp DNA tetrahedron (T20) was used as an example. It was mixed with cationic liposomes (DOTAP / cholesterol, molar ratio 1:2) at an N / P ratio of 1:1.6 to obtain DNA tetrahedron (T20)-LPX. BALB / c mice (female, 6-8 weeks old, purchased from Vital River) were randomly divided into 5 groups of 5 mice each. Administration was performed via intramuscular injection of a mixture of T20-LPX and RBD (20 μg T20 and 1 μg RBD / dose / mouse), a mixture of CpG and RBD (20 μg CpG and 1 μg RBD / dose / mouse), a mixture of AddaVax and RBD (50 μL AddaVax and 1 μg RBD / dose / mouse), RBD (1 μg / dose / mouse), or PBS. The drug was injected on day 0, and serum was collected on day 14. The titer of RBD-specific antibodies in the serum was determined using the ELISA method (SouthernBiotech).

[0402] The results are as follows Figure 19As shown, compared with the RBD protein-only immunization group, the group using framework DNA (T20-LPX) as an adjuvant induced significantly higher RBD-specific antibody titers. More importantly, the antibody titers in the T20-LPX group were also significantly higher than those in the commercial adjuvants CpG and AddaVax groups. This evidence suggests that framework DNA is an excellent vaccine adjuvant that can promote antibody responses against the SARS-CoV-2 RBD protein, thereby protecting against pathogen infection.

[0403] In summary, this invention utilizes framework DNA with 2D or 3D structures to activate cGAS, resulting in a novel cGAS-STING signaling pathway agonist. It accelerates cGAMP synthesis, enhances the generation of type I interferon downstream of the cGAS-STING signaling pathway, exhibits relatively uniform size and morphology, and strong stability. It can be any type of framework DNA with 2D or 3D structures, and its sequence composition can be random. Its cGAS activation effect is significantly stronger than existing commercial agonists, demonstrating broad application prospects.

[0404] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. Application of framework DNA in the preparation of agents to combat pathogen infection.

2. The application according to claim 1, characterized in that, The pathogens include at least one of bacteria, viruses, or parasites; Preferably, the structure of the framework DNA includes at least one of a one-dimensional structure, a two-dimensional structure, or a three-dimensional structure.

3. The application according to claim 2, characterized in that, The one-dimensional structure comprises at least two linearly tandem double-stranded DNA strands; Preferably, the two-dimensional structure includes any one or a combination of at least two of the following: double-stranded, ring-shaped, shovel-shaped, three-way connection, triangle, cross-shaped, quadrilateral, parallel structure, or angled structure; the parallel structure includes two parallel double-stranded DNA strands; the angled structure includes two double-stranded DNA strands forming an angle greater than 0° and less than 180°. Preferably, the three-dimensional structure includes any one or a combination of at least two of the following: pyramidal, triangular prism, or tetrahedral shapes. Preferably, the tetrahedral shape includes a regular tetrahedral shape and / or at least one non-regular tetrahedral shape with an angle less than 60°; Preferably, the framework DNA also has unpaired base ends.

4. The agonist of the cGAS-STING signaling pathway according to claim 3, characterized in that, In the one-dimensional structure, double-stranded DNA is linked by single-stranded DNA, and the length of the single-stranded DNA is ≥1 nt; preferably 1 to 40 nt. Preferably, in the parallel structure, one end of a double-stranded DNA is connected to the other end of a double-stranded DNA via single-stranded DNA, and the length of the single-stranded DNA is ≥1 nt; preferably 1 to 42 nt. Preferably, in the angled structure, one end of a double-stranded DNA is connected to the other end of a double-stranded DNA via single-stranded DNA, the length of the single-stranded DNA at the angled end is ≥1nt, and the length of the single-stranded DNA at the non-angled end is ≥2nt. Preferably, the length of the single-stranded DNA at the angled end is 1–38 nt, and the length of the single-stranded DNA at the non-angled end is 2–40 nt. Preferably, the side length of the tetrahedral DNA is ≥15bp; Preferably, the side length of the tetrahedral DNA is ≥15bp and ≤40bp; Preferably, the length of the unpaired base ends in the DNA is ≥2 nt, and it contains at least one G base; Preferably, the length of the unpaired base terminus in the DNA is 2 to 43 nt, and it contains at least one G base.

5. The application according to any one of claims 1 to 4, characterized in that, The raw materials for preparing the framework DNA include at least two single-stranded DNAs with complementary base pairing regions. Preferably, the framework DNA contains at least one base-complementary pairing region; Preferably, the framework DNA contains at least one base-complementary pairing region with a length ≥15bp and ≤40bp; Preferably, the complementary base pairing region is formed by annealing at least two single-stranded DNA molecules; The method for preparing the framework DNA includes: mixing at least two single-stranded DNAs and then annealing them to form at least one complementary base pairing region, thereby obtaining the framework DNA; Preferably, the single-stranded DNA is mixed in a buffer solution; Preferably, the buffer solution contains 10–40 mM Tris-HCl and 2–5 mM MgCl2 with a pH of 7.5–8; Preferably, the annealing temperature is 90-95°C, and the annealing time is 10-20 minutes; Preferably, the annealing process further includes a step of cooling to 2-4°C and holding for 20-30 minutes.

6. The application according to any one of claims 2 to 5, characterized in that, The method for preparing the duplex includes: annealing two single-stranded DNAs to form a base-complementary pairing region; Preferably, the method for preparing the ring includes: annealing two single-stranded DNA molecules to form a base-complementary pairing region; Preferably, the method for preparing the shovel shape includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions intersect at a point in space and are not coplanar; Preferably, the method for preparing the three-way ligation includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions intersect at a point on a plane; Preferably, the method for preparing the triangle includes: annealing three single-stranded DNA strands to form three complementary base pairing regions, wherein the three complementary base pairing regions are the three sides of the triangle; Preferably, the method for preparing the cross shape includes: annealing four single-stranded DNA strands to form four complementary base pairing regions, wherein the four complementary base pairing regions intersect at a point on a plane; Preferably, the method for preparing the quadrilateral includes: annealing four single-stranded DNA strands to form four complementary base pairing regions, wherein the four complementary base pairing regions are the four sides of the quadrilateral.

7. The application according to any one of claims 2 to 6, characterized in that, Preferably, the method for preparing the pyramid shape includes: annealing five single-stranded DNA strands to form eight complementary base pairing regions, wherein the eight complementary base pairing regions are the eight sides of a square pyramid; Preferably, the method for preparing the triangular prism includes: annealing five single-stranded DNA strands to form nine complementary base pairing regions, wherein the nine complementary base pairing regions are the nine sides of the triangular prism; Preferably, the method for preparing the tetrahedral shape includes: annealing four single-stranded DNA strands to form six complementary base pairing regions, wherein the six complementary base pairing regions are the six edges of the tetrahedron; Preferably, the six complementary base pairing regions are of equal length, with a length ≥15bp and ≤40bp; Preferably, the method for preparing the non-tetrahedral shape includes: annealing four single-stranded DNA strands to form six complementary base pairing regions, wherein the six complementary base pairing regions are the six edges of a tetrahedron; Preferably, the six complementary base pairing regions are of unequal length, and at least one complementary base pairing region has a length ≥15bp and ≤40bp. Preferably, the six complementary base pairing regions are of unequal length, each having a length ≥15bp and ≤40bp; Preferably, the one-dimensional structure comprises two linearly tandem double-stranded DNA strands and / or three linearly tandem double-stranded DNA strands; Preferably, the method for preparing the two linearly tandem double-stranded DNAs includes: annealing three single-stranded DNAs to form two complementary base-pairing regions; Preferably, the method for preparing the three linearly tandem double-stranded DNAs includes: annealing four single-stranded DNAs to form three complementary base pairing regions; Preferably, the method for preparing the parallel structure includes: annealing two single-stranded DNAs to form two complementary base pairing regions, wherein the two complementary base pairing regions do not intersect in the plane; Preferably, the method for preparing the angled structure includes: annealing two single-stranded DNAs to form two complementary base pairing regions, wherein the two complementary base pairing regions intersect at a point on a plane; Preferably, the method for preparing the framework DNA with unpaired base ends includes: annealing two single-stranded DNAs to form a complementary base pairing region.

8. The application according to any one of claims 1 to 7, characterized in that, The framework DNA is loaded into a pharmaceutically acceptable vector; Preferably, the carrier comprises cationic liposomes.

9. The use of the framework DNA as described in any one of claims 1 to 8 in the preparation of an agonist of cyclic guanosine monophosphate-adenosine synthase.

10. The use of the framework DNA as described in any one of claims 1 to 8 in the preparation of type I interferon synthesis agonists; Preferably, the type I interferon includes IFN-α and / or IFN-β; Preferably, the IFN-α includes any one or a combination of at least two of IFN-α1, IFN-α2, IFN-α4, IFN-α7, or IFN-α14.

Images