Peanut ubiquitin Ubiquitin 4-1 gene promoter as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of plant genetic engineering and biology, and discloses an endogenous strong promoter PAhUBQ4-1 of a peanut Ubiquitin 4-1 gene as well as a preparation method and application of the endogenous strong promoter PAhUBQ4-1. The sequence of the promoter is as shown in SEQ ID NO. 1. According to the invention, an amino acid sequence of an arabidopsis ubiquitin gene Ubiquitin-10 is taken as a reference, a peanut Ubiquitin4-1 candidate gene is identified through homologous retrieval, and after a high-expression gene is screened through expression quantity analysis, the gene promoter is cloned from a peanut Yuanghua 9326 genome by adopting a PCR (Polymerase Chain Reaction) technology; a recombinant vector containing the promoter is constructed, peanut embryogenic calluses are transformed, and functional verification shows that the promoter can efficiently drive downstream genes to be expressed in the peanut calluses. The technical bottleneck that existing peanut gene editing depends on an exogenous promoter and is poor in adaptability is solved, the application blank of the peanut endogenous strong promoter is filled, and the peanut endogenous strong promoter can be used for constructing a peanut precise gene editing system and promoting peanut breeding improvements such as stress resistance and high quality, and has important practical value and industrialization prospect.

Description

Technical Field

[0001] This invention relates to the fields of plant genetic engineering and biotechnology. Specifically, it relates to a peanut ubiquitin 4-1 gene promoter, its preparation method, and its applications. Background Technology

[0002] Peanuts (Arachis hypogeae L.) are a globally important economic crop, occupying a core position in edible oil supply and snack food processing. The continuous development of plant genetic engineering technology and the application of CRISPR / Cas9 gene editing technology have significantly improved the efficiency and precision of target gene regulation, greatly shortening the crop breeding cycle and providing core support for upgrading peanut breeding technology.

[0003] In the process of peanut genetic transformation, gene editing vectors containing promoters and target genes are constructed and transformed into peanut embryogenic callus tissue through Agrobacterium-mediated transformation or gene gun transformation. After obtaining positive resistant lines through resistance screening, subsequent molecular identification and trait verification are carried out.

[0004] As a core element in gene expression regulation, promoters directly determine the expression level of exogenous genes and play a crucial role in gene editing efficiency. Plant genetic transformation often uses callus tissue as the core recipient material, and endogenous callus-based high-efficiency promoters have been verified in various crops to have advantages such as strong species adaptability and high expression stability.

[0005] In current peanut gene editing research, the expression of Cas9 protein is generally driven by the virus-derived CaMV 35S promoter. There are few reports on the application of peanut endogenous promoters to Cas9 protein expression, which has become a key bottleneck restricting the further improvement of peanut gene editing efficiency.

[0006] The ubiquitin gene promoter has been proven to drive the expression of exogenous genes stably and efficiently in plant cells. However, there are currently no reports on the discovery of ubiquitin genes, the functional identification of their promoters, and their application research in peanuts. Therefore, the discovery of endogenous promoters of peanut ubiquitin genes and the clarification of their functions have important research and application value. Summary of the Invention

[0007] To address the problems existing in the prior art, this invention provides a peanut ubiquitin 4-1 gene promoter, its preparation method, and its application.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] A strong endogenous promoter P of the peanut ubiquitin 4-1 gene AhUBQ4-1 Its nucleotide sequence is shown in SEQ ID NO.1.

[0010] An amplification of the endogenous strong promoter P of the peanut ubiquitin 4-1 gene AhUBQ4-1 The specific primer pairs are:

[0011] P AhUBQ4-1 S: 5′-CAATGCTAAGTCGCATTACCAATT-3′;

[0012] P AhUBQ4-1 A: 5′-CTGCATCATCGTTAACAACAATTAAA-3′;

[0013] And the primer pairs with homologous arms used for constructing GUS reporter gene expression vectors, specifically:

[0014] P AhUBQ4-1 S: 5′-ccaatacgcaaaccgcctgcaggCAATGCTAAGTCGCATTACCAATT-3′ and P AhUBQ4-1 A:5′-ttaccctcagatctaccatggCTGCATCATCGTTAACAACAATTAAA-3′;

[0015] Primer pairs with homologous arms for constructing base editing vectors: forward homologous arm primer 5'-AGGTGGGACAAAACGGGCGCGCC-3' and reverse homologous arm primer 5'-TTCCGCTTCTTCTTTGGTACCATGGTGGC-3'.

[0016] A type of gene containing the endogenous strong promoter P of the peanut ubiquitin 4-1 gene AhUBQ4-1 The recombinant vector uses a plant expression vector or gene editing vector as a backbone vector to carry the promoter P. AhUBQ4-1 Inserted into a backbone vector, replacing the original promoter in the backbone vector or acting as a new promoter to regulate the expression of downstream genes; the backbone vector is at least one of 35S-pBWA(H)-gus vector, 35S-CBE base editing vector, and CRISPR / Cas9 vector.

[0017] The recombinant vector includes P AhUBQ4-1 -pBWA(H)-gus and P AhUBQ4-1 -At least one of CBE.

[0018] A strong endogenous promoter P of the peanut ubiquitin 4-1 gene AhUBQ4-1 The preparation method of [the substance] is characterized by comprising the following steps:

[0019] (1) Extract genomic DNA from peanut variety Yuhua 9326;

[0020] (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the specific primer pair described above;

[0021] The amplification reaction system was 50 μL: 100 ng genomic DNA template, 1×PrimeSTAR GXL buffer, 200 μM dNTPs, one 0.3 μM forward and one reverse primer, and 1.25 U PrimeSTAR GXL DNA polymerase, with sterile deionized water added to bring the total volume to 50 μL.

[0022] Amplification reaction program: 94 ℃ pre-denaturation for 30 s, 35 cycles (98 ℃ denaturation for 10 s, 55 ℃ annealing for 15 s, 68 ℃ extension for 2 min), 72 ℃ extension for 5 min, and 4 ℃ hold-to-stop.

[0023] (3) The PCR amplification products were detected by agarose gel electrophoresis, and the target product was recovered and purified;

[0024] (4) The purified product was ligated into a cloning vector, transformed into host cells, and after culturing, single colonies were picked for sequencing verification to obtain the P. AhUBQ4-1 The cloning vector is a T vector, and the host cell is Escherichia coli competent cells DH5α.

[0025] The endogenous promoter P of the peanut ubiquitin 4-1 gene AhUBQ4-1 Its application in driving gene expression includes driving the expression of key gene editing proteins, reporter genes, or functional genes in peanut callus cells.

[0026] The key gene editing proteins include Cas9 protein, Cas9 protein-deaminase fusion protein, Cas9 protein-reverse transcriptase fusion protein, or other gene editing-related functional proteins; the reporter gene is the GUS gene; the functional genes include at least one of stress resistance genes, disease resistance genes, and genes related to superior traits.

[0027] The endogenous promoter P of the peanut ubiquitin 4-1 gene AhUBQ4-1 Its application in flowering breeding, through the construction of structures containing the aforementioned P AhUBQ4-1 Gene editing vectors or plant expression vectors for promoters.

[0028] The application of the recombinant vector in peanut genetic transformation and promoter function verification.

[0029] The beneficial effects of this invention are:

[0030] (1) This invention can specifically clone P from peanut genomic DNA using conventional PCR amplification technology. AhUBQ4-1 The promoter is simple and controllable to operate, requiring no complex instruments or special experimental conditions. Moreover, the amplification products are highly specific, reproducible, and the results are stable and reliable. Compared with the existing technologies that require genomic library screening to obtain promoters, this invention significantly reduces the technical threshold and production cost of promoter cloning, laying a solid foundation for subsequent industrial applications.

[0031] (2) The peanut-containing P constructed in this invention AhUBQ4-1 The recombinant vector for high-efficiency promoter expression, after optimization, is highly compatible in size with the peanut genetic transformation system, exhibiting efficient transformation characteristics in peanut cells and enabling rapid introduction into recipient materials such as peanut embryogenic callus. Simultaneously, the GUS reporter gene carried by this recombinant vector demonstrates high expression intensity, allowing for rapid detection using conventional histochemical staining methods. The clear detection signal provides a direct and accurate assessment of promoter expression activity, effectively simplifying the promoter function verification process and reducing detection costs. Transforming peanuts using this recombinant vector stably yields transgenic lines with high GUS gene expression in peanut callus, providing an efficient and reliable tool for promoter function verification and subsequent optimization of gene editing vectors.

[0032] (3) This invention is the first to clone P from peanut. AhUBQ4-1 The endogenous promoter effectively solves the technical problem of the lack of precise endogenous promoters in the current field of peanut gene editing. The viral CaMV 35S promoter commonly used in existing peanut gene editing practices has defects such as poor species adaptability and insufficient expression stability in peanut callus tissue. The endogenous promoter provided by this invention is naturally compatible with the peanut genome background, fundamentally making up for the above-mentioned defects of exogenous promoters, and providing core component support for the optimization and upgrading of peanut gene editing technology.

[0033] (4) Peanut P obtained by the present invention AhUBQ4-1 The endogenous promoter exhibits a low Indel rate in peanut callus, specifically and efficiently driving the precise expression of key gene-editing proteins such as Cas9 in peanut callus. Experimental data confirm that, compared to existing gene-editing systems using the CaMV 35S promoter, the P promoter in this invention... AhUBQ4-1 The indel rate of promoter-driven CBE vectors is only 3.6%, far lower than the 17.9% of 35S-CBE vectors, which can significantly reduce the off-target rate and provide key technical support for precise gene editing of peanuts. This series of promoters can be widely used in gene editing breeding work to improve traits such as herbicide resistance, drought resistance, cold resistance, and disease resistance in peanuts. It has important practical value and broad industrialization prospects for promoting the progress of peanut molecular breeding technology and cultivating superior new peanut varieties. Attached Figure Description

[0034] Figure 1 Phylogenetic analysis diagram of 10 peanut ubiquitin homologous genes.

[0035] Figure 2 This is a graph showing the expression levels of 10 peanut ubiquitin homologous genes.

[0036] Figure 3 For PCR amplification of P AhUBQ4-1 Fragment electrophoresis image.

[0037] Lane 1 is P AhUBQ4-1 PCR amplification results of the promoter; lane M represents the nucleic acid marker in a 5000 bp ladder.

[0038] Figure 4 For 35S-pBWA(H)-gus, P AhUBQ4-1 -pBWA(H)-gus, 35S-CBE and P AhUBQ4-1 -CBE vector T-DNA region schematic diagram. Among them, T7 Ter, T7 phage RNA polymerase terminator; GUS, β-glucuronidase reporter gene; 35S, cauliflower mosaic virus 35S promoter; Hyg, hygromycin B resistance gene; AtU6, Arabidopsis thaliana U6 promoter; evoFERNY, cytidine deaminase; nCas9(D10A), Cas9(D10A) nickase; UGI, uracil-DNA glycosylation inhibitor; NOS Ter, carmine synthase terminator; the promoter is CaMV 35S or P. AhUBQ4-1 RB and LB represent the right and left boundaries of T-DNA, respectively.

[0039] Figure 5 For P AhUBQ4-1 Histochemical staining results of transgenic peanut callus driving the GUS reporter gene.

[0040] Figure 6 This is a sequence peak diagram of the representative Sanger strain. Detailed Implementation

[0041] The present application will be further described in detail below with reference to the embodiments.

[0042] Example 1: Identification and Expression Analysis of the Peanut Ubiquitin Gene

[0043] 1. Identification of the peanut ubiquitin gene

[0044] Using the amino acid sequence of the Arabidopsis ubiquitin gene Ubiquitin-10 (At4g05320) as a reference sequence, homology sequences were searched for in the peanut reference genome (version: Arachis hypogaea Tifrunner Tifrunner.gnm2.ann2.PVFB Annotations) using the BLASTP tool in the PeanutBase database (https: / / www.peanutbase.org / ). Ten gene sequences showed high similarity, identified by the identifiers Ah09g369200, Ah13g542400, Ah19g554200, Ah13g220400, Ah05g180000, Ah03g512700, Ah03g192500, Ah16g223600, Ah06g186100, and Ah15g166100. Through phylogenetic analysis, the evolutionary relationships of the above genes were obtained, such as... Figure 1 As shown in the figure, the 10 homologous genes in peanuts cluster in pairs into one branch, indicating that there may be 5 AhUBQ4 genes in the peanut genome, with one copy of each gene on the A and B genomes.

[0045] 2. Test materials and sampling treatment

[0046] The peanut material used in the experiment was Yuhua 9326, sown in the field and managed under routine field conditions. Sampling was divided into two main categories: first, sampling of Yuhua 9326 plants in full bloom in the field, collecting tissues such as roots, stems, flowers, leaves, and pegs; second, sampling of peanut pods in the reproductive growth stage, collecting pods at R3, R6, and R8 stages according to the peanut growth stages classification standard (KJBoote, Peanut Science, 1982). Additionally, callus tissue from Yuhua 9326 cultured indoors was used as supplementary sampling material. All collected samples were flash-frozen in liquid nitrogen and stored at -80 ℃ for later use.

[0047] 3. Total RNA extraction and cDNA synthesis

[0048] Total RNA was extracted from the above-mentioned samples using the Takara MiniBEST Plant RNA Extraction Kit, following the instructions in the kit's manual. Using the extracted total RNA as a template, first-strand cDNA was synthesized using the Takara PrimeScript™ 1st Strand cDNA Synthesis Kit, following the instructions in the kit's manual. The synthesized cDNA product was used as a template for real-time quantitative PCR (RT-qPCR).

[0049] 4. RT-qPCR detection of candidate ubiquitin gene expression levels

[0050] Using the synthesized first-strand cDNA as a template, the expression levels of the 10 peanut candidate ubiquitin genes obtained above were detected using the Applied Biosystems™ QuantStudio™ 5 real-time quantitative PCR system to clarify the expression characteristics of each gene in different tissues and growth stages.

[0051] The experiment used the peanut constitutive expression gene AhADH3 as an internal reference gene. Its amplification primers and candidate ubiquitin gene-specific amplification primers are as follows:

[0052] The primers for the internal reference gene AhADH3 are:

[0053] ADH3-F:GACGCTTGGCGAGATCAACA (SEQ ID NO.2),

[0054] ADH3-R: AACCGGACAACCACCACATG (SEQ ID NO.3);

[0055] Candidate ubiquitin gene primers include:

[0056] qUBI-0616F: CCTAACGGGGAAAGACCATAACTCTC (SEQ ID NO.4),

[0057] qUBI-0616R: CTCTAATTGCTTCCCAGCGAAG (SEQ ID NO.5) (simultaneous amplification of Ah06g186100 and Ah16g223600);

[0058] qUBI-0515F: CACCGGATCAGCAACGTCTG (SEQ ID NO.6),

[0059] qUBI-0515R: CCACGGAGACGGAGAACGAG (SEQ ID NO.7) (simultaneous amplification of Ah05g180000 and Ah15g166100);

[0060] qUBI-56-0313F: CTGATTTAATTCCTTTTTGTGCTTCC (SEQ ID NO.8),

[0061] qUBI-56-0313R: GATCCCTTCCTTATCTTGAATTTTC (SEQ ID NO.9) (simultaneous amplification of Ah03g512700 and Ah13g542400);

[0062] qUBI-78-0313F:GCAAATCTTCGTGAAAACCTTGAC (SEQ ID NO.10),

[0063] qUBI-78-0313R: CTTATCCTGAATTTTGGCCTTGAC (SEQ ID NO.11) (simultaneous amplification of Ah03g192500 and Ah13g220400);

[0064] qUBI-319F:GTTTGTGAACTTGTGCAAGTGTAATC (SEQ ID NO.12),

[0065] qUBI-319R:ACTAGGTAGCAGAGAGCAAATTTATTG (SEQ ID NO.13) (Amplification of Ah19g554200);

[0066] qUBI-409F:TTTTGTGAACTTGTGCAAGTGTAATT (SEQ ID NO.14),

[0067] qUBI-409R:ACTAGGTAGCAGAGAGCAAATTTATTa (SEQ ID NO.15) (Amplified Ah09g369200).

[0068] RT-qPCR test results are as follows Figure 2 As shown in the figure, the expression levels of Ah05g180000 and Ah15g166100 in all detected tissue sites were significantly higher than those of the other eight genes. The promoter of the Ah05g180000 gene was selected for cloning. This gene and its promoter were named AhUBQ4-1 and P, respectively. AhUBQ4-1 .

[0069] Example 2 Peanut PAhUBQ4-1 Methods for preparing promoters

[0070] In this embodiment, the highly expressed peanut ubiquitin gene obtained in Example 1 was used to prepare its corresponding promoter P. AhUBQ4-1 The specific steps are as follows:

[0071] 1. Genomic DNA extraction

[0072] Fresh leaves of peanut variety Yuhua 9326 were selected as materials. Genomic DNA was extracted from the leaves using the Plant DNA Extraction Kit (catalog number: DP350) from Tiangen Biotech (Beijing) Co., Ltd., strictly following the instructions in the kit. The extracted genomic DNA was stored at -20 ℃ for later use.

[0073] 2. Promoter amplification primer design

[0074] Based on the sequence information of the AhUBQ4-1 gene in the peanut reference genome (version: Arachis hypogaea Tifrunner.gnm2.J5K5 Genomes), specific amplification primer pairs were designed targeting the promoter region approximately 2000 bp upstream of the start codon. The specific primer sequences are as follows:

[0075] P AhUBQ4-1 S: 5′-CAATGCTAAGTCGCATTACCAATT-3′ (SEQ ID NO. 16);

[0076] P AhUBQ4-1 A: 5′-CTGCATCATCGTTAACAACAATTAAA-3′ (SEQ ID NO. 17).

[0077] 3. PCR amplification of promoter sequence

[0078] Using the genomic DNA extracted from the leaves of Yuhua 9326 in step 1 as a template, the target promoter region was amplified by PCR using a high-fidelity enzyme (Takara, catalog number: R050Q).

[0079] Amplification reaction system (total system 50 μL): 100 ng DNA template, 1 × PrimeSTAR GXL buffer, 200 μM dNTPs, one 0.3 μM forward and one reverse primer, and 1.25 U PrimeSTAR GXL DNA polymerase, with sterile deionized water added to a final volume of 50 μL.

[0080] Amplification reaction program: pre-denaturation at 94 ℃ for 30 s; followed by 35 cycles with the following parameters: denaturation at 98 ℃ for 10 s, annealing at 55 ℃ for 15 s, extension at 68 ℃ for 2 min; after the cycle, extension at 72 ℃ for 5 min; and finally, holding at 4 ℃ to terminate the reaction.

[0081] 4. PCR product detection, recovery, and cloning

[0082] After the PCR reaction, a suitable amount of the amplification product was taken for detection by 1.0% (w / v) agarose gel electrophoresis. The detection results are as follows: Figure 3 As shown. The remaining target PCR products were recovered using a DNA purification kit (Catalog No.: DC301) from Nanjing Novizan Biotechnology Co., Ltd. The recovered purified products were ligated into T vectors (Beijing Qingke Biotechnology Co., Ltd., Catalog No.: TSV-007), and transformed into competent E. coli DH5α cells (Sangon Biotech (Shanghai) Co., Ltd.) using the freeze-thaw method. The transformed bacterial culture was evenly spread on LB solid medium containing the corresponding antibiotic and incubated overnight at 37 ℃. The next day, single colonies were picked and inoculated into LB liquid medium, and cultured overnight at 37 ℃ with shaking at 200 rpm to obtain bacterial culture samples.

[0083] 5. Sequencing Validation and Promoter Acquisition

[0084] The bacterial culture samples obtained above were sent to Sanger sequencing verification at Sangon Biotech (Shanghai) Co., Ltd. The results analysis showed that P was obtained. AhUBQ4-1 The base sequence is as shown in SEQ ID NO. 1.

[0085] Example 3 Peanut P AhUBQ4-1 Application of sequences in transgenic peanut callus

[0086] 1. Peanut ubiquitin gene promoter P AhUBQ4-1 Construction of plant expression vectors

[0087] 1.1 Construction of GUS reporter gene expression vector in plants

[0088] The 35S-pBWA(H)-gus vector (Wuhan Boyuan Biotechnology Co., Ltd.) was double-digested with Sbf I and Nco I restriction enzymes (Thermo Fisher Scientific) to remove the CaMV 35S promoter driving the GUS reporter gene in the vector. After the enzyme digestion reaction, the linearized vector fragment was separated and recovered by agarose gel electrophoresis.

[0089] To achieve precise connection between the promoter and the linearized vector, the P designed in Example 2... AhUBQ4-1Homologous arm sequences identical to those inserted into the vector were added to the 5' ends of the promoter forward and reverse amplification primers, respectively. The optimized primer sequences are as follows:

[0090] P AhUBQ4-1 S: 5′-ccaatacgcaaaccgcctgcaggCAATGCTAAGTCGCATTACCAATT-3′ (SEQ IDNO.18) and P AhUBQ4-1 A: 5′-ttaccctcagatctaccatggCTGCATCATCGTTAACAACAATTAAA-3′ (SEQ ID NO. 19).

[0091] Using the genomic DNA of *Yuhua 9326* as a template, P was amplified using the primers with added homologous arms described above. AhUBQ4-1 Promoter sequence; after purification and recovery, the amplified product was ligated into the linearized pBWA(H)-gus vector using a seamless cloning kit (Takara, Clontech, #638948) to construct P. AhUBQ4-1 -pBWA(H)-gus recombinant vector; the 35S-pBWA(H)-gus vector without promoter replacement was used as the control vector. All the above plasmid resistance gene markers were hygromycin resistance.

[0092] 1.2 Construction of base editing plant expression vectors

[0093] The 35S-CBE base editing vector (Weimi Biotechnology Co., Ltd., Nanjing) was double-digested with Asc I and Kpn I restriction enzymes (Thermo Fisher Scientific) to remove the CaMV35S promoter driving the evoFERNY-nCas9 fusion protein. The digestion products were separated by agarose gel electrophoresis, and the linearized base editing vector fragments were recovered.

[0094] In P AhUBQ4-1 Homologous arm sequences matching the insertion sites of the linearized base editing vector were added to the 5' ends of the promoter forward and reverse amplification primers, respectively: forward homologous arm primer 5'-AGGTGGGACAAAACGGGCGCGCC-3' (SEQ ID NO. 20) and reverse homologous arm primer 5'-TTCCGCTTCTTCTTTGGTACCATGGTGGC-3' (SEQ ID NO. 21); using the genomic DNA of *Yuhua 9326* as a template, P with homologous arms was amplified. AhUBQ4-1 Promoter sequence; after purification and recovery of the amplification product, it was ligated into a linearized base editing vector using a seamless cloning kit (Takara, Clontech, #638948) to construct P AhUBQ4-1The 35S-CBE recombinant vector was used as a control vector with the 35S-CBE vector without promoter replacement. The editing target of the vector system was set at the P197 site of the peanut AhALS2 gene. The above plasmid resistance gene markers were all hygromycin resistance.

[0095] 1.3 Recombinant vector sequencing validation

[0096] All the recombinant vectors constructed above were transformed into competent *E. coli* cells, plated on LB solid medium containing the corresponding antibiotics, and incubated overnight at 37 °C. The next day, single colonies were picked and inoculated onto LB liquid medium, and cultured overnight at 37 °C with shaking at 200 rpm to obtain bacterial culture samples. The bacterial culture samples were sent to a biotechnology company for Sanger sequencing verification. The GUS reporter gene recombinant vector was sequenced using primer Ahgus-seq: 5′-TTCGTCGGTTCTGTAACTATCATC-3′ (SEQ ID NO. 22), and positive clones were detected. The base editing recombinant vector was sequenced using primer CBE-seq: 5′-GAGCAGTGGGTAGAAGGGTT-3′ (SEQ ID NO. 23), and positive clones were detected. The T-DNA region structure of the recombinant vectors is shown below. Figure 4 As shown.

[0097] The GUS reporter gene recombinant vector constructed in this invention is of suitable size and has high plant cell transformation efficiency. It carries a GUS marker gene with high expression intensity, which can be rapidly detected by a simple histochemical staining method. Transforming peanuts with this vector can stably obtain transgenic lines with high GUS gene expression in peanut callus tissue, suitable for P... AhUBQ4-1 Verification of promoter expression activity; construction of P AhUBQ4-1 -CBE recombinant vectors can be used to verify P AhUBQ4-1 The expression efficiency of promoter-driven base editing proteins in peanut cells provides an efficient vector tool for subsequent peanut gene editing breeding.

[0098] 2. Genetic transformation of peanuts

[0099] 2.1 Collection and pretreatment of explants: Take mature peanut pods, remove the shells, select plump, clean seeds without sterile spots, soak them in 75% alcohol for 1 min, remove the alcohol, soak them in 0.1% mercuric chloride for 8 min, remove the mercuric chloride, and finally rinse them 5-7 times with sterile water and soak them overnight for later use.

[0100] 2.2 Induction, screening and subculture of embryogenic callus: Cotyledons, embryonic leaflets and hypocotyls of peanut seeds were removed in a clean bench. The epicotyls were placed on MS induction medium (Table 1) and cultured at 28 ℃. Subculture was performed every 3-4 weeks. Embryogenic callus tissue appeared after 3-4 subcultures. Embryogenic callus tissue cultured for 4-12 months was selected for subsequent experiments.

[0101] Table 1 Stock solution formulation for MS induction medium

[0102]

[0103] 2.3 Preparation for Gene Gun Bombardment Method: The specific steps for preparing the bullets according to the instructions of the Xinzhi Gene Gun (GJ-1000) are as follows:

[0104] Weigh 60 mg of gold powder into a 2 mL centrifuge tube, add 1 mL of anhydrous ethanol, sonicate until the temperature feels slightly hot to the touch, centrifuge and discard the supernatant.

[0105] Add 1 mL of anhydrous ethanol to a centrifuge tube, vortex for 3-5 min, let stand for 1 min and discard the supernatant; add 1 mL of sterile distilled water to a centrifuge tube, vortex and centrifuge, discard the supernatant, add 50% sterile glycerol to prepare a 60 mg / mL gold powder suspension for later use.

[0106] Using the Tiangen endotoxin-free plasmid small-scale extraction kit (catalog number: DP118), P was extracted according to the instructions in the product manual. AhUBQ4-1 -pBWA(H)-gus、P AhUBQ4-1 -CBE and the corresponding control 35S-pBWA(H)-gus and 35S-CBE recombinant vector plasmids.

[0107] Take 50 μL of gold powder suspension, add 10 μL of plasmid with a concentration of 1 μg / μL, shake for 30 s, add 50 μL of calcium chloride with a concentration of 2.5 M, shake for 30 s, add 20 μL of spermidine with a concentration of 0.1 M, shake for 30 s, centrifuge and discard the supernatant, add 150 μL of 70% ethanol, blow the precipitate until it is evenly dispersed, centrifuge and discard the supernatant, add 150 μL of anhydrous ethanol, let stand for 1 min, discard the supernatant and add 60 μL of anhydrous ethanol, blow the precipitate apart and set aside.

[0108] 2.4 Genetic transformation of peanut: The induced peanut embryogenic callus was placed on MS medium and bombarded with the GJ-1000 gene gun. After bombardment, it was cultured at 28 °C for 3 days, and then transferred to MS medium containing 20 mg / L hygromycin for screening. After culturing for 1 month, the newly formed callus was selected and transferred to MS medium containing 20 mg / L hygromycin for subculture twice. The embryogenic callus obtained by proliferation was used for subsequent research.

[0109] 3. Gene promoter P AhUBQ4-1 Functional analysis:

[0110] (1) The P was verified by using the GUS histochemical staining method. AhUBQ4-1 The specific steps for determining the expression activity of the promoter in peanut callus are as follows:

[0111] In P AhUBQ4-1 From peanut embryogenic callus transformed with 35S-pBWA(H)-gus and control 35S-pBWA(H)-gus vectors, a portion of callus from hygromycin-resistant callus lines was selected and placed in 2 mL centrifuge tubes. GUS staining solution (Beijing Cooler Master Technology Co., Ltd.) was added, ensuring the sample was completely submerged. The tubes were then incubated overnight at 37 ℃. After incubation, the tubes were washed three times with anhydrous ethanol, and the staining was observed and photographed under a microscope.

[0112] The results are as follows Figure 5 As shown: CaMV 35S and P AhUBQ4-1 Promoter-driven GUS genes can be expressed in peanut callus. Figure 5 (b, c), while no blue color representing GUS activity was found in unconverted peanut callus (b, c). Figure 5 a), Explanation of P AhUBQ4-1 The promoter has the function of driving the expression of downstream genes in peanut callus.

[0113] (2) To verify P AhUBQ4-1 The editing efficiency of promoter-driven base-editing proteins, for those via P AhUBQ4-1 The efficiency of target site editing was tested in peanut hygromycin-resistant callus lines transformed with the 35S-CBE vector and the control 35S-CBE vector. The specific steps are as follows: From the callus transformed with the two vectors, 56 hygromycin-resistant lines were randomly selected from each vector, and genomic DNA was extracted from the callus lines using conventional plant genome extraction methods; using the extracted genomic DNA as a template, target site-specific primers were used:

[0114] HT-197F: 5′-GGAGTGAGTACGGTGTGCGTCTGCATCGCCACCTCC-3′ (SEQ ID NO.24), HT-197R: 5′-GAGTTGGATGCTGGATGGAAAAGCCTCATTCACAATCCTA-3′ (SEQ ID NO.25) amplified the P197 target sequence of the AhALS2 gene. The amplified products were sent to the Hi-TOM high-throughput sequencing platform of the China National Rice Research Institute for sequencing analysis. The filtering threshold was 0.1%, and 2000 reads were sequenced for each reaction. Data with ≥1% of reads were selected for statistical analysis. Among them, a mutant read ratio of ≥90% of the total reads at that site was defined as a homozygous mutation, a ratio <90% but ≥20% was defined as a heterozygous mutation, and a ratio <20% was defined as a chimeric mutation.

[0115] Sequencing results showed that P AhUBQ4-1 - The CBE vector can drive the editing protein to achieve precise editing at the target site, with an editing efficiency of 12.5%, which is lower than the editing efficiency of the control 35S-CBE (Table 2). Figure 6 ).

[0116] Table 2. Base Editing Efficiency Statistics

[0117]

[0118] Note: Editing efficiency = (editing coefficient / identification coefficient) × 100%; Indel: insertion or deletion; Indel rate = (indel mutant coefficient / identification coefficient) × 100%.

[0119] As can be seen from the data in Table 2, P AhUBQ4-1 The promoter-driven vector indel rate (3.6%) was lower than that of the 35S-CBE vector (17.9%), indicating that peanut endogenous P AhUBQ4-1 Promoters have significant advantages in improving the accuracy of peanut gene editing and have important potential application value in peanut gene editing.

[0120] Based on the P obtained by this invention AhUBQ4-1 The promoter can be used to construct gene editing vectors containing Cas9 proteins, Cas9 protein-deaminase fusion proteins, or Cas9 protein-reverse transcriptase fusion proteins driven by any one of these promoters. This allows for the precise knockout mutations and base substitutions driven by endogenous promoters in peanuts. This technology system can be widely used to create new peanut germplasm with superior qualities such as herbicide resistance, drought resistance, cold tolerance, and disease resistance, providing an efficient molecular breeding tool for peanut breeding and showing broad application prospects.

[0121] In summary, this invention successfully cloned P from peanuts.AhUBQ4-1 An endogenous strong promoter with a lower indel rate and superior editing precision compared to the commonly used CaMV 35S exogenous promoter. Therefore, P AhUBQ4-1） Promoters have important application value in the field of peanut genetic engineering breeding, providing key core components to support the construction of an efficient and precise peanut gene editing system and the creation of new peanut breeding materials with stress resistance and high quality.

[0122] SEQ ID NO.1 (P AhUBQ4-1 (Promoter nucleotide sequence)

[0123]

Claims

1. A strong endogenous promoter P for the peanut ubiquitin 4-1 gene AhUBQ4-1 Its characteristics are, The P AhUBQ4-1 The nucleotide sequence is as shown in SEQ ID NO.

1.

2. An amplification method for the endogenous strong promoter P of the peanut ubiquitin 4-1 gene as described in claim 1. AhUBQ4-1 The specific primer pair is characterized by, The primer pair sequence is as follows: P AhUBQ4-1 S:5'-CAATGCTAAGTCGCATTACCAATT-3'; P AhUBQ4-1 A:5'-CTGCATCATCGTTAACAACAATTAAA-3; And the primer pairs with homologous arms used for constructing GUS reporter gene expression vectors, specifically: P AhUBQ4-1 S: 5'-ccaatacgcaaaccgcctgcaggCAATGCTAAGTCGCATTACCAATT-3' and P AhUBQ4-1 A: 5'-ttaccctcagatctaccatggCTGCATCATCGTTAACAACAATTAAA-3'; Primer pairs with homologous arms for constructing base editing vectors: forward homologous arm primer 5'-AGGTGGGACAAAACGGGCGCGCC-3' and reverse homologous arm primer 5'-TTCCGCTTCTTCTTTGGTACCATGGTGGC-3'.

3. A gene containing the endogenous strong promoter P of the peanut ubiquitin 4-1 gene as described in claim 1 or 2. AhUBQ4-1 The recombinant vector, characterized in that, The recombinant vector uses a plant expression vector or a gene editing vector as its backbone vector, and the promoter P is inserted into the vector. AhUBQ4-1 Inserted into a backbone vector, replacing the original promoter in the backbone vector or acting as a new promoter to regulate the expression of downstream genes; the backbone vector is at least one of 35S-pBWA(H)-gus vector, 35S-CBE base editing vector, and CRISPR / Cas9 vector.

4. The recombinant vector according to claim 3, characterized in that, The recombinant vector includes P AhUBQ4-1 -pBWA(H)-gus and P AhUBQ4-1 -At least one of CBE.

5. A strong endogenous promoter P of the peanut ubiquitin 4-1 gene as described in claim 1 or 2. AhUBQ4-1 The preparation method of the [method] is characterized by, Includes the following steps: (1) Extract genomic DNA from peanut variety Yuhua 9326; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the specific primer pair described in claim 2; The amplification reaction system was 50 μL: 100 ng genomic DNA template, 1×PrimeSTAR GXL buffer, 200 μM dNTPs, one 0.3 μM forward and one reverse primer, and 1.25 U PrimeSTAR GXL DNA polymerase, with sterile deionized water added to bring the total volume to 50 μL. Amplification reaction program: 94 ℃ pre-denaturation for 30 s, 35 cycles (98 ℃ denaturation for 10 s, 55 ℃ annealing for 15 s, 68 ℃ extension for 2 min), 72 ℃ extension for 5 min, and 4 ℃ hold-to-stop. (3) The PCR amplification products were detected by agarose gel electrophoresis, and the target product was recovered and purified; (4) The purified product was ligated into a cloning vector, transformed into host cells, and after culturing, single colonies were picked for sequencing verification to obtain the P. AhUBQ4-1 The cloning vector is a T vector, and the host cell is Escherichia coli competent cells DH5α.

6. An endogenous promoter P of the peanut ubiquitin 4-1 gene as described in claim 1 or 2. AhUBQ4-1 Its application in driving gene expression is characterized by, The applications include driving the expression of key gene editing proteins, reporter genes, or functional genes in peanut callus cells.

7. The application according to claim 6, characterized in that, The key gene editing proteins include Cas9 protein, Cas9 protein-deaminase fusion protein, Cas9 protein-reverse transcriptase fusion protein, or other gene editing-related functional proteins; the reporter gene is the GUS gene; the functional genes include at least one of stress resistance genes, disease resistance genes, and genes related to superior traits.

8. An endogenous promoter P of the peanut ubiquitin 4-1 gene as described in claim 1 or 2. AhUBQ4-1 Its application in flowering breeding is characterized by, The application is to construct a system containing P. AhUBQ4-1 Gene editing vectors or plant expression vectors for promoters.

9. The application of the recombinant vector according to claim 3 or 4 in peanut genetic transformation and promoter function verification.

Images