Kit for sensing detection of mastitis miRNA marker and sensing detection method

Abstract

The invention discloses a kit for sensing and detecting a miRNA (micro Ribonucleic Acid) marker for mastitis and a sensing and detecting method. The invention develops a two-pot isothermal miRNA sensing detection method based on RCA amplification and CRISPR / Cas12a, according to the method, isothermal linear amplification of target miRNA is realized by using a lock-type probe mediated RCA technology, HRP on MNP-ssDNA-HRP is released by combining trans-shear activity of CRISPR / Cas12a, and visual color development reading of the miRNA level is realized by using HRP to catalyze TMB / H2O2 color development.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a kit and method for sensing and detecting a miRNA biomarker for mastitis. Background Technology

[0002] Mastitis is a common and highly dangerous disease in dairy cows. It is caused by microbial infection or physical and chemical stimulation, which can reduce milk production and quality, threaten the health of dairy cows, and thus cause significant economic losses.

[0003] Currently, mastitis in dairy cows is mainly monitored by measuring somatic cell counts. However, this usually requires individual staining and counting of somatic cells, which requires expensive fluorescence reading equipment. It also has a lag in assessing the health of the cow itself, and the monitoring of subclinical mastitis is not accurate enough.

[0004] For example, the invention application with publication number CN117721170A discloses the formula, preparation method and usage method of a novel rapid diagnostic reagent for bovine mastitis. It improves the speed of diagnosing bovine mastitis by developing a diagnostic reagent for rapid detection of somatic cell count in milk. The formula of the diagnostic reagent includes sodium α-olefin sulfonate, water, pH adjuster and bromocresol purple.

[0005] For example, the invention application with publication number CN101059444A discloses a rapid diagnostic kit for double N-subclinical mastitis in dairy cows, the main components of which are silver nitrate and potassium chromate.

[0006] There are also methods that identify mastitis in dairy cows by collecting relevant images and analyzing them. For example, invention application CN114049293A discloses a device for identifying and classifying mastitis in dairy cows. However, this method requires the use of corresponding hardware and software, which is costly, and it also requires the collection of thermal infrared video of specific locations on the dairy cows, making it difficult to operate.

[0007] Molecular detection methods are significant for improving the accuracy and speed of detection, especially for early diagnosis, but currently there is a lack of suitable molecular markers for the diagnosis of mastitis in dairy cows. Summary of the Invention

[0008] To address the limitations of existing diagnostic methods for bovine mastitis, such as the lack of early diagnosis and high reliance on equipment, this study focuses on screening for specific molecular markers of mastitis and developing a cow mastitis monitoring platform that integrates triple miRNA signal amplification and CRISPR / Cas12a colorimetric detection to achieve rapid diagnosis of bovine mastitis.

[0009] This invention first provides a kit for sensing and detecting mastitis miRNA biomarkers, wherein the mastitis miRNA biomarkers are at least one of bta-miR-223, bta-miR-935, or bta-miR-2284w, with the following sequences: bta-miR-223: UGUCAGUUUGUCAAAUACCCCA; bta-miR-935: CCAGUUACCGCUUCCGCUACCGC; bta-miR-2284w: AAGAGUUUGUUCGGGUUUCUC; The sensing detection kit includes: an RCA reaction reagent for amplifying mastitis miRNA targets, including a padlock probe; a Cas12a RNP, including a complex formed by mixing and incubating Cas12a and crRNA; and an MNP-ssDNA-HRP, including magnetic beads and ssDNA and horseradish peroxidase coupled to the magnetic beads.

[0010] Preferably, the padlock probe corresponding to bta-miR-223 is ppb_miR-223: ACAAACTGACAAGATACCCTAACCATCGATCGTCGCCGTCCAGCTCGACCTGGGGTATTTG; the padlock probe corresponding to bta-miR-935 is ppb_miR-935: GCGGTAACTGGAGATACCCTAACCATCGATCGTCGCCGTCCAGCTCGACCGCGGTAGCGGAA; and the padlock probe corresponding to bta-miR-2284w is ppb_miR-2284w: ACAAACTCTTAGATACCCTAACCATCGATCGTCGCCGTCCAGCTCGACCGAGAAACCCGA.

[0011] Preferably, the RCA reaction reagents used to amplify mastitis miRNA targets also include SplintR buffer, Phi29 DNA polymerase, and SplintR ligase.

[0012] Preferred crRNA in Cas12a RNP: UAAUUUCUACUAAGUGUAGAUCGUCGCCGUCCAGCUCGACC.

[0013] Preferably, in the preparation of MNP-ssDNA-HRP, magnetic beads with carboxyl groups on their surface and ssDNA with an amino group at one end and biotin at the other end are first provided. The magnetic beads and ssDNA are connected by an amino-carboxyl reaction between the carboxyl and amino groups to obtain MNP-ssDNA-Biotin. Horseradish peroxidase conjugated with streptomycin was provided, and MNP-ssDNA-HRP was obtained by ligation via streptavidin reaction between biotin and streptomycin.

[0014] Preferably, the ssDNA is a poly-T chain, for example, 20 T strands. The ssDNA chain configuration is mainly to ensure sufficient space between HRP and the magnetic beads, facilitating Cas12a's access to and cleavage of HRP in the reaction system. Therefore, the specific sequence is not particularly important.

[0015] Preferably, the sensor detection kit for the mastitis miRNA biomarker further includes tetramethylbenzidine, a catalytic substrate of horseradish peroxidase.

[0016] This invention provides a sensing detection method for a miRNA biomarker for mastitis. The sensing detection method is for non-disease diagnosis purposes. The sensing detection kit is used, and the sensing detection method includes the following steps: (1) amplifying the miRNA to be tested by RCA reaction to obtain RCA product; (2) adding Cas12a RNP and MNP-ssDNA-HRP to the RCA product. After the reaction, magnetic separation is performed to precipitate the magnetic beads. The supernatant is then taken out and added to tetramethylbenzidine, the catalytic substrate of horseradish peroxidase, for colorimetric reaction and the colorimetric result is detected.

[0017] Preferably, the sample to be detected is milk. This invention develops a two-pot, isothermal miRNA sensing and detection method based on RCA amplification and CRISPR / Cas12a. This method utilizes lock-probe-mediated RCA technology to achieve isothermal linear amplification of target miRNAs. Combined with the trans-cleavage activity of CRISPR / Cas12a, HRP is released from MNP-ssDNA-HRP. HRP catalyzes TMB / H2O2 colorimetric development, enabling visual colorimetric readout of the miRNA level. By combining RCA amplification, CRISPR / Cas12a activation, and HRP-catalyzed TMB oxidation, a three-stage signal amplification of miRNA is achieved. RCA can amplify a single miRNA target to approximately 10-1. 3 ~10 5 A linear DNA copy is extracted; CRISPR / Cas12a trans-cleavage further amplifies the signal by thousands of times; HRP and TMB reactions (which constitute a signal amplification) significantly enhance colorimetric readout. Ultimately, the overall amplification of the entire system can reach 10^10. 9 ~10 12The triple signal amplification strategy achieves femtomolar detection limits and recoveries of 91%-104% in complex milk matrices, with a CV% <10% and high specificity for pooled detection. The CRISPR-MICRO portable detection platform, developed based on the RCA-CRISPR / Cas12a-TMB method, offers advantages such as triple enzyme signal amplification, two-pot reaction, and isothermal reaction. Attached Figure Description

[0018] Figure 1 Characterization and performance of miR-223 detection based on RCA-CRISPR / Cas12a. Figure 1 In the figure, A represents the miR-223 cyclization, RCA, and Cas12a RNP cleavage products detected by 1% agarose gel electrophoresis. Figure 1 In the figure, B represents the influence of key components on RCA products in agarose gel electrophoresis analysis. Figure 1 In the figure, C represents the change in particle size of the RCA product and the Cas12a RNP reaction product as detected by a nanoparticle size analyzer.

[0019] Figure 2 Characterization and performance of miR-223 detection based on RCA-CRISPR / Cas12a. Figure 2 A in the diagram illustrates how RCA amplifies the miR-223 signal and uses the trans-shearing activity of CRISPR / Cas12a for signal enhancement and output. Figure 2 B and C in the figure represent the changes in fluorescence signal generated by different concentrations of miR-223 as the reaction progresses, and the linear relationship between miR-223 and fluorescence signal at 40 min. Figure 2 In the figure, D represents the effect of different missing factors on the fluorescence signal.

[0020] Figure 3 Characterization and performance of miR-935 detection based on RCA-CRISPR / Cas12a. Figure 3 In the figure, A represents the influence of key components on RCA products in agarose gel electrophoresis analysis. Figure 3 In the figure, B represents the change in particle size of the RCA product and the Cas12a RNP reaction product as detected by a nanoparticle size analyzer. Figure 3 In the figure, C represents the effect of different missing factors on the fluorescence signal; Figure 3 D and E in the figure represent the changes in fluorescence signal generated by different concentrations of miR-935 as the reaction progresses, and the linear relationship between miR-935 and fluorescence signal at 40 min.

[0021] Figure 4 Characterization and performance of miR-2284w based on RCA-CRISPR / Cas12a. Figure 4In the figure, A represents the influence of key components on RCA products in agarose gel electrophoresis analysis. Figure 4 In the figure, B represents the change in particle size of the RCA product and the Cas12a RNP reaction product as detected by a nanoparticle size analyzer. Figure 4 In the figure, C represents the effect of different missing factors on the fluorescence signal; Figure 4 D and E in the figure represent the changes in fluorescence signal generated by different concentrations of miR-2284w as the reaction progresses, and the linear relationship between miR-2284w and fluorescence signal at 40 min.

[0022] Figure 5 Optimization of single-factor experiments and key experimental factors for CRISPR-MICRO sensors. Among them, Figure 5 In this context, A represents a single-factor influence experiment. Figure 5 In this context, B represents the optimized dosage of SplintR ligase. Figure 5 C in the figure represents the optimized dosage of Phi29 polymerase; Figure 5 In this context, D represents the ppb concentration optimization. Figure 5 E in the figure represents the Cas12a RNP shearing time optimization; Figure 5 F in the figure represents the optimized final colorimetric reaction time.

[0023] Figure 6 Linear analysis and sample recovery experiments were conducted to detect miRNAs in different matrices using the CRISPR-MICRO platform. Specifically, different concentrations of miR-223 were added to DEPC water and milk matrices. Figure 6 (A) miR-935 Figure 6 (B in) and miR-2284w ( Figure 6 After C), the linear relationship between the ΔGray value and miRNA concentration was detected using a CRISPR-MICRO sensor.

[0024] Figure 7 Evaluation of pooled detection specificity for CRISPR-MICRO sensors. Figure 7 In Figure A, rows 1 to 3 show the colorimetric results of miR-223, miR-935, and miR-2284w, respectively, while the vertical axis shows the presence or absence of the target and the release of other miRNAs. Figure 7 B in the figure represents the statistical analysis of the colorimetric results.

[0025] Figure 8 This study compares the detection of miRNA levels using a CRISPR-MICRO sensor and qPCR. Figure 8 In this context, A represents the correlation analysis between miR-223 expression level and somatic cell number. Figure 8B in the figure represents a comparison of the linear relationship between the CRISPR-MICRO sensor and the qRT-PCR method in the detection of miR-223; Figure 8 In this context, C represents the coefficient of variation (CV) of the detection results from CRISPR-MICRO and qRT-PCR methods.

[0026] Figure 9 This study compares the detection of miRNA levels using a CRISPR-MICRO sensor and qPCR. Figure 9 In this context, A represents the correlation analysis between miR-935 expression levels and somatic cell count; Figure 9 B in the figure represents a comparison of the linear relationship between the CRISPR-MICRO sensor and the qRT-PCR method in the detection of miR-935; Figure 9 In this context, C represents the coefficient of variation (CV) of the detection results from CRISPR-MICRO and qRT-PCR methods.

[0027] Figure 10 This study compares the detection of miRNA levels using a CRISPR-MICRO sensor and qPCR. Figure 10 In this context, A represents the correlation analysis between miR-2284w expression level and somatic cell number. Figure 10 In the figure, B represents a comparison of the linear relationship between the CRISPR-MICRO sensor and the qRT-PCR method in the detection of miR-2284w. Figure 10 In this context, C represents the coefficient of variation (CV) of the detection results from CRISPR-MICRO and qRT-PCR methods. Detailed Implementation

[0028] We first used high-throughput sequencing and bioinformatics analysis to screen for three miRNA biomarkers associated with bovine mastitis. These biomarkers showed significantly upregulated expression levels in the milk of mastitis-affected cows, exhibiting high fold-up expression and low coefficient of variation, making them key molecular markers for diagnosing bovine mastitis. These biomarkers include bta-miR-223, bta-miR-935, and bta-miR-2284w; the sequences of the three miRNAs are shown in Table 1.

[0029] High-throughput sequencing technology was used to analyze miRNAs in bovine milk somatic cells and exosomes to screen for miRNA biomarkers that showed significant differences between the mastitis group and the healthy control group. The sequencing analysis was commissioned to Shanghai Meiji Bio-Sequencing Co., Ltd.

[0030] (1) RNA extraction: Take an appropriate amount of exosomes or somatic cell solution, centrifuge at 13000×g for 5 minutes at 4℃, transfer the supernatant to another centrifuge tube, add pre-chilled chloroform at a ratio of 0.2 mL chloroform / 1 mL Trizol, vortex to mix, and let stand at room temperature for 5 minutes. Centrifuge at 13000×g for 15 minutes at 4℃, transfer the supernatant to another centrifuge tube, add an equal volume of pre-chilled isopropanol, and let stand at room temperature for 10 minutes. Centrifuge at 13000×g for 10 minutes at 4℃, discard the supernatant, add 1 mL of pre-chilled 75% ethanol to suspend the precipitate. Centrifuge at 12000×g for 5 minutes at 4℃, discard the supernatant, air dry at room temperature for 3-5 minutes, and finally add 20-50 μL of sterile 0.1% DEPC water to dissolve the RNA.

[0031] (2) Library construction and sequencing: Libraries were constructed using the QIAseq miRNA Library Kit. Total RNA was extracted from tissue samples. RNA concentration and purity were detected using Nanodrop 2000, RNA integrity was detected by agarose gel electrophoresis, and RIN values ​​were determined using an Agilent 5300. A single library construction required a total RNA volume of 1 μg, a concentration ≥50 ng / μL, RQN>6.5, and OD260 / 280 between 1.8 and 2.2. Adapter sequences were ligated at the 3' and 5' ends, cDNA was synthesized using reverse transcriptase and random primers, and PCR amplification was performed (11-12 cycles). The target fragment was recovered by gel excision, and finally sequenced on the Illumina NovaSeqXplus platform.

[0032] (3) Bioinformatics Analysis: Statistical analysis and quality assessment were performed on the raw sequencing data, including statistical analysis of base content distribution, base quality distribution, and base error rate distribution. Quality control steps included removing 3' adapter sequences, cleaving low-quality bases, removing reads containing unknown base N, and reads that did not meet length requirements, to obtain high-quality clean data. The clean reads were aligned with the reference genome to obtain mapped reads, which were used for the identification of known miRNAs and the prediction of new miRNAs. The identification of known miRNAs was performed by alignment with the miRBase 22.0 database, and the prediction of new miRNAs was based on the hairpin structure characteristics of miRNA precursors. The expression levels of miRNAs were quantitatively analyzed, and expression levels were normalized using TPM. Differential expression analysis was performed to screen out significantly differentially expressed miRNAs (FDR < 0.05 & |log2FC| ≥ 1). GO and KEGG annotation analyses were performed on differentially expressed miRNA target genes. GO enrichment analysis was conducted using Goatools, and p-values ​​were corrected using the Bonferroni, Holm, Sidak, and false discovery rate methods. GO functional enrichment was considered significant when p_fdr ≤ 0.05. KEGG pathway enrichment analysis used Fisher's exact test with KOBAS software, and p-values ​​were corrected using the BH (FDR) method. KEGG pathway enrichment was considered significant when the corrected p-value ≤ 0.05.

[0033] After sequencing miRNAs in bovine milk somatic cells and exosomes using the above method, further analysis yielded the following results: fold changes were detected in bovine milk somatic cells (mastitis group vs. normal group). The top three fold changes were bta-miR-223, bta-miR-935, and bta-miR-2284w.

[0034] The primer sequences used in qPCR detection in this application are shown in Table 2. The RNA or DNA sequences involved in the examples are shown in Table 3.

[0035] Table 1. miRNA sequences in high-throughput sequencing analysis Table 2. Primer sequences of the three miRNAs Table 3. RNA or DNA sequences involved in the examples PM3-020 magnetic beads: PM3-020 superparamagnetic polymer nanospheres from AIIMag.

[0036] SplintR buffer, SplintR ligase (25 U / μL), Cas12a (1 μM), and NEB 2.1 Buffer were all purchased from New England NEB Biolabs. Phi29 polymerase (10 U / μL) and dNTPs (10 mM) were purchased from ThermoFisher Scientific. BSA powder was purchased from Maclean's Reagents.

[0037] SYBR Gold (10000x) nucleic acid gel staining reagent was purchased from Thermo Fisher Scientific. Agarose and TAE buffer powder were purchased from Maclean's Reagent Company, and DNA marker was purchased from Shanghai Sangon Biotech Co., Ltd.

[0038] Example 1: Preparation of Cas12a RNP and MNP-ssDNA-HRP This embodiment relates to an experimental method for pre-preparing Cas12a RNP and MNP-ssDNA-HRP required for the experiment.

[0039] Preparation of Cas12a-crRNA ribonucleoprotein (Cas12a RNP): Mix 2 µL water, 0.5 µL NEB 2.1 Buffer, 1 µL Cas12a (1 µM) and 1.5 µL crRNA (1 µM), and incubate at 37 °C for 30 min to obtain the Cas12a RNP complex.

[0040] Preparation of Fe3O4 magnetic nanoparticles-horseradish peroxidase (MNP-ssDNA-HRP): 200 µL of PM3-020 magnetic beads (10 mg / mL) were transferred to a 1.5 mL centrifuge tube. The beads were washed three times with MEST buffer (10 mM, 0.05% (v / v) Tween 20), followed by two washes with MES buffer (0.1 M, pH 6.0). After magnetic separation, the supernatant was removed. 1 mL of NHS / EDC mixture (1:1, 20 mg / mL) prepared with MES buffer was added. The mixture was inverted and mixed for 30 min to activate the carboxyl groups on the surface of the magnetic beads. The sample was washed twice with MES and PBS buffer (pH 7.4), and after magnetic separation, 50 µL of NH2-ssDNA-Biotin (100 µM) and 450 µL of PBS were added. The mixture was inverted and stirred for 2 hours on a rotary mixer. The -COOH groups on the MNPs (magnetic nanoparticles, i.e., magnetic beads) were linked to the -NH2 groups on the NH2-ssDNA-Biotin through an aminocarboxylation reaction, yielding MNP-ssDNA-Biotin. After washing three times with PBS and magnetic separation, 50 μL of HRP-Streptavidin (horseradish peroxidase-streptavidin, 1 mg / mL) and 450 µL of PBS were added to the MNP-ssDNA-Biotin. The mixture was inverted and stirred for 30 min on a rotary mixer. The Biotin on the MNP-ssDNA-Biotin was linked to the Streptavidin on the HRP-streptavidin through a streptavidin reaction, yielding MNP-ssDNA-HRP. Wash with PBS four times. Finally, add 500 µL of 1% (w / v, 1 g BSA powder dissolved in 100 mL of water) BSA to MNP-ssDNA-HRP (to block non-specific adsorption on the surface of the magnetic nanobeads and stabilize HRP enzyme activity to reduce background signal). Shake well at room temperature for 30 min, then wash with PBS three times. Add 500 μL of PBS to prepare 2 mg / mL MNP-ssDNA-HRP.

[0041] Example 2: RCA amplification of miRNA target experiment This embodiment relates to an experimental method for amplifying the target miRNA using rolling circle amplification (RCA) technology.

[0042] miR-223, miR-935, and miR-2284w, synthesized by Shanghai Sangon Biotech, were prepared into 100 μM stock solutions using DEPC-H2O and stored at -20℃. They were diluted to the required working concentration immediately before use. RCA amplification of the miRNA target: 2 µL of padlock probe (ppb, referring to ppb-223, ppd-935, or ppb-2284w), 2 µL of miRNA (the detection target), and 0.4 µL of SplintR buffer were mixed, denatured at 95℃ for 5 min, and then slowly cooled to room temperature for annealing. The annealed product was transferred to a 20 µL reaction mixture (containing 1.6 µL SplintR buffer, 0.8 µL dNTP, 0.2 µL BSA, 0.2 µL Phi29 DNA polymerase, 0.5 µL SplintR ligase, and 12.3 µL water), and reacted at 37 °C for 2 h. The reaction was then terminated at 65 °C for 10 min to obtain the RCA product.

[0043] Example 3: Agarose gel electrophoresis This embodiment relates to an experimental method for detecting reaction products by agarose gel electrophoresis.

[0044] When detecting RCA and the reaction products of RCA and Cas12a RNP using 1% agarose gel electrophoresis, firstly, 1.5 g of agarose was heated and fully dissolved in 150 mL of 1×TAE buffer. After cooling to approximately 60°C, 15 μL of SYBR Gold (10000×) dye was added and mixed thoroughly. The mixture was then poured into a gel mold and allowed to cool and solidify. Next, the reaction products of RCA and Cas12a RNP were mixed with 6× loading buffer at a volume ratio of 1:6 and loaded into the gel wells. Electrophoresis was then performed in 1×TAE buffer at a constant voltage of 100 V for approximately 1 hour. Finally, the fluorescence signal was observed and captured under UV light using a gel imaging system (Shenhua Technology Co., Ltd.).

[0045] The results are as follows Figure 1 In the A and B sections, RCA technology can efficiently amplify target miRNAs. Under isothermal conditions, miRNAs can achieve exponential amplification, significantly amplifying trace amounts of miRNA signals. Figure 1 As shown in A, the DNA marker serves as a reference (lane 1), while the high molecular weight RCA product remains in the well (lane 4). Short fragments are generated after Cas12a RNP cleavage (lane 5), indicating that its trans-cleavage activity is activated. Figure 1In lane B, lane 5, containing all components (miR-223, ppb-223, SplintR ligase, Phi29 polymerase, and RNP), showed RCA products. The absence of any component (e.g., the absence of SplintR in lane 2 or Phi29 in lane 3) resulted in no product. This indicates that ppb-223 and miR-223 can be successfully ligated to produce RCA products. The results are as follows... Figure 1 The C in the dynamic light scattering results showed that after adding Cas12a RNP to the RCA product and reacting at 37℃, the particle size of the RCA product decreased from 289.9 nm to 116.4 nm after cleavage, confirming that Cas12a RNP can target and cleave the RCA product.

[0046] Example 4: Traditional CRISPR / Cas12a method for detecting miRNA This embodiment relates to an experimental method for achieving miRNA signal output using CRISPR / Cas12a.

[0047] CRISPR / Cas12a cleavage of fluorescent reporter molecules miRNA detection system: 5 µL of Cas12a RNP and 0.2 µL of fluorescent reporter probe (100 µM, Reporter, 5'-6-FAM-TTATT-3'-BHQ1) were added to 20 µL of RCA product and incubated at 37℃ for 1 h using a qPCR instrument. The fluorescence signal was monitored in real time to determine the initial miRNA concentration.

[0048] To further verify the functionality of the RCA-CRISPR / Cas12a system, the signal transduction module employed a conventional fluorescent reporter probe (5'-6-FAM-TTATT-3'-BHQ1), the reaction principle of which is as follows: Figure 2 A in the fluorescence experiment shows that ( Figure 2 (D and E in), after Cas12a RNP activation, it can cleave ssDNA to release fluorescent groups, and the fluorescence intensity increases in a concentration-dependent manner (miR-223). Figure 2 In the B group, the intensity was linearly correlated with the concentration at 40 min, with a LOD of 71.75 fM. Figure 2 (C in the text). Furthermore, a strong fluorescence signal is generated in the complete system containing miR-223 / ppb-223, RCA reagent, Cas12a RNP, and reporter probe, while the signal disappears when any component is missing. Figure 2 (D in the text). Similarly, based on the specificity of ppb-935 and ppb-2284w, this method is also applicable to miR-935 ( Figure 3 ) and miR-2284w detection ( Figure 4 This demonstrates that the platform possesses highly specific and sensitive miRNA detection capabilities.

[0049] Example 5: A newly constructed CRISPR / Cas12a method for detecting miRNA This embodiment involves a lack-factor experiment to determine the detection feasibility of the constructed sensing detection system. The newly constructed CRISPR / Cas12a method for detecting miRNA in this application is named the CRISPR-MICRO method.

[0050] The CRISPR / Cas12a cleavage of MNP-ssDNA-HRP to catalyze TMB (tetramethylbenzidine) color development miRNA detection system: Add 5 µL of Cas12a RNP (prepared Cas12a and crRNA complex) and 5 µL of MNP-ssDNA-HRP (2 mg / mL) to 20 µL of RCA product, and incubate in a metal bath at 37°C for 30 min. After magnetic separation and precipitation of the magnetic nanoparticles, add 25 µL of the supernatant to a 96-well plate containing 50 µL of TMB and 2.5 µL of H2O2 (hydrogen peroxide). After reacting for approximately 15 min, the colorimetric results are obtained.

[0051] The results are as follows Figure 5 In the A section, the sensor can detect the levels of miR-223, miR-935, and miR-2284w, exhibiting component-dependent specific signals, and only the full component reaction can produce a detectable colorimetric signal.

[0052] Example 6: Single-factor optimization experiment This embodiment involves single-factor optimization to improve the sensitivity of the constructed sensing and detection system.

[0053] To improve the sensitivity of the detection system, the reaction concentration and time conditions of key experimental factors were optimized, specifically including SplintR ligase concentration (0, 0.1, 0.2, 0.5, 1, 2 μL), Phi29 polymerase (0.01, 0.02, 0.05, 0.1, 0.2 U / μL), padlock probe concentration (ppb, 0, 10, 50, 100, 250, 500 nM), Cas12a RNP cleavage reaction time (5, 15, 30, 45, 60, 90, 120 min), and final colorimetric reaction time (1, 5, 10, 15, 20, 25, 30 min).

[0054] The results are as follows Figure 5 There was no significant difference in the amount of BF and SplintR used, ≥0.2 µL, with 0.2 µL being preferred. Figure 5 Of the B-type, Phi29 offers the best price-performance ratio at 0.02 U / µL. Figure 5 The C in the formula (ppb 100 nM) can balance capture efficiency and specificity. Figure 5 The enzyme activity reached its peak after Cas12a RNP cleavage for 45 min (D in the D); Figure 5 E in the colorimetric reaction); signal saturation occurs after 15 min of colorimetric reaction ( Figure 5 (F in the text).

[0055] Example 7: Sample Spiking Recovery Experiment This embodiment relates to evaluating the detection performance of the CRISPR-MICRO method of the present invention in complex matrices through a sample recovery experiment.

[0056] miRNAs of various concentrations were added to milk and extracted using the UE miRNA miniaturization kit (U-Landi). The concentration signal was detected using the RCA-CRISPR / Cas12a cleavage MNP-ssDNA-HRP catalytic TMB colorimetric system. A standard curve for sample addition and recovery was established. MiRNAs of 80, 800, and 8000 fM were randomly selected for sample addition and detection. The detection results were substituted back into the standard curve to calculate the sample addition recovery rate, and the CV value was calculated to evaluate the stability of the detection system.

[0057] Three miRNAs were detected in DEPC water and fresh milk, and the results are as follows: Figure 6 In the study, the AC and Δ gray values ​​were linearly correlated with miRNA concentration, with LOD as low as 1.19-4.16 fM. The signal in milk was slightly lower, attributed to matrix non-specific interference. The results of spiked recovery experiments (80, 800, 8000 fM) are shown in Table 4, with recoveries ranging from 91.99% to 104.23%, CV < 10%, indicating high accuracy and good reproducibility.

[0058] Table 4. Results of miRNA recovery detection in milk matrix Example 8: Pooled Specificity Test This embodiment relates to evaluating the miRNA detection specificity of a sensor through a sample recovery experiment.

[0059] The experiment included three miRNAs to be tested: miR-223, miR-935, and miR-2284w. The experiment was designed with four groups: (1) containing none of the three target miRNAs (No target); (2) containing only one target miRNA (Target); (3) containing non-target miRNAs but no target miRNA (Mixed-no target); and (4) containing all three target miRNAs (Mixed-with target). The detection specificity of the method was verified through the experiment.

[0060] The results are as follows Figure 7In the A and B groups, no colorimetric reaction was observed in the No target group, indicating that no signal was generated when the target miRNA was absent. The Target group consistently produced a clear colorimetric signal. In the Mixed-no target group, the colorimetric signal was weak due to the absence of the target miRNA, and can be considered as background noise from the mixed detection. In the Mixed-with target group, despite interference from other miRNAs, the colorimetric signal was significant and slightly stronger than that of the Target group, indicating good detection specificity of this method.

[0061] Example 9: Extraction of miRNA from real milk samples and detection of its level by qRT-PCR This embodiment relates to comparing the detection and discrimination accuracy of a newly developed sensing detection method with that of the traditional qRT-PCR method.

[0062] A total of 96 milk samples were collected from Jinhua Xiayang Livestock Company, including healthy samples, samples with latent mastitis, and samples with clinical mastitis. The criteria for different degrees of mastitis were: somatic cell count <200,000 / mL for healthy samples, 200,000-400,000 / mL for latent mastitis, and >400,000 / mL for mastitis. During milk sample collection, Trizol reagent (to prevent RNA degradation) was added at a 1:1 ratio and the samples were immediately frozen on dry ice. The samples were quickly sent to the laboratory, where miRNA was extracted from the milk samples using the UE miRNA miniaturization kit (Youyilandi). The purity and concentration of the extracted miRNA were determined using an ultra-micro spectrophotometer, followed by PCR using a TaKaRa kit. Then, following the method described in Example 5, the miRNA in each actual sample was detected and analyzed using sensors.

[0063] The results are as follows Figure 8 , Figure 9 , Figure 10 The levels of the three biomarkers (miR-223, miR-935, and miR-2284w) increased with increasing somatic cell count (SCC), and the concentration ranges clearly corresponded to the three stages of mastitis. Figure 8 A in Figure 9 A in Figure 10 A in the chart: green (healthy), light blue (suspected subclinical mastitis), and red (subclinical mastitis). Figure 8 B in Figure 9 B in Figure 10 B further indicates that the results obtained by both CRISPR-MICRO and qRT-PCR methods for detecting the three miRNAs showed good linearity. Figure 8 C in Figure 9 C in Figure 10The value of C indicates that the CV of both methods is <10%, demonstrating high accuracy. This confirms the accuracy and reliability of the sensor of this invention in quantifying miRNAs in complex milk samples.

Claims

1. A kit for the detection of mastitis miRNA markers, characterized by, The miRNA markers for mastitis are at least one of bta-miR-223, bta-miR-935, or bta-miR-2284w, with the following sequences: bta-miR-223:UGUCAGUUUGUCAAAUACCCCA; bta-miR-935: CCAGUUACCGCUUCCGCUACCGC; bta-miR-2284w:AAGAGUUUGUUCGGGUUUCUC; The sensing detection kit includes: RCA reaction reagents for amplifying mastitis miRNA targets, including padlock probes; Cas12a RNP, including the complex formed by the mixed incubation of Cas12a and crRNA; MNP-ssDNA-HRP consists of magnetic beads and ssDNA and horseradish peroxidase coupled to the magnetic beads.

2. The kit for the detection of the mastitis miRNA marker according to claim 1, wherein The padlock probe corresponding to bta-miR-223 is ppb_miR-223: ACAAACTGACAAGATACCCTAACCATCGATCGTCGCCGTCCAGCTCGACCTGGGGTATTTG; The padlock probe corresponding to bta-miR-935 is ppb_miR-935: GCGGTAACTGGAGATACCCTAACCATCGATCGTCGCCGTCCAGCTCGACCGCGGTAGCGGAA; The padlock probe corresponding to bta-miR-2284w is ppb_miR-2284w: ACAAACTCTTAGATACCCTAACCATCGATCGTCGCCGTCCAGCTCGACCGAGAAACCCGA.

3. The kit for the detection of the mastitis miRNA marker according to claim 1, wherein The RCA reaction reagents used to amplify mastitis miRNA targets also include SplintR buffer, Phi29 DNA polymerase, and SplintR ligase.

4. The kit for the detection of the mastitis miRNA marker according to claim 1, wherein crRNA in Cas12aRNP: UAAUUUCUACUAAGUGUAGAUCGUCGCCGUCCAGCUCGACC.

5. The kit for the detection of the mastitis miRNA marker according to claim 1, wherein In the preparation of MNP-ssDNA-HRP, magnetic beads with carboxyl groups on their surface and ssDNA with an amino group at one end and biotin at the other end are first provided. The magnetic beads and ssDNA are connected by an amino-carboxyl reaction between the carboxyl and amino groups to obtain MNP-ssDNA-Biotin. Horseradish peroxidase conjugated with streptomycin was provided, and MNP-ssDNA-HRP was obtained by ligation via streptavidin reaction between biotin and streptomycin.

6. The kit for the detection of the mastitis miRNA marker according to claim 1, wherein ssDNA is a poly-T chain.

7. The sensor detection kit for mastitis miRNA biomarkers according to claim 1, characterized in that, It also includes tetramethylbenzidine, a catalytic substrate of horseradish peroxidase.

8. A sensing detection method for a mastitis miRNA marker, wherein the sensing detection method is not for disease diagnosis, characterized in that, Using the sensor detection kit according to any one of claims 1 to 7, the sensor detection method includes the following steps: (1) The target miRNA was amplified by the RCA reaction to obtain the RCA product; (2) Add Cas12a RNP and MNP-ssDNA-HRP to the RCA product. After the reaction, magnetically separate and precipitate the magnetic beads. Then, take the supernatant and add tetramethylbenzidine, the catalytic substrate of horseradish peroxidase, to carry out the color reaction and detect the color result.

9. The sensing detection method for the mastitis miRNA biomarker according to claim 8, characterized in that, The sample tested was milk.

Images