Cell senescence persistent detection method based on fluorescent plasmid and application

Abstract

The invention discloses a fluorescent plasmid-based continuous detection method for cell senescence, which comprises the following steps: modifying a pWPXLd vector and connecting the modified pWPXLd vector with a promoter sequence of a senescence-related core gene p21 to construct a recombinant expression vector; then, by means of a lentivirus transfection system, the recombinant vector is introduced into a target cell, a DNA damage agent is used for inducing the target cell to generate an aging-related biological event, specifically activating a p21 promoter and driving green fluorescent protein expression, and continuous, stable and specific detection of the cell aging state is achieved. The invention also discloses an application of the method. The method and the application disclosed by the invention solve the problem that an existing senescence detection method is difficult to continuously and stably mark senescent cells.

Description

Technical Field

[0001] This invention belongs to the field of biological detection methods, specifically relating to a method for detecting persistent cell senescence based on fluorescent plasmids, and also to the application of this method. Background Technology

[0002] Currently, my country faces an increasingly severe aging population situation. With increasing age, a series of degenerative changes inevitably occur at the tissue, cellular, and molecular levels. Cellular senescence is a common phenomenon in the treatment of many diseases, such as pulmonary fibrosis, diabetes, Alzheimer's disease, brain injury, and cancer. As a crucial biological process, cellular senescence plays a vital role in tumor suppression, the aging process, tissue remodeling, and the development of age-related diseases.

[0003] In recent years, the search for methods to accurately determine whether cells have entered a senescent state has become a research hotspot in the field of aging research. Under in vitro culture conditions, senescent cells often exhibit a series of characteristic changes, among which increased cell volume is particularly significant, accompanied by alterations in various biomolecules. Researchers have developed several methods for identifying senescent cells, including staining for senescence-related β-galactosidase (SA-β-gal) activity and the detection of senescence-related marker molecules, such as upregulation of p21 and p16 expression, increased secretion of senescence-related secretory phenotype-related factors, and downregulation of cyclin A2, lamin B1, and the proliferation marker Ki67 expression levels. However, most of these detection methods require cell fixation, which can damage cell integrity and has certain limitations. Currently, there is a lack of methods for continuous labeling of senescence in live cells.

[0004] Cellular senescence manifests as a state of cell cycle arrest. Senescence-related proliferation arrest is primarily mediated by cyclin-dependent kinase (CDK) inhibitors 1 and 2A, commonly referred to as p21 and p16. These inhibitors block the assembly of the CDK-cyclin complex, which is involved in the G1-S phase transition cell cycle checkpoint. Specifically, p21 inhibits the activity of CDK2-cyclin E, maintaining retinoblastoma protein (Rb) in a hypophosphorylated G1 phase state. p16 directly interacts with and inhibits the activity of CDK4 / 6, leading to cell cycle arrest. Therefore, p21 and p16 are considered universal and reliable markers of cellular senescence. Currently, detection systems using p21 and p16 promoters and dual-luciferase plasmids constructed with pEGFP-N1 or pGL4.17 vectors can effectively detect senescence markers in live cells, but these systems are only suitable for transient expression. Cells often lose the marker signal 24-48 hours after transfection, and the target cell lines are often limited by transfection efficiency. Therefore, stable and continuous real-time detection and tracking technologies for markers of senescence in living cells are still lacking. This technological bottleneck, to some extent, hinders in-depth research into the biological characteristics of senescent cells and a comprehensive understanding of the mechanisms underlying the development of aging-related diseases. Summary of the Invention

[0005] The first objective of this invention is to provide a method for the continuous detection of cell senescence based on fluorescent plasmids, which solves the problem that existing senescence detection methods are unable to continuously and stably label senescent live cells.

[0006] A second objective of this invention is to provide an application of the above-described method.

[0007] The first technical solution adopted in this invention is: a method for continuous detection of cell senescence based on fluorescent plasmids. By modifying the pWPXLd vector and connecting it to the promoter sequence of the senescence-related core gene p21, a recombinant expression vector is constructed. Subsequently, the recombinant vector is introduced into target cells using a lentiviral transfection system. A DNA damaging agent is used to induce senescence-related biological events in the target cells, specifically activating the p21 promoter and driving the expression of green fluorescent protein, thereby achieving continuous, stable, and specific detection of cell senescence status.

[0008] The first technical solution adopted in this invention is further characterized by:

[0009] Furthermore, a method for detecting persistent cell senescence based on fluorescent plasmids includes the following steps: Step 1: Construct the EGFP fluorescent pWPXLd vector recombinant plasmid based on the promoter sequence of the human p21 gene; Step 2: Use the core gene vector plasmid and packaging plasmid to transfect HEK-293T cells to obtain lentiviral packaging solution; infect the target cell line with the lentiviral packaging solution, and after infection, treat the target cell line with a low dose of DNA damaging agent to induce cell senescence. Step 3: After induction treatment, continue culturing the cells for a certain period of time to allow them to fully enter the senescent state. Observe them under a fluorescence microscope 3 to 7 days after treatment with the DNA damaging agent to detect its labeling effect on cell senescence.

[0010] Furthermore, the method for constructing the EGFP fluorescent pWPXLd recombinant vector in step 1 is as follows: A pair of specific primers with restriction enzyme sites for amplifying the promoter of the human p21 gene are designed, and their sequences are as follows: Fragment 1 forward: 5'AAGGAAAAAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGA3'; Reverse: 5'CTTTCAAATTCCCACTCCTTTCAAG3'; Segment 2 forward: 5' GGAATTTGAAAGCTGACTGCCCCTA 3'; Reverse:5'CCTTAATTAAATTTAAATGTCGAAATTCCTCCCCTGTTGTCTGCCGCCGCTCTC 3'; Fragment 1, using pWPXLd as a template, was cloned to sequence the key elements regulating viral transcription, RRE and gp41 peptide, with a total length of 992 bp. Fragment 2, using the whole genome of HEK293T cells as a template, was amplified by PCR using synthesized primers specific to the p21 gene promoter, resulting in a target gene fragment of 2734 bp. The two fragments were then recombined and amplified using overlap extension PCR technology. The amplified 3714 bp fragment was ligated into the pWPXLd vector using the NotI and PacI restriction sites introduced in the primers to construct the p21 promoter EGFP reporter gene vector.

[0011] Furthermore, the nucleotide sequences of the key components RRE and gp41 peptide are shown in SEQ ID NO: 1; The nucleotide sequence of the gene fragment of the promoter is shown in SEQ ID NO: 2.

[0012] Furthermore, in step 2, the constructed p21 promoter EGFP is used as the core plasmid and combined with the packaging plasmid to form a lentiviral packaging solution. HEK-293T cells are used as tool cells for transfection, and the resulting lentiviral packaging solution is used to infect target cells.

[0013] Furthermore, the packaging plasmids used for lentivirus packaging include PAX and pMD2.G, with a plasmid ratio of p21 promoter EGFP:PAX:pMD2.G = 12μg:9μg:3μg. The transfection reagent is polyethyleneimine (PEI), and the viral fluid is collected 48-72 hours after transfection.

[0014] Furthermore, in step 2, the target cell line is human small cell lung cancer NCI-H446 cells, with a cell density of 40%-50% before infection. After 8-10 hours of virus treatment, the cells are replaced with normal culture medium.

[0015] Furthermore, the DNA damaging agent was a combination of cisplatin and etoposide, with concentrations of 0.3-0.5 μM for cisplatin and 0.9-1.5 μM for etoposide, and the treatment time was 48 hours.

[0016] Furthermore, in step 3, fluorescence detection was performed 3-7 days after induction treatment, using the 488nm channel and bright field channel of a fluorescence microscope for simultaneous imaging over a continuous period of 48 hours, in an environment of 37℃ and 5% CO2.

[0017] The method also includes SA-β-gal staining of senescent cells to verify the senescence state, and the staining results are used as evidence for the fluorescent labeling detection results.

[0018] The second technical solution adopted in this invention is: the application of the above-mentioned method in cell aging-related research, anti-aging drug screening, or aging-related disease diagnosis and treatment evaluation.

[0019] The beneficial effects of this invention are: The pWPXLd recombinant expression vector generated by this invention remains stable after transfection, and the cellular senescence process can be visually displayed through fluorescence imaging labeling. This method has advantages such as high sensitivity, visualization and real-time performance, and strong stability, enabling continuous and effective detection of cellular senescence. This method is not only applicable to in vitro cell experiments but also feasible in animal model studies, providing a technical means for long-term continuous monitoring of aging-related diseases and intuitive screening of senescence-clearing drugs.

[0020] This invention features a simple and efficient process, easy-to-master operation steps, and high specificity and stability—fluorescence expression is triggered only when cellular senescence is induced, and this effect is continuous. Compared to existing technologies, this method overcomes the technical bottleneck of continuous and stable labeling of in vitro live cell senescence, enabling sustainable real-time dynamic monitoring of the aging process. This technology provides an intuitive, precise, and reliable research tool for in-depth analysis of the biological behavior characteristics, fate transition mechanisms, and interactions with the microenvironment of senescent cells, and has broad application prospects in the study of aging-related disease mechanisms and drug screening. Attached Figure Description

[0021] Figure 1 This is the pWPXLd carrier spectrum of the present invention; Figure 2 This is an electrophoresis image of the pWPXLd vector digested with enzymes according to the present invention; Figure 3 This is an electrophoresis diagram of gene amplification of viral transcription elements of the pWPXLd vector of the present invention; Figure 4 This is an electrophoresis diagram of the p21 promoter gene amplification of the present invention; Figure 5 This is a PCR electrophoresis image of the overlapping extension gradient annealing of fragments 1 and 2 of the present invention; Figure 6 This is an electrophoresis diagram comparing fragments 1 and 2 of the present invention with the PCR products after overlapping extension; Figure 7 This is an electrophoresis diagram of the p21 promoter EGFP fluorescent recombinant plasmid miniprep of this invention; Figure 8a This is a schematic diagram of the staining detection of chemotherapy-induced senescent cells according to the present invention; Figure 8b This is a schematic diagram illustrating the proportion of positive cells in the staining detection of chemotherapy-induced senescent cells according to the present invention; Figure 9 This is a schematic diagram of fluorescence detection of the p21 promoter EGFP aging tag of the present invention; Figure 10 This is a schematic diagram of the continuous detection of the p21 promoter EGFP senescence tag of the present invention. Detailed Implementation

[0022] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0023] pWPXLd, a lentiviral expression plasmid, differs from traditional fluorescent labeling vectors like pGL4.17 and pEGFP-N1. The fluorescent signals exhibited by traditional vectors are gradually lost due to cell proliferation or prolonged transfection time, while pWPXLd possesses excellent stability, efficiently infecting cells in both dividing and non-dividing phases, providing strong support for long-term and stable gene expression. Furthermore, the lentiviral particles packaged by the pWPXLd vector can integrate into the host genome, exhibiting high copy numbers and efficient expression. Simultaneously, this vector also carries markers such as green fluorescent protein (EGFP), facilitating screening and visual tracking in mammalian cells.

[0024] Given the aforementioned characteristics of the pWPXLd vector, this invention modifies it and applies it to the field of gene function research. p21, as a key factor regulating the cell cycle, is considered a significant marker of various cellular senescence processes when upregulated. Based on this, this study directionally recombines the p21 promoter with the pWPXLd vector to construct a p21 promoter EGFP fluorescent recombinant vector, developing a novel method for continuously labeling cellular senescence processes through fluorescence changes. The p21 promoter EGFP fluorescence modified with the pWPXLd vector remains stable after transfection, and the cellular senescence process can be visually displayed through fluorescence imaging. This method has advantages such as high sensitivity, visualization and real-time performance, and strong stability, enabling continuous and effective detection of cellular senescence. This method is not only applicable to in vitro cell experiments but also feasible in animal model studies, providing a technical means for long-term continuous monitoring of aging-related diseases and intuitive screening of senescence-clearing drugs.

[0025] This invention provides a method for persistent detection of cellular senescence based on fluorescent plasmids. A recombinant expression vector is constructed by cloning and ligating the promoter sequence of the senescence-related core gene p21 into the pWPXLd vector. Subsequently, using a lentiviral transfection system, this recombinant vector is efficiently introduced into target cells, achieving continuous, stable, and specific detection of cellular senescence. This detection system can monitor senescent cells in real time, providing a powerful tool for in-depth research on diseases related to cellular senescence.

[0026] This invention modifies the pWPXLd vector to achieve stable and high expression of the promoter combination, which persists after transfection. When target cells undergo senescence-related biological events induced by chemotherapy drugs, the p21 promoter is specifically activated, driving the expression of green fluorescent protein, thereby presenting a distinct green fluorescent signal in senescent cells, ensuring the persistence and accuracy of senescent cell detection.

[0027] This invention is a cell senescence detection technology based on senescence-related gene promoter plasmids, which can be used to study the cell senescence process and to screen and develop anti-aging drugs.

[0028] The technical solution of the present invention will be further illustrated below through embodiments.

[0029] Example 1 The method for persistent detection of cellular senescence based on fluorescent plasmids involves cloning the promoter sequence of the senescence-related core gene p21 and ligating it into the pWPXLd vector to construct a recombinant expression vector. Subsequently, using a lentiviral transfection system, the recombinant vector is introduced into target cells. A DNA damaging agent is used to induce senescence-related biological events in the target cells, specifically activating the p21 promoter and driving the expression of green fluorescent protein, thereby achieving continuous, stable, and specific detection of cellular senescence.

[0030] Example 2 A method for detecting persistent cell senescence based on fluorescent plasmids includes the following steps: Step 1: Construct the EGFP fluorescent pWPXLd vector recombinant plasmid based on the promoter sequence of the human p21 gene; The method for recombining the EGFP fluorescent pWPXLd vector is as follows: Design a pair of specific primers for the promoter amplification of the human p21 gene with restriction enzyme sites, the sequences of which are as follows: Fragment 1 forward: 5'AAGGAAAAAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGA3'; Reverse: 5'CTTTCAAATTCCCACTCCTTTCAAG3'; Segment 2 forward: 5' GGAATTTGAAAGCTGACTGCCCCTA 3'; Reverse:5'CCTTAATTAAATTTAAATGTCGAAATTCCTCCCCTGTTGTCTGCCGCCGCTCTC 3'; Fragment 1, using pWPXLd as a template, was cloned to sequence the key elements regulating viral transcription, RRE and gp41 peptide, with a total length of 992 bp. Fragment 2, using the whole genome of HEK293T cells as a template, was amplified by PCR using synthesized primers specific to the p21 gene promoter, resulting in a target gene fragment of 2734 bp. The two fragments were then recombined and amplified using overlap extension PCR technology. The amplified 3714 bp fragment was ligated into the pWPXLd vector using the NotI and PacI restriction sites introduced in the primers to construct the p21 promoter EGFP reporter gene vector.

[0031] The nucleotide sequences of the key components RRE and gp41 peptide are shown in SEQ ID NO: 1; The nucleotide sequence of the gene fragment of the promoter is shown in SEQ ID NO: 2; Step 2: Use the core gene vector plasmid and packaging plasmid to transfect HEK-293T cells to obtain lentiviral packaging solution; infect the target cell line with the lentiviral packaging solution, and after infection, treat the target cell line with a low dose of DNA damaging agent to induce cell senescence. In step 2, the constructed p21 promoter EGFP is used as the core plasmid and combined with the packaging plasmid to form a lentiviral packaging solution. HEK-293T cells are used as tool cells for transfection, and the resulting lentiviral solution is used to infect target cells.

[0032] The packaging plasmids used for lentivirus packaging include PAX and pMD2.G, with a plasmid ratio of p21 promoter EGFP:PAX:pMD2.G = 12μg:9μg:3μg. The transfection reagent is polyethyleneimine (PEI), and the viral fluid is collected 48-72 hours after transfection.

[0033] The target cell line was human small cell lung cancer NCI-H446 cells, with a cell density of 40%-50% before infection. After 8-10 hours of virus treatment, the cells were replaced with normal culture medium.

[0034] The DNA damaging agent was a combination of cisplatin and etoposide, with concentrations of 0.3-0.5 μM for cisplatin and 0.9-1.5 μM for etoposide, and the treatment time was 48 hours.

[0035] Step 3: After induction treatment, continue culturing the cells for a certain period of time to allow them to fully enter the senescent state. Observe them under a fluorescence microscope 3 to 7 days after chemotherapy drug treatment to detect its labeling effect on cell senescence. Fluorescence detection was performed 3-7 days after induction treatment. Simultaneous imaging was performed using the 488nm channel and bright field channel of a fluorescence microscope for 48 consecutive hours in an environment of 37℃ and 5% CO2.

[0036] The method also includes SA-β-gal staining of senescent cells to verify the senescence state, and the staining results are used as evidence for the fluorescent labeling detection results.

[0037] Example 3 The above methods can be applied in cell senescence-related research, anti-aging drug screening, or diagnosis and treatment evaluation of senescence-related diseases.

[0038] Example 4 1. Construction of p21 promoter EGFP fluorescent recombinant vector First, the pWPXLd vector was directionally modified to achieve p21 promoter-specific activation of green fluorescent protein (EGFP) expression. Based on the pWPXLd vector map, as shown... Figure 1 As shown, the restriction endonucleases NotI HF (NEB, R3189V) and PacI (NEB, R0547V) can use the same Cut Smart digestion buffer when digesting the vector and fragment. However, during the vector digestion process, the key elements regulating viral transcription, RRE and gp41 peptide, are also removed. Therefore, during the vector construction process, the genes of the viral transcription elements of the pWPXLd vector and the p21 promoter need to be amplified separately, and then the two fragments are overlapped and extended to finally obtain the target fragment for the recombinant vector.

[0039] 1.1 Identification and recovery of pWPXLd vector by double digestion with NotI and PacI The pWPXLd vector was double-digested using NotI and PacI enzymes. The digestion system (100 μL) consisted of: 10 μL of CutSmart™ Buffer, 4 μg of DNA (volume depends on concentration), 2 μL each of the two restriction endonucleases (NotIHF and PacI), and double-distilled water to a final volume of 100 μL. The digestion was performed in a 37°C water bath for 3-4 hours. The digested vector was then subjected to 1% agarose gel electrophoresis. The electrophoresis results showed only one clean band at approximately 8279 bp, indicating successful cleavage of the vector. Figure 2 As shown. Subsequently, the gel was recovered using a gel recovery kit (Tiangen, DP219), following the instructions in the kit's manual.

[0040] 1.2 PCR recombination of the target fragment 1.2.1 Gene cloning of viral transcription elements in pWPXLd vector (fragment 1) PCR amplification was performed on the key transcriptional element RRE and the gp41 peptide sequence in the pWPXLd vector. Primers were designed using Primer Premier 5 software, avoiding mismatches, hairpin structures, and ensuring similar annealing temperatures for both primers. Appropriate restriction enzyme sites and corresponding protective bases were added to the 5' ends of both primers. A primer for fragment 1 was designed, and its sequence is as follows: Forward: 5'AAGGAAAAAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGA3'; Reverse: 5' CTTTCAAATTCCCACTCCTTTCAAG 3'; Using pWPXLd vector as a template, the fragment amplification PCR system (50 μL) consisted of: 1 μL each of 10 μM full-length primers (forward and reverse), 10 ng DNA (volume depends on concentration), 0.5 μL Primer STAR, 10 μL 5×GC Buffer, 4 μL dNTPs, and double-distilled water to a final volume of 50 μL. The PCR program parameters were: 98℃ for 15 seconds, then 58℃ for 5 seconds, then 72℃ for 1 minute, for 38 cycles. Subsequent 1.5% agarose gel electrophoresis yielded the target fragment with a molecular weight of approximately 1000 bp. Figure 3 As shown.

[0041] 1.2.2 PCR amplification of the target gene p21 promoter (fragment 2) To construct the p21 promoter EGFP fluorescent recombinant vector, the promoter sequence of the target gene p21 needs to be obtained. The p21 promoter fragment was obtained from the UCSC and Ensemble databases. Primers for the selected target fragment were designed using Primer Premier 5 software. Using the whole genome of HEK293T cells as a template, PCR amplification was performed using synthesized primers specific to the p21 gene promoter.

[0042] The primers for the p21 promoter (fragment 2) have the following sequence: Positive: 5' GGAATTTGAAAGCTGACTGCCCCTA 3'; Reverse: 5'CCTTAATTAAATTTAAATGTCGAAATTCCTCCCCTGTTGTCTGCCGCCGCTC TC 3'; PCR system (50 μL): 1 μL each of 10 μM forward and reverse primers, 200 ng DNA (volume depends on concentration), 0.5 μL PrimerSTAR, 10 μL 5× GC Buffer, 4 μL dNTPs, and double-distilled water to a final volume of 50 μL; PCR program parameters: 98℃ 15 s - 58℃ 5 s - 72℃ 3 min, 38 cycles. Subsequent 1.5% agarose gel electrophoresis yielded a target fragment with a molecular weight of approximately 3000 bp, as shown below. Figure 4 As shown.

[0043] 1.2.3 Overlapping extension of segments 1 and 2 The amplified fragments 1 and 2 were extended by overlap. First, a PCR system (48 μL) was constructed excluding primers: 100 ng each of fragments 1 and 2 (volume depends on concentration), 0.5 μL Primer STAR, 10 μL 5× GC Buffer, 4 μL dNTPs, and double-distilled water was added to bring the volume to 48 μL. The PCR program parameters were: 98℃ for 15 seconds, 58℃ for 5 seconds, and 72℃ for 4 minutes, for 8 cycles to ensure base pairing of the overlapping sequences of fragments 1 and 2. Then, 1 μL each of the forward primer of fragment 1 and the reverse primer of fragment 2 (10 μM concentration) were added to form a 50 μL system, and 40 cycles of amplification were performed. Gradient annealing was selected, with temperatures set at 45-50-55-60-65℃. Subsequent 1.5% agarose gel electrophoresis yielded a target fragment with a molecular weight of approximately 4000 bp. Annealing conditions of 50 and 55℃ were found to be optimal. Figure 5 As shown.

[0044] Further comparison of the obtained fragments 1 and 2 with the PCR products after overlap extension revealed target fragments with molecular weights of 1000bp, 3000bp, and 4000bp, respectively, by 1.5% agarose gel electrophoresis. Figure 6 As shown.

[0045] 1.3 Recovery of the target fragment by double digestion with NotI and PacI The target fragment after overlapping extension was digested and recovered using the following digestion system (50 μL): CutSmart™ Buffer 5 μL, DNA 2 μg (volume depends on concentration), 1 μL each of two restriction endonucleases (NotI HF and PacI), and double-distilled water to a final volume of 50 μL. Digestion was performed in a 37°C water bath for 2 hours. The target DNA fragment was then recovered using a gel extraction kit for subsequent vector ligation.

[0046] 1.4 Ligation of the target gene to the enzyme-digested vector The entire ligation process was performed on ice. Ligation system (20 μL): 100 ng digested vector, 500 ng digested fragment (promoter:vector = 5:1), 1 μL T4 DNA ligase, 2 μL T4 DNA ligase buffer, and double-distilled water to a final volume of 20 μL. The mixture was incubated at room temperature for 6 hours.

[0047] 1.5 Plasmid Transformation Competent *E. coli* DH5α cells were selected and removed from -80°C and placed on ice for 5 minutes. The ligated recombinant DNA was added to the competent cell suspension, and the contents were gently mixed. The mixture was then placed on ice for 30 minutes. The centrifuge tubes were then heat-shocked in a 42°C water bath for 90 seconds and quickly transferred to ice for 3 minutes. 800 μL of sterile LB medium (antibiotic-free) was added to the centrifuge tubes, mixed, and incubated at 37°C with shaking for 1 hour (220 rpm). The cells were then revived to allow expression of the relevant antibiotic resistance marker gene on the plasmid.

[0048] After centrifuging the transformed competent cells at low speed (1000 rpm, 5 minutes), discard 800 μL of supernatant. Gently pipette the suspended bacterial cells and add them to LB solid agar medium containing ampicillin. Spread the agar evenly using a sterile glass spreader. Incubate the plates upside down in a 37°C incubator for 12-16 hours; white dotted single-clone colonies will appear.

[0049] 1.6 Plasmid Extraction Nine single colonies were randomly selected and cultured in 3 mL of LB medium containing ampicillin at 37°C for 8 hours. The resulting bacterial suspension was centrifuged (12000 rpm, 1 minute) to obtain bacterial cells. These cells were extracted using a miniprep kit (Tiangen, DP103) and subjected to agarose gel electrophoresis. Colonies 1, 2, 3, and 4 had a molecular weight of approximately 12000 bp. Figure 7 As shown. After gene sequencing, the sequence of bacterial cell No. 2 was completely matched with the primer sequence using BLAST. Then, the bacterial culture of No. 2 was amplified and cultured in 100 mL of LB medium with shaking for 12-16 hours. After centrifugation (12000 rpm, 5 minutes), bacterial cells were obtained. The cells were extracted using an endotoxin-free large-scale extraction kit (Tiangen, DP117) to obtain the p21 promoter EGFP fluorescent recombinant plasmid.

[0050] Example 5 Step 2. Preparation and transfection of the p21 promoter EGFP recombinant vector Step 2.1 Lentiviral packaging and infection of p21 promoter EGFP Cell line selection: Human embryonic kidney cells HEK-293T cells were used. Culture medium preparation: Prepare an appropriate amount of culture medium containing 10% fetal bovine serum and DMEM high glucose medium.

[0051] Step 2.1.1: Lentiviral packaging (10cm plate) (1) The day before formal transfection, HEK-293T cells were plated so that the cell density was approximately 70%-80% the next day, at which point the virus could be encapsulated.

[0052] (2) Transfection: On the second day, observe the cell state and density. Replace the HEK-293T medium with 4 mL of serum-free DMEM empty culture. Adding empty culture allows for microscopic observation of whether the cells shrink rapidly. If this occurs, the infection efficiency may be affected due to poor cell state.

[0053] (3) Add 100 μL of DMEM empty culture to a 1.5 mL centrifuge tube, and mix the plasmids in the following ratio: p21 promoter EGFP plasmid: packaging plasmid PAX: packaging plasmid pMD2.G = 12 μg: 9 μg: 3 μg. After mixing the plasmids, add 8 μL of PEI and mix immediately after adding PEI, trying to avoid air bubbles. Incubate at room temperature for 15 minutes. Slowly add the incubated liquid to the cell culture dish and shake well, then return it to the cell culture incubator.

[0054] (4) After 6-8 hours, replace with 5 mL of DMEM complete medium containing serum.

[0055] (5) On the second day, at the same time as the virus, replace it with 5.5-6 mL of DMEM complete culture medium containing serum.

[0056] (6) A batch of virus solution can be collected 48 hours after virus packaging. The collected virus solution needs to be filtered through a 0.45μm filter membrane and stored in a 4℃ refrigerator. At the same time, add 5.5-6mL of serum-containing DMEM complete culture medium to the cells to prepare for the next virus collection.

[0057] (7) The second virus collection can be carried out 72 hours after the virus is packaged.

[0058] Step 2.1.2: Virus infection of cells (10cm plate) (1) The day before the infection, the infected human small cell lung cancer NCI-H446 cells should be plated, and the cell density should be approximately 40%-50% before the infection can proceed.

[0059] (2) On the second day, add 5 mL of filtered virus to the cells to be infected, then add 10 μL of polybrene (1 μg / mL), and continue culturing for 8-10 hours before changing the medium to 8 mL of the serum-containing complete culture medium used in the cell culture.

[0060] (3) On the third day, a second infection was performed at the same time, following the same procedure as in operation (2). After 48 hours, the cells could be further treated with chemotherapy drugs to induce cell senescence.

[0061] Example 6 Step 3: Detection and application of live cell senescence markers Step 3.1 Inducing cellular senescence using DNA damaging agents Cell line selection: Human small cell lung cancer NCI-H446 cells were used. Culture medium preparation: Prepare an appropriate amount of culture medium containing 10% fetal bovine serum (FBS) and RPMI-1640.

[0062] Induction of cellular senescence: Cisplatin and etoposide are first-line chemotherapy drugs for the clinical treatment of small cell lung cancer. These two drugs, as DNA damaging agents, often lead to treatment-induced cellular senescence. Therefore, NCl-H446 cells transfected with the p21 promoter EGFP plasmid were treated with a combination of clinical chemotherapy drugs (0.3 μM cisplatin and 0.9 μM etoposide) for 48 hours to induce cellular senescence.

[0063] Step 3.2 Staining detection of senescent cells Senescence-associated β-galactosidase (SA-β-gal) staining is a universal detection method for cell senescence, used to validate senescence detection technologies. Chemotherapy-induced cell senescence is gradual, often occurring gradually over several days after treatment. By fixing cells and staining them with SA-β-gal at different times after chemotherapy, microscopic examination revealed a gradual increase in the proportion of senescent-positive cells (appearing blue) within 3-7 days after chemotherapy treatment. The proportion of senescent-positive cells was significantly higher at 7 days post-chemotherapy compared to day 0. This indicates successful induction of cell senescence, and at this stage, the cells have gradually entered a senescent state. Figure 8a and Figure 8b As shown.

[0064] Step 3.3 Live cell detection of aging markers Using the pWPXLd vector empty vector as the control group and the p21 promoter EGFP as the experimental group, the green fluorescence of EGFP was detected by fluorescence microscopy using the green fluorescence channel, while the bright field channel was used to record cell morphology. Both channels were used for imaging. Green fluorescence was clearly observed in the control group, indicating that the empty vector could be stably expressed in NCl-H446 cells. In the experimental group, green fluorescence was not activated on day 0 after chemotherapy treatment, before cell senescence; weak green fluorescence was observed on day 3 after treatment; and on day 7 after treatment, when tumor cells significantly enlarged and entered deep senescence, green fluorescence labeling was significantly activated. Figure 9 As shown.

[0065] Combined with SA-β-gal staining verification, the results of the green fluorescent labeling of senescent cells were consistent with the proportion of senescent positive cells, indicating that the cells entered the senescent state 3-7 days after chemotherapy treatment. Therefore, the fluorescent labeling was activated by the p21 promoter, indicating that the p21 promoter EGFP fluorescent recombinant vector successfully labeled senescent live cells with specificity and could indicate senescent cells by fluorescence.

[0066] Step 3.4 Continuous detection of aging markers Two days after chemotherapy, cells were digested with trypsin and reseeded in bottom-mounted glass culture dishes at a density of approximately 30% to allow senescent cells to fully extend and adhere to the bottom of the dish. After 24 hours, the culture dishes were placed in a live-cell workstation (Zeiss Cell Discoverer 7 with LSM 900), set to 37°C and 5% CO2 concentration, and the microscope was used to simultaneously capture images in the green fluorescence and bright field channels for 48 hours.

[0067] Continuous imaging revealed that NCI-H446 cells did not emit green fluorescence in their non-senescent state, but green fluorescence labeling was initiated as they entered the senescent state over time. Furthermore, continuous monitoring from 0 to 10 hours showed that the fluorescence indicator stably labeled senescent cells as the senescence process intensified. This demonstrates the successful application of this senescent live-cell labeling technology. Figure 10 As shown.

[0068] sequence list sequence list <110> Xi'an Peihua University <120> Methods and applications for detecting persistent cell senescence based on fluorescent plasmids <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 992 <212> DNA <213> Artificial sequence <400> 1 aaggaaaaaa gcggccgctg atcttcagac ctggaggagg agatatgagg gacaattgga60 gaagtgaatt atataaatat aaagtagtaa aaattgaacc attaggagta gcacccacca120 aggcaaagag aagagtggtg cagagagaaa aaagagcagt gggaatagga gctttgttcc180 ttgggttctt gggagcagca ggaagcacta tgggcgcagc gtcaatgacg ctgacggtac240 aggccagaca attattgtct ggtatagtgc agcagcagaa caatttgctg agggctattg300 aggcgcaca gcatctgttg caaccacag tctggggcat caagcagctc caggcacaa360 tcctggctgt ggaaagatac ctaaaggatc aacagctct ggggatttgg ggttgctctg420 gaaaactcat ttgcaccact gctgtgcctt ggaatgctag tggagtaat aaatctctgg480 aacagatttg gatcacacg acctggatgg agtgggacag agaattaac attackacacaa540 gcttaataca ctccttaatt gagaatcgc aaaaccagca agaaagaat gaacaagaat 600 tattggaatt agataaatgg gcaagttgt ggaatttggtt taacaataca aattggctgt660 ggtatataa attattcata atgatagtag gaggcttggt aggtttaaga atagttttg 720 ctgtactttc tatagtgaat agagttaggc agggatattc accattatcg ttcagaccc780 acctcccaac cccgagggga cccgacaggc ccgaaggaat agagagaa ggtggagaga840 gagacagaga cagatccatt cgattagtga acggatctcg acggtatcga tgtcgacgat900 aagctttgca aagatggata aagttttaaa cagagaggaa tcttgcagc taatggacct960 tctaggtctt gaaaggagtg ggaatttgaa ag992 <210>2 <211>2734 <212>DNA <213>Artificial Sequence <400>2 ggaatttgaa agctgactgc ccctatttgg gactccccag tctctttctg agaaatggtg60 acattgttcc cagcacttcc tctcccttcc taggcagctt ctgcagccac cactgagcct120 tcctcacatc ctccttcttc aggcttgggc tttccacctt tcaccattcc cctaccccat180 gctgctccac cgcactctgg ggagggggct ggactgggca ctcttgtccc ccaggctgag240 cctccctcca tccctatgct gcctgcttcc caggaacatg cttgggcagc aggctgtggc300 tctgattggc tttctggccg tcaggaacat gtcccaacat gttgagctct ggcatagaag360 aggctggtgg ctattttgtc cttgggctgc ctgttttcag gtgaggaagg ggatggtagg420 agacaggaga cctctaaaga ccccaggtaa accttagcct gttactctga acagggtatg480 tgatctgcca gcagatcctt gcgacagggc tgggatctga tgcatgtgtg cttgtgtgag540 tgtgtgctgg gagtcagatt ctgtgtgtga cttttaacag cctgctccct tgcctttttc600 agggcagaag tcctccctta gagtgtgtct gggtacacat tcaagtgcat ggttgcaaac660 tttttttttt aaagcactga atagtactag acacttagta ggtacttaag aaatattgaa720 tgtcgtggtg gtggtgagct agaagttata aaaaaaattc tttcccaaaa acaacaacaa780 aaagaattat ttcattgtga agctcagtac cacaaaaatt taaataattc attacaagcc840 tttattaaaa aaaattttct ccccaaagta aacagacaga caatgtctag tctatttgaa900 atgcctgaaa gcagaggggc ttcaaggcag tgggagaagg tgcctgtcct ctgctggaca960 tttgacaacc agccctttgg atggtttgga tgtataggag cgaaggtgca gacagcagtg1020 gggcttagag tggggtcctg aggctgtgcc gtggcctttc tggggtttag ccacaatcct1080 ggcctgactc cagggcgagg caggccaagg gggtctgcta ctgtgtcctc ccacccctac1140 ctgggctccc atccccacag cagaggagaa agaagcctgt cctccccgag gtcagctgcg1200 ttagaggaag aagactgggc atgtctgggc agagatttcc agactctgag cagcctgaga1260 tgtcagtaat tgtagctgct ccaagcctgg gttctgtttt ttagtgggat ttctgttcag1320 atgaacaatc catcctctgc aattttttaa aagcaaaact gcaaatgttt caggcacaga1380 aaggaggcaa aggtgaagtc caggggaggt caggggtgtg aggtagatgg gagcggatag1440 acacatcact catttctgtg tctgtcagaa gaaccagtag acacttccag aattgtcctt1500 tatttatgtc atctccataa accatctgca aatgagggtt atttggcatt tttgtcattt1560 tggagccaca gaataaagg atgacaagca gagagccccg ggcaggaggc aaaagtcctg1620 tgttccaact atagtcattt ctttgctgca tgatctgagt taggtcacca gacttctctg1680 agccccagtt tccccagcag tgtatacggg ctatgtgggg agtattcagg agacacaa1740 ctcactcgtc aaatcctccc cttcctggcc aacaaagctg ctgcaaccac agggatttct1800 tctgttcagg tgagtgtagg gtgtagggag attggttcaa tgtccaattc ttctgtttcc1860 ctggagatca ggttgccctt ttttggtagt ctctccaatt ccctccttcc cggaagcatg1920 tgacaatcaa caactttgta tacttaagtt cagtggacct caatttcctc atctgtgaaa1980 taaacgggac tgaaaaatca ttctggcctc aagatgcttt gttggggtgt ctaggtgctc2040 caggtgcttc tgggagaggt gacctagtga gggatcagtg ggaatagagg tgatattgtg2100 gggcttttct ggaaattgca gagaggtgca tcgtttttat aatttatgaa tttttatgta2160 ttaatgtcat cctcctgatc ttttcagctg cattgggtaa atccttgcct gccagagtgg2220 gtcagcggtg agccagaaag ggggctcatt ctaacagtgc tgtgtcctcc tggagagtgc2280 caactcattc tccaagtaaa aaaagccaga tttgtggctc acttcgtggg gaaatgtgtc2340 cagcgcacca acgcaggcga gggactgggg gaggagggaa gtgccctcct gcagcacgcg2400 aggttccggg accggctggc ctgctggaac tcggccaggc tcagctggct cggcgctggg2460 cagccaggag cctgggcccc ggggagggcg gtcccgggcg gcgcggtggg ccgagcgcgg2520 gtcccgcctc cttaggaggc gggcccgggc ggggcggttg tatatcaggg ccgcgctgag2580 ctgcgccagc tgaggtgtga gcagctgccg aagtcagttc cttgtggagc cggagctggg2640 cgcggattcg ccgaggcacc gaggcactca gaggaggtga gagagcggcg gcagacaaca2700 ggggaggaat ttcgacattt aaatttaatt aagg2734。

Claims

1. A method for detecting persistent cell senescence based on fluorescent plasmids, characterized in that, A recombinant expression vector was constructed by modifying the pWPXLd vector and linking it to the promoter sequence of the aging-related core gene p21. Subsequently, the recombinant vector was introduced into target cells using a lentiviral transfection system. A DNA damaging agent was used to induce aging-related biological events in the target cells, specifically activating the p21 promoter and driving the expression of green fluorescent protein, thus achieving continuous, stable and specific detection of cellular senescence.

2. The method according to claim 1, characterized in that, The method includes the following steps: Step 1: Construct the EGFP fluorescent pWPXLd vector recombinant plasmid based on the promoter sequence of the human p21 gene; Step 2: Transfect HEK-293T cells with the core gene vector plasmid and packaging plasmid to obtain lentiviral packaging solution; infect the target cell line with the lentiviral packaging solution, and after infection, treat the target cell line with a low dose of DNA damaging agent to induce cell senescence. Step 3: After induction treatment, continue culturing the cells for a certain period of time to allow them to fully enter the senescent state. Observe them under a fluorescence microscope 3 to 7 days after treatment with the DNA damaging agent to detect its labeling effect on cell senescence.

3. The method according to claim 1, characterized in that, The method for constructing the EGFP fluorescent pWPXLd recombinant vector in step 1 is as follows: A pair of specific primers with restriction enzyme sites for amplifying the promoter of the human p21 gene are designed, and their sequences are as follows: Fragment 1 forward: 5'AAGGAAAAAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGA3'; Reverse: 5'CTTTCAAATTCCCACTCCTTTCAAG3'; Segment 2 forward: 5' GGAATTTGAAAGCTGACTGCCCCTA 3'; Reverse: 5'CCTTAATTAAATTTAAATGTCGAAATTCCTCCCCTGTTGTCTGCCGCCGCTCTC 3'; Fragment 1, using pWPXLd as a template, was cloned to sequence the key elements regulating viral transcription, RRE and gp41 peptide, with a total length of 992 bp. Fragment 2, using the whole genome of HEK293T cells as a template, was amplified by PCR using synthesized primers specific to the p21 gene promoter, resulting in a target gene fragment of 2734 bp. The two fragments were then recombined and amplified using overlap extension PCR technology. The amplified 3714 bp fragment was ligated into the pWPXLd vector using the NotI and PacI restriction sites introduced in the primers to construct the p21 promoter EGFP reporter gene vector.

4. The method according to claim 3, characterized in that, The nucleotide sequences of the key components RRE and gp41 peptide are shown in SEQ ID NO: 1; The nucleotide sequence of the gene fragment of the promoter is shown in SEQ ID NO:

2.

5. The method according to claim 4, characterized in that, In step 2, the constructed p21 promoter EGFP is used as the core plasmid and combined with the packaging plasmid to form a lentiviral packaging solution. HEK-293T cells are used as tool cells for transfection, and the resulting lentiviral packaging solution is used to infect target cells.

6. The method according to claim 5, characterized in that, The packaging plasmids used for the lentivirus packaging include PAX and pMD2.G, with a plasmid ratio of p21 promoter EGFP:PAX:pMD2.G = 12μg:9μg:3μg. The transfection reagent is polyethyleneimine (PEI), and the virus solution is collected 48-72 hours after transfection.

7. The method according to claim 5, characterized in that, In step 2, the target cell line is human small cell lung cancer NCI-H446 cells, with a cell density of 40%-50% before infection. After 8-10 hours of virus treatment, the cells are replaced with normal culture medium.

8. The method according to claim 5, characterized in that, The DNA damaging agent is a combination of cisplatin and etoposide, with concentrations of 0.3-0.5 μM for cisplatin and 0.9-1.5 μM for etoposide, and the treatment time is 48 hours.

9. The method according to claim 1, characterized in that, In step 3, fluorescence detection is performed on days 3-7 after induction treatment. The fluorescence microscope is used to simultaneously capture images in the 488nm channel and bright field channel for 48 consecutive hours. The imaging environment is 37℃ and 5% CO2. The method also includes SA-β-gal staining of senescent cells to verify the senescence state, and the staining result is used as evidence for the fluorescent labeling detection result.

10. The application of the method as described in any one of claims 1-9 in cell aging-related research, anti-aging drug screening, or assessment of diagnosis and treatment of aging-related diseases.

Images