Application of overexpression VaHY5 gene related biological product in grape cold-resistant breeding

Abstract

The invention belongs to the technical field of plant molecular biology and genetic engineering, and particularly relates to application of overexpression VaHY5 gene related biological products in grape cold-resistant breeding. The invention proves that the VaHY5 gene can obviously improve the low-temperature tolerance of the grape through instantaneous transformation of the grape Cauvignon and stable genetic transformation of the callus expression VaHY5. The research not only provides a theoretical basis for clarification of a molecular mechanism of the HY5 transcription factor in grape low-temperature response, but also establishes the grape VaHY5 gene as a cold-resistant gene resource with extremely high application value, and lays a theoretical foundation for improving the cold resistance of cultivated grapes in genetic engineering and cultivating cold-resistant new quality.

Description

Technical Field

[0001] This invention belongs to the fields of plant molecular biology and genetic engineering technology, specifically relating to overexpression. VaHY5 Application of gene-related bioproducts in cold-resistant grape breeding. Background Technology

[0002] Grape( Vitis spp As one of the most important economic fruit trees widely cultivated globally, grapes are susceptible to the effects of low temperatures on their growth and development. In northern regions, severe winters often cause frost damage to grapes. To ensure safe overwintering, a significant amount of manpower and resources are required each year for soil burial for frost protection, which seriously restricts the sustainable development of the grape industry.

[0003] Therefore, there is an urgent need to provide a new strategy for breeding cold-resistant grape varieties, which is of great significance for grape cold-resistant breeding and cultivation. Summary of the Invention

[0004] To address the above problems, this invention provides an overexpression... VaHY5 Application of gene-related bioproducts in cold-resistant grape breeding.

[0005] This invention is achieved through the following technical solution: overexpression VaHY5 The application of gene-related biological products in cold-resistant grape breeding, the aforementioned VaHY5 The base sequence of the gene is shown in SEQ ID NO.1.

[0006] Preferably, the VaHY5 The amino acid sequence of the protein expressed by the gene is shown in SEQ ID NO.2.

[0007] Preferably, the biological product is VaHY5 Recombinant overexpression vectors of genes or recombinant engineered bacteria.

[0008] Preferably, the recombinant overexpression vector is used to express the... VaHY5 The gene was obtained by inserting it into the pCAMBIA2300-GFP vector.

[0009] Preferably, the recombinant Agrobacterium is obtained by introducing the recombinant overexpression vector into Agrobacterium.

[0010] Preferably, the Agrobacterium is EHA105.

[0011] Preferably, the recombinant overexpression vector is used to enhance... VaHY5 The expression level of genes is adjusted to improve the cold resistance of grapes, thereby breeding cold-resistant grape varieties.

[0012] Preferably, the method for improving the cold resistance of grapes is as follows: RNA was extracted from grapes and reverse transcribed into cDNA.

[0013] Using cDNA as a template, the primers shown in SEQ ID NO.3 and SEQ ID NO.4 were used to clone the sample. VaHY5 .

[0014] Will VaHY5 The vector was ligated into the recombinant overexpression vector.

[0015] The recombinant overexpression vector was transformed into Agrobacterium to obtain recombinant Agrobacterium.

[0016] By infecting plants with recombinant Agrobacterium, overexpression plants can be obtained, thereby improving the cold resistance of plants.

[0017] Compared with the prior art, the present invention has the following beneficial effects: This invention provides overexpression VaHY5 The application of gene-related biological products in cold-resistant grape breeding, the aforementioned VaHY5 The gene's base sequence is shown in SEQ ID NO.1. Expression was achieved through transient transformation of grapes and stable genetic transformation of callus. VaHY5, Confirmed VaHY5 The gene significantly enhances the low-temperature tolerance of grapes. This study not only provides a theoretical basis for elucidating the molecular mechanism of the HY5 transcription factor in grape's low-temperature response, but also... VaHY5 The gene has been identified as a highly valuable cold-resistant gene resource, laying a theoretical foundation for improving the cold resistance of cultivated grapes through genetic engineering and cultivating new cold-resistant varieties. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is an analysis diagram of the grape HY5 gene expression pattern according to the present invention; Figure 1 In the middle, a is VaHY5 The results of relative transcription levels in inflorescences, tendrils, leaves, petioles, stems, and roots are shown in Figure b; b represents... VaHY5 The relative expression levels in the low-temperature response are shown in the figure; expression levels are normalized relative to the petiole and 0 hours at 25°C, respectively; data are expressed as mean ± standard error, n=3; * P <0.05,** P <0.01, *** P<0.001, Fisher's LSD test.

[0020] Figure 2 For the present invention VaHY5 Image showing the results of gene cloning and bioinformatics analysis; Figure 2 In the middle, a is VaHY5 Cloning diagram of the gene; where M represents the DNA marker DL2000; b shows chromosome location and schematic diagram; c represents... HY5 Phylogenetic tree diagram; d is the amino acid sequence alignment diagram of tobacco VaHY5 and its homologous genes in Arabidopsis, apple and tomato; e is the subcellular localization map of VaHY5 protein; DAPI staining was used to display the cell nucleus; scale bar = 24.1 μm.

[0021] Figure 3 For the present invention OE- VaHY5 Figure showing the identification and cold resistance analysis results of the instant-transformation grape variety 'Cabernet Sauvignon'; Figure 3 In the middle, 'a' represents the instantaneous transformation of 'Cabernet Sauvignon'. VaHY5 - PCR detection results of OE; M is DNA marker DL2000; Nc is negative control; Pc is positive control; UT is untransformed plant; OE#1~OE#6 are overexpressing plants; b is Western blot analysis results of transiently transformed 'Cabernet Sauvignon' VaHY5-GFP using GFP antibody; c is the comparison between UT group and OE group. -VaHY5 Phenotypic comparison of grapevines treated at room temperature (25℃) and low temperature (-2℃) for 10 days; Scale bar: 1cm; d represents the difference between the UT group and the transgenic grapevines. VaHY5 The qRT-PCR analysis results of the expression are shown in the figure; e is the fluorescence imaging image of the maximum photochemical efficiency Fv / Fm; f is the quantitative analysis result of the Fv / Fm value; * P <0.05,** P <0.01, *** P <0.001, Fisher's LSD test.

[0022] Figure 4 For the present invention OE- VaHY5 ROS removal detection graph of 'Cabernet Sauvignon' grapes; Figure 4 In the diagram, a is the DAB staining image; b is the H2O2 content image; c is the NBT staining image; d is the O2 content image. - Content diagram; Note: UT represents unconverted 'Cabernet Sauvignon'; OE#1 and OE#2: OE-VaHY5 transgenic 'Cabernet Sauvignon' grapes; * P <0.05,** P <0.01, *** P<0.001, Fisher's LSD test. Transient transformation cannot be sampled by line; only pooled sampling is possible, as shown in the figure. VaHY5 -OEs indicates.

[0023] Figure 5 For the present invention OE- VaHY5 A diagram analyzing the cold hardiness of 'Cabernet Sauvignon' grapevines; Figure 5 In the graph, a represents POD activity; b represents SOD activity; c represents CAT activity; d represents malondialdehyde (MDA) content; e represents proline content; and f represents electrolyte leakage rate. Each data point was determined using three independent biological replicates, with each replicate containing samples from three plants. P <0.05,** P <0.01, *** P <0.001, Fisher's LSD test. Transient transformation cannot be sampled by line; only pooled sampling is possible, as shown in the figure. VaHY5 -OEs indicates.

[0024] Figure 6 For the present invention OE- VaHY5 'Cabernet Sauvignon' grapes CBF and COR Gene expression analysis diagram; Figure 6 In the middle, a is VvCBF3 The relative expression level results are shown in the figure; b is... VvCBF4 The relative expression level results are shown in the figure; c represents... VvCBF6 The relative expression level results are shown in the figure; d represents... VvCOR27 Relative expression level results; * P <0.05,** P <0.01, *** P <0.001, Fisher's LSD test. Transient transformation cannot be sampled by line; only pooled sampling is possible, as shown in the figure. VaHY5 -OEs indicates.

[0025] Figure 7 For the present invention OE- VaHY5 Identification of callus tissue and analysis of expression levels in different strains; Figure 7 In the diagram, 'a' represents UT and OE- VaHY5 Figure 1 shows the qRT-PCR analysis results of transgenic callus tissue; b represents OE- VaHY5 Image c shows the in vivo fluorescence imaging results of GFP in UT callus; image c shows the Western blot analysis results of VaHY5-GFP using GFP antibody; Note: UT is non-transgenic callus; OE#2, OE#3, OE#14, OE#18, OE#41 and OE#53 are six different overexpression groups. VaHY5 Callus strains;*P <0.05,** P <0.01, *** P <0.001, Fisher's LSD test.

[0026] Figure 8 For the present invention OE- VaHY5 Analysis diagram of the cold resistance of Pinot Noir callus; Figure 8 In the diagram, a shows the phenotypic results after 10 days of culture at 10℃; b shows the fresh weight of the wild-type (untransformed line UT) and the transgenic lines OE#3, OE#14, and OE#41 after 10 days of culture at 10℃; c shows the H2O2 content; and d shows the O2 content. - Content chart; error bars marked with different superscript letters indicate P A significant difference exists when the value is less than 0.05;* P <0.05,** P <0.01, *** P <0.001, Fisher's LSD test.

[0027] Figure 9 For the present invention OE- VaHY5 Physiological parameters detected in Pinot Noir callus; Figure 9 In the diagram, a represents POD activity; b represents SOD activity; c represents CAT activity; d represents MDA content; and e represents proline content. Error bars labeled with different superscript letters indicate... P Significant differences exist when <0.05.

[0028] Figure 10 For the present invention OE- VaHY5 Pinot Noir callus CBF and COR Gene expression analysis diagram; Figure 10 In the middle, a is VvCBF3;b for VvCBF4 c is VvCBF6 d is VvCOR27 The relative expression level; error bars marked with different superscript letters indicate P Significant differences exist when <0.05. Detailed Implementation

[0029] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0030] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0031] The beneficial effects of the present invention will be illustrated below through specific embodiments.

[0032] The materials used in this invention, 'Beibinghong' and 'Cabernet Sauvignon', are preserved at the experimental base of the College of Enology and Horticulture, Ningxia University; 'Pinot Noir' is preserved in Laboratory 332 of the College of Enology and Horticulture, Ningxia University.

[0033] Example 1 (1) Expression patterns of the transcription factor VaHY5 in different tissues and under low temperature stress in wild grapes With 'Beibinghong' ( Vitis amurensis Using cuttings from Rupr. as material, tissue-specific analyses were performed on different tissues, including inflorescences, tendrils, leaves, petioles, stems, and roots. qRT-PCR technology was used to analyze the tissues. VaHY5 The expression profiles of genes in different tissues, including inflorescences, tendrils, leaves, petioles, stems, and roots, were analyzed. The results showed... VaHY5 The expression level was highest in leaves and lowest in stems, as shown in the results. Figure 1 As shown in 'a'.

[0034] In order to investigate VaHY5 This invention analyzes the orthologous genes of the plant in the cultivated grape 'Cabernet Sauvignon'. VvHY5 The expression pattern was determined through the following experiments: -2℃ low-temperature treatment was performed, using materials at room temperature at the same time point as a control. Cabernet Sauvignon leaves were collected at 0h, 3h, 6h, 12h, 24h, 48h, and 72h as materials to analyze the... VvHY5 Expression patterns involved in response to low-temperature stress were analyzed. VvHY5 The expression levels were found to have decreased to their lowest point after 24 hours of treatment at -2℃, followed by a significant increase. The expression levels at 48 hours and 72 hours were significantly higher than those in the control group. Figure 1 As shown in b in the figure. These results indicate that... HY5 Genes may play a key role in the cold stress response of grapes.

[0035] (2) VaHY5 Gene cloning and its sequence characterization RNA was extracted from leaves of 'Beibinghong' and reverse transcribed into cDNA template, which was then amplified using a high-fidelity enzyme. VaHY5 The CDS sequence was obtained and subjected to bioinformatics analysis. An overexpression vector was constructed to... VaHY5 Subcellular localization analysis of the protein was performed.

[0036] Based on the pCAMBIA2300-GFP vector and VaHY5 Sequence design with Sal I and BamH Primer pCAMBIA2300- for restriction enzyme site I VaHY5 -GFP- Sal IF and pCAMBIA2300- VaHY5 -GFP- BamH IR; pCAMBIA2300- VaHY5 -GFP- Sal The base sequence of IF is shown in SEQ ID NO.3, which is 5'-CGGGATCCATGGCTGAGCTGGTGAAG-3'; pCAMBIA2300- VaHY5 -GFP- BamH The base sequence of IR is shown in SEQ ID NO.4, which is 5'-ACGCGTCGACTTAAGCTTGGATCCTTAGT-3'. The recombinant vector pMD™18-T- VaHY5 Using the plasmid as a template, DNA polymerase PrimeSTAR was used for amplification. VaHY5 The CDS sequence. Using Sal I and BamH The pCAMBIA2300-GFP vector was double-digested with enzyme I, and then recovered separately. VaHY5 Gene fragments and vector fragments were used. Homologous recombination was employed, and the ligation product was introduced into *E. coli* strain DH5α using a heat shock method. The treated bacterial culture was spread onto LB agar plates containing 250 mg / L Kan and incubated at 37°C for 12 h. After PCR detection of single colonies, sequencing was performed, and plasmids with the correct sequences were extracted to obtain the overexpression vector pCAMBIA2300- VaHY5 -GFP. Agrobacterium EHA105 was transformed using the freeze-thaw method, and the bacterial culture was preserved for later use.

[0037] VaHY5 The gene's open reading frame (ORF) is 510 bp in length, encoding a protein composed of 169 amino acids with a molecular weight of 18.4 kDa and a theoretical isoelectric point (pI) of 9.74. VaHY5 The gene is located on chromosome 4 of the reference genome, covering the interval from 4716971 to 4720106 bp, and contains four exons, such as Figure 2 As shown in b in the figure. Phylogenetic analysis indicates that, VaHY5 With Eurasian grapes ( V. vinifera ) and wild grapes ( V. amurensis The close clustering of homologous genes indicates that it exhibits evolutionary conservation within the Vitaceae family, such as... Figure 2 As shown in c. Furthermore, multiple sequence alignment of VaHY5, AtHY5, MdHY5, and SlHY5 proteins revealed that they almost all possess highly conserved bZIP domains, such as... Figure 2 As shown in d.

[0038] VaHY5 The gene's base sequence is shown in SEQ ID NO.1, and is as follows: ATGCAGGAACAAGCTACGAGTTCTCTTGCGGCCAGCTCTTTACCTTCTAGTAGCGAGAGATCTTCTAGTTCTGCTCTTCAAGCCGAAGTAAAGGAAGGAATGGAGAGTGACGAGGAGATCAGAAGAG TGCCAGAGATCGGCAGTGGGGACCCGGCGGCCCATCAGCCTCCGGACGAGAGGCAGCTTTAGTGGCCGGTCCCGACCGGGTTCAGGCCTCAGGCGATGGTCAGAGAAAAAGAGGAAGAAGCCCGGCT GACAAAGAGAACAAGCGGTTAAAGAGGTTGTTGAGGAACAGAGTGTCAGCACAGCAAGCAAGGGAAAGGAAGAAAGCATACTTGAATGAGCTAGAGGTGAGGGTCAAAGACTTGGAGAGGAAGAACTC TGAGCTTGAAGAGAGGCTCTCCACCTTGCAAAATGAGAATCAGATGCTCAGACATATATTGAAGAACACCACAGCAAGCAGGAGAGGAGGAAGTAGTAATAATTCAAACGCAGATGGGTCTTTGTGA.

[0039] VaHY5 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.2, and is as follows: MQEQATSSLAASSLPSSSERSSSSAPHLEIKEGIESDEEIRRVPEFGGEAVGKETSGRESGSATGQERTQATVGESQRKRGRTPAEKENKRLKRLLRNRVSAQQARERKKAYLSELENRVKDLENKNSELEERLSTLQNENQMLRHILKNTTGNKRGGGGGSNADASL.

[0040] The cellular localization of the VaHY5 protein was determined using an Agrobacterium-mediated transient expression assay in tobacco leaves. Leaves were infected with Agrobacterium carrying the pCAMBIA2300-VaHY5-GFP construct, while simultaneously expressing the protein in tobacco leaves without... VaHY5 The empty vector pCAMBIA2300-GFP of the gene was used as a control. Confocal imaging showed that VaHY5::GFP was specifically localized in the cell nucleus, which was further confirmed by DAPI co-staining. In contrast, the GFP fluorescence in the control group was distributed throughout the cell, such as... Figure 2 As shown in 'e', ​​VaHY5 functions as a nuclear localization transcription factor.

[0041] (3) OE- VaHY5 Functional analysis of 'Cabernet Sauvignon' tissue culture seedlings under low temperature stress The recombinant overexpression vector pCAMBIA2300- VaHY5 -GFP was transiently transformed into 'Cabernet Sauvignon' tissue culture seedlings using Agrobacterium-mediated transformation, and transgenic positive plants OE#1~OE#6 were obtained by PCR and Western blotting. The following control groups were also set up: negative control group Nc; positive control group Pc and untransformed plant group UT; negative control group ddH2O; positive control group OE- VaHY5 -GFP plasmid; analysis was performed on the phenotype, physiological and biochemical indicators, and expression levels of related genes in untransformed plants to verify... VaHY5 Gene function under low temperature stress.

[0042] To investigate VaHY5 The mechanism of gene action under low-temperature stress was investigated by temporarily overexpressing it in the 'Cabernet Sauvignon' variety. Genomic DNA extracted from transgenic plants and analyzed by PCR confirmed the presence of the transgene and that the band size was consistent with expectations. Figure 3 As shown in a. Plants with high expression levels (OE#1~OE#3) were selected for further Western blotting to verify strong VaHY5-GFP expression in the transgenic plants, while no GFP signal was detected in the non-transgenic control group. Figure 3 As shown in b in the figure.

[0043] Three transgenic plants were randomly selected for expression analysis. The results showed that in the overexpressing plants... VaHY5 The expression level was 10 times that of UT plants, such as Figure 3 As shown in d. VaHY5 Overexpression of OE- enhanced the cold resistance of transgenic grapes. Cold resistance tests showed that after 3 days of immersion, OE- VaHY5The transgenic plants exhibited strong resistance to -2℃ low-temperature stress, with only some leaves wilting after 10 days, while the UT plants suffered more severe damage. Under normal conditions at 25℃, no significant phenotypic differences were observed between the transgenic and UT plants. Figure 3 As shown in c in the figure. Furthermore, low-temperature stress significantly reduced wild-type and OE- VaHY5 The maximum photochemical efficiency of PSII in plants, Fv / Fm, and PSII photoinhibition parameters. However, OE- VaHY5 The Fv / Fm value of the plant was consistently significantly higher than that of the wild-type plant, such as Figure 3 As shown in e and f.

[0044] Reactive oxygen species (ROS), as important signaling molecules in plants, play a crucial role in stress responses. Two major ROS, H₂O₂ and O₂, were detected by DAB and NBT histochemical staining, respectively. - Accumulation. Before -2℃ cold treatment, the UT group and OE- VaHY5 The reactive oxygen species (ROS) levels in the groups were comparable. However, after being treated at -2℃, the leaves in the UT group showed a deeper staining, indicating a higher accumulation of ROS. Figure 4 As shown in a and c in the figure. Consistent with the staining results, quantitative analysis confirmed OE- VaHY5 H2O2 and O2 accumulated by plants - Fewer than UT plants, as shown in the figure Figure 4 As shown in b and d in the figure. These results indicate that VaHY5 Overexpression enhances reactive oxygen species (ROS) scavenging ability, thereby increasing OE- VaHY5 Cold resistance of transgenic plants.

[0045] To evaluate the antioxidant response under low-temperature stress, the activities of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) in grape leaves were measured. 72 hours after low-temperature stress treatment, the activities of SOD, POD, and CAT in grape leaves were measured. VaHY5 The activities of all three enzymes in the plant were significantly higher than those in the UT control group, such as Figure 5 As shown in a, b, and c. Conversely, the malondialdehyde content and relative electrolyte leakage rate in the leaves are significantly reduced, as shown in... Figure 5 As shown in d and f. Similar to the activities of POD, SOD, and CAT, OE- VaHY5 The proline content in the leaves also increased significantly, such as Figure 5 As shown in 'e'. The overall results indicate that... VaHY5 Overexpression enhanced the physiological resistance of the Eurasian grape variety 'Cabernet Sauvignon' to frost damage.

[0046] To explore in depth VaHY5 The effect of overexpression on the grape CBF pathway was analyzed using qRT-PCR technology on transgenic plants and the UT group under -2℃ stress conditions. VvCBF3 , VvCBF4 , VvCBF6 and VvCOR27 The expression level. Compared with the UT group, OE- VaHY5 In the plant VvCBF3 Expression was significantly upregulated, such as Figure 6 As shown in 'a', transgenic plants exhibited [significant effects] at 12, 24, and 48 hours after low-temperature treatment. VvCBF4 Rapidly induced expression, such as Figure 6 As shown in b in the figure. VvCBF6 Expression levels remained unchanged in wild-type plants, but changed in OE- VaHY5 The level in the plant rose sharply after 12 hours and remained high, such as... Figure 6 As shown in c in the diagram. Similarly, VvCOR27 During the entire cryogenic treatment at OE- VaHY5 The expression level was significantly higher in the plant, such as Figure 6 As shown in d.

[0047] (4) OE- VaHY5 Functional analysis of stable genetically transformed 'Pinot Noir' callus under low temperature stress.

[0048] The recombinant overexpression vector pCAMBIA2300- VaHY5 -GFP was used to stably transform 'Pinot Noir' callus tissue using Agrobacterium-mediated transformation, and transgenic positive plants were obtained by PCR and Western blotting. Phenotypic, physiological and biochemical indicators, and expression levels of related genes were analyzed to verify the results. VaHY5 Gene function under low temperature stress.

[0049] To further verify VaHY5 The role of Agrobacterium-mediated ultrasound-assisted transformation in grape low-temperature stress was investigated, and six stable overexpressing strains were successfully obtained. VaHY5 The transgenic callus lines OE#2, OE#3, OE#14, OE#18, OE#41, and OE#53 were selected. Fluorescence imaging showed that the five lines OE#3, OE#14, OE#18, OE#41, and OE#53 exhibited strong GFP signals, while no GFP signal was detected in the UT group callus. Figure 7 As shown in b and c in the figure. qRT-PCR results confirmed that these lines... VaHY5 High gene expression was observed, with OE#3 showing approximately 120-fold increased expression compared to the UT group callus tissue. Figure 7 As shown in 'a'.

[0050] Three strains with high OE expression were selected. VaHY5 Cold resistance was tested on callus lines OE#3, OE#14, and OE#41. After treatment at 10℃ for 10 days, the cold resistance of OE- VaHY5The callus tissue was larger and had a higher fresh weight than the control group, such as Figure 8 As shown in a and b in the figure. Reactive oxygen species analysis shows that OE- VaHY5 The levels of hydrogen peroxide and superoxide anions decreased significantly before and after cold stress, such as Figure 8 As shown in c and d in the figure. The activities of antioxidant enzymes superoxide dismutase (SOD) and catalase (CAT) were significantly increased in transgenic callus before and after cold treatment, as shown in the figure. Figure 9 As shown in b and c in the figure. After low-temperature treatment, OE- VaHY5 In transgenic callus, POD activity is increased and MDA content is decreased, such as... Figure 9 As shown in a and d in the figure. These results indicate that... VaHY5 Overexpression can alleviate oxidative damage. After treatment at 10°C for 10 days, OE- VaHY5 The proline content of the transgenic lines was significantly increased, such as Figure 9 As shown in e. These findings indicate VaHY5 Cold resistance can be improved by enhancing antioxidant capacity and osmotic regulation capacity.

[0051] Following cold stress, UT grape callus tissue exhibited lower tolerance. CBF-COR pathway gene expression analysis showed that, compared to the UT group, OE- VaHY5 Callus tissue showed significantly upregulated levels under cold stress conditions. VvCBF3 , VvCBF4 , VvCBF6 and VvCOR27 The level of expression, such as Figure 10 As shown in a~d in the diagram.

[0052] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0053] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. Overexpression VaHY5 The application of gene-related biological products in grape cold-resistance breeding is characterized by, The VaHY5 The base sequence of the gene is shown as SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The VaHY5 The amino acid sequence of the protein expressed by the gene is shown in SEQ ID NO.

2.

3. The application according to claim 1, characterized in that, The biological product is VaHY5 Recombinant overexpression vectors of genes or recombinant engineered bacteria.

4. The application according to claim 3, characterized in that, The recombinant overexpression vector is used to express the... VaHY5 The gene was obtained by inserting it into the pCAMBIA2300-GFP vector.

5. The application according to claim 3, characterized in that, The recombinant Agrobacterium was obtained by introducing the recombinant overexpression vector into Agrobacterium.

6. The application according to claim 5, characterized in that, The Agrobacterium was EHA105.

7. The application according to claim 3, characterized in that, Using the recombinant overexpression vector to improve VaHY5 The expression level of genes is adjusted to improve the cold resistance of grapes, thereby breeding cold-resistant grape varieties.

8. The application according to claim 7, characterized in that, The following are methods to improve the cold resistance of grapes: RNA was extracted from grapes and reverse transcribed into cDNA; Using cDNA as a template, the primers shown in SEQ ID NO.3 and SEQ ID NO.4 were used to clone the sample. VaHY5 ; Will VaHY5 The vector was ligated into a recombinant overexpression vector; The recombinant overexpression vector was transformed into Agrobacterium to obtain recombinant Agrobacterium; By infecting plants with recombinant Agrobacterium, overexpression plants can be obtained, thereby improving the cold resistance of plants.

Images