Primer probe combination for detecting African swine fever virus, PCR (Polymerase Chain Reaction) detection product and detection method of African swine fever virus

By designing a multi-target detection method for the African swine fever virus MGF505 gene, using repetitive sequences as specific probes and combining five primers for high-sensitivity detection, the problem of insufficient detection sensitivity in existing technologies is solved, achieving efficient and low-cost detection results.

CN121874404AActive Publication Date: 2026-04-17TAIZHOU LEILING BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TAIZHOU LEILING BIOTECH CO LTD
Filing Date
2026-03-23
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

In existing technologies, the sensitivity of African swine fever virus detection methods is insufficient, and the multiple probe strategy leads to primer dimer formation, which affects detection efficiency and cost, and cannot meet the requirements for high sensitivity.

Method used

A primer-probe combination was designed for multi-target detection of the African swine fever virus MGF505 gene. The repetitive sequence 'CAATGAAGTAGTAAAGCTCTTGTTAC' was used as a specific probe, and five primers were combined for high-sensitivity detection, reducing the probability of primer dimer formation and improving detection efficiency.

Benefits of technology

It achieves highly sensitive detection of African swine fever virus, improves the detection rate of weak positive samples, reduces detection costs, and enhances the specificity and repeatability of the test.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121874404A_ABST
    Figure CN121874404A_ABST
Patent Text Reader

Abstract

The invention discloses a primer probe combination for detecting an African swine fever virus, a PCR (Polymerase Chain Reaction) detection product and a detection method of the African swine fever virus, and relates to the technical field of animal epidemic disease prevention and control. Comprising a first primer probe set, a second primer probe set and a third primer probe set aiming at the MGF505 gene, a probe is shown as SEQ ID NO: 1, and the first primer probe set comprises an upstream primer and a downstream primer which are sequentially shown as SEQ ID NO: 2-3; the second primer probe group comprises an upstream primer and a downstream primer which are sequentially shown as SEQ ID NO: 4-5; the third primer probe group comprises an upstream primer as shown in SEQ ID NO: 2 and a downstream primer as shown in SEQ ID NO: 6. The primer probe combination provided by the invention can be used for carrying out high-sensitivity and high-specificity detection on multiple target points of the African swine fever virus MGF505 gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of animal disease prevention and control technology, and more specifically, to a primer-probe combination for detecting African swine fever virus, a PCR detection product, and a method for detecting African swine fever virus. Background Technology

[0002] African swine fever (ASF) was first reported in Kenya in 1921 and first discovered in Northeast my country in 2018. It is a highly contagious and hemorrhagic disease caused by the African swine fever virus (ASFV) infecting domestic or wild pigs. Due to its severity, the World Organisation for Animal Health (OIE) lists it as a notifiable animal disease, and my country also classifies it as a Class A animal disease requiring special attention.

[0003] The B646L gene is one of the key marker genes of ASFV. Its high sequence conservation and detection specificity make it an ideal target for ASFV nucleic acid detection. However, detection methods that rely solely on a single gene and a single target cannot meet the market's demand for high sensitivity in African swine fever virus detection reagents. Developing highly sensitive detection methods has always been a research focus, especially for viruses like African swine fever virus, which have no effective drugs or vaccines and have a high mortality rate.

[0004] Researchers have established a Taqman real-time PCR detection method for African swine fever virus using a multiplex probe strategy. This method designs four sets of primers and probes targeting the B646L gene, with a detection limit of 0.5-5 copies / μL [1]. However, this method is quite difficult to design when combining primers and probes, as it requires the design of four different sets of probes. As the number of primers and probes increases, the probability of primer dimers forming between primers increases. The formation of primer dimers reduces the concentration of free effective primers, causing reaction resources to be used to amplify useless dimers. In addition, the formation of dimers affects the amplification efficiency of the target product, reduces detection sensitivity, and also interferes with the detection signal, affecting quantitative accuracy.

[0005] The increase in the number of probes in existing technologies also leads to an increase in the cost of the detection system.

[0006] In view of this, the present invention is proposed.

[0007] References: [1] Ding S, Shen T, Feng Z, Diao S, Yan Y, Du Z, Jin Y, Gu J, Zhou J, Liao M, Dong W. Development of a highly sensitive TaqMan method based on multi-probe strategy: its application in ASFV deteCtion. Biol MethodsProtoc. 2024;9. Summary of the Invention

[0008] The purpose of this invention is to provide a primer-probe combination for detecting African swine fever virus, a PCR detection product, and a method for detecting African swine fever virus to solve the above-mentioned technical problems.

[0009] This invention is implemented as follows: In a first aspect, the present invention provides a primer-probe combination for detecting African swine fever virus, comprising: a first primer-probe set, a second primer-probe set, and a third primer-probe set targeting the MGF505 gene; the first primer-probe set comprising the probe shown in SEQ ID NO: 1 and upstream and downstream primers shown in SEQ ID NO: 2-3 in sequence; the second primer-probe set comprising the probe shown in SEQ ID NO: 1 and upstream and downstream primers shown in SEQ ID NO: 4-5 in sequence; and the third primer-probe set comprising the probe shown in SEQ ID NO: 1, the upstream primer shown in SEQ ID NO: 2, and the downstream primer shown in SEQ ID NO: 6.

[0010] Secondly, the present invention also provides the application of primer-probe combination in the preparation of PCR detection products for African swine fever virus, wherein the PCR detection products are reagents, kits, chips or detectors.

[0011] Thirdly, the present invention also provides a PCR detection product for African swine fever virus, which includes the above-mentioned primer and probe combination, and the PCR detection product is a reagent, kit, chip or detector.

[0012] In a preferred embodiment of the present invention, the PCR detection product for African swine fever virus further includes: qPCRMix, a positive control, and a negative control.

[0013] Fourthly, the present invention also provides a method for detecting African swine fever virus, which is not intended for the diagnosis of the disease, and includes the following steps: mixing the nucleic acid sample to be tested with the above-mentioned primer and probe combination in a PCR system, performing PCR amplification, and detecting the fluorescence signal of the amplification product.

[0014] The present invention has the following beneficial effects: By sequencing the genome of the African swine fever virus (ASFV) MGF505 gene, this invention discovered a repetitive sequence (or shared sequence) "CAATGAAGTAGTAAAGCTCTTGTTAC" in the genes encoding the ASFV MGF505-2R, MGF505-7R, and MGF505-10R proteins. Using this sequence as a specific probe sequence and designing corresponding detection primer sequences, this invention enables highly sensitive and specific detection of multiple targets within the ASFV MGF505 gene, and the detection method provided by this invention exhibits excellent reproducibility. The detection primer-probe combination provided by this invention requires only one probe and five primers to achieve detection of three targets, reducing the probability of primer dimer formation when multiple probes and primers are combined, thus lowering the cost of the detection system. Compared with single-target quantitative fluorescence detection methods, under the same amplification conditions, the copy number of viral amplification products in positive samples can be increased by 2-3 times, which helps to improve the detection rate of weakly positive samples.

[0015] The present invention provides technical support for the detection of African swine fever virus and the prevention and control of African swine fever. Attached Figure Description

[0016] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 This diagram shows the probe binding sites at the MGF505-2R, MGF505-7R, and MGF505-10R genes. Figure 2 The figure shows the validation results of TaqMan real-time PCR detection methods for ASFV MGF505 with single, dual, and triple targets. Figure 3 Figure 1. Experimental results of reaction procedure optimization for the TaqMan real-time PCR detection method for ASF MGF505 multi-target; Figure 4Figure 1 shows the results of sensitivity analysis of the TaqMan real-time PCR detection method for ASFV MGF505 multi-target detection. Figure 5 Standard curve for TaqMan real-time PCR detection of ASFV MGF505 multi-target site; Figure 6 The figure shows the specificity analysis results of the TaqMan real-time PCR detection method for ASF MGF505 multi-target. Figure 7 The figure shows the repeatability results of the TaqMan real-time PCR detection method for ASF MGF505 multi-target sites. Detailed Implementation

[0018] Reference will now be made to detailed embodiments of the present invention, one or more of which are described below. Each example is provided for explanation and not for limitation of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the invention without departing from its scope or spirit. For example, features described or illustrated as part of one embodiment may be used in another embodiment to produce further embodiments.

[0019] Unless otherwise specified, the practice of this invention will employ conventional techniques of cell biology, molecular biology (including recombinant technologies), microbiology, biochemistry, and immunology, which are within the capabilities of those skilled in the art. This technique is well explained in the literature, such as *Molecular Cloning: A Laboratory Manual*, 2nd edition (Sambrook et al., 1989); *Oligonucleotide Synthesis* (edited by M.J. Gait, 1984); *Animal Cell Culture* (edited by R.R. Freshney, 1987); *Methods in Enzymology* (Academic Press, Inc.); *Handbook of Experimental Immunology* (edited by D.M. Weir and C.C. Blackwell); *Gene Transfer Vectors for Mammalian Cells* (edited by J.M. Miller and M.P. Calos, 1987); *Current Protocols in Molecular Biology* (edited by F.M. Mausubel et al., 1987); and *PCR: The Polymerase Chain Reaction*. The references cited in the references are: "Reaction" (Mullis et al., ed., 1994); and "Current Protocols in Immunology" (JEColigan et al., ed., 1991), each of which is explicitly incorporated herein by reference.

[0020] Repetitive sequences are DNA sequences that occur repeatedly in the genome and play an important role in viral infection and mutation. Studies have shown that repetitive sequences are widely distributed in the African swine fever virus (ASFV) genome and may promote homologous recombination; some repetitive sequences have been found to play important roles in the ASFV infection process in host cells; and multigene family (MGF) genes located in the variable regions on the left and right sides of the ASFV genome show particularly high diversity. The MGF505 gene is present in all virulence isolates and is involved not only in immune evasion but also in interfering with the innate immune response.

[0021] MGF505-7R protein is a type I transmembrane structural protein of ASFV, encoded by the E183L (GI:1885932156) gene. It plays a crucial role in viral replication, participating in viral adhesion and invasion of cells, inducing host cell apoptosis, and acting as a key component in viral mutation and early infection. MGF505-7R protein can form disulfide bonds, creating an envelope precursor during ASFV transfection of cells. This precursor targets the endoplasmic reticulum membrane for protein expression, damaging cells. Furthermore, MGF505-7R protein acts as an effective inhibitor of innate immunity, helping the virus evade the immune system.

[0022] MGF505-2R protein is an effective inhibitor of innate immunity, which can help viruses evade the immune system.

[0023] In a first aspect, the present invention provides a primer-probe combination for detecting African swine fever virus, comprising: a first primer-probe set, a second primer-probe set, and a third primer-probe set targeting the MGF505 gene; the first primer-probe set comprising the probe shown in SEQ ID NO: 1 and upstream and downstream primers shown in SEQ ID NO: 2-3 in sequence; the second primer-probe set comprising the probe shown in SEQ ID NO: 1 and upstream and downstream primers shown in SEQ ID NO: 4-5 in sequence; and the third primer-probe set comprising the probe shown in SEQ ID NO: 1, the upstream primer shown in SEQ ID NO: 2, and the downstream primer shown in SEQ ID NO: 6.

[0024] By sequencing the genome of the African swine fever virus (ASFV) MGF505 gene, this invention discovered a repetitive sequence (or shared sequence) "CAATGAAGTAGTAAAGCTCTTGTTAC" in the genes encoding the ASFV MGF505-2R, MGF505-7R, and MGF505-10R proteins. Using this repetitive sequence as a specific probe sequence and designing corresponding detection primer sequences, this invention enables highly sensitive and specific detection of multiple targets within the ASFV MGF505 gene, and the detection method provided by this invention exhibits excellent reproducibility. The detection primer-probe combination provided by this invention requires only one probe; designing five primers is sufficient to achieve high specificity and sensitivity detection of three targets, reducing the probability of primer dimer formation when multiple probes and primers are combined, and also reducing the cost of the detection system. Compared with single-target quantitative fluorescence detection methods, under the same amplification conditions, the amplified copy number of viral amplification products in positive samples can be increased by 2-3 times, which helps to improve the detection rate of weakly positive samples.

[0025] In a preferred embodiment of the present invention, the probe is equipped with a fluorescent reporter group and a fluorescent quencher group.

[0026] In a preferred embodiment of the present invention, the fluorescent reporter group is selected from any one of 5-FAM, 6-FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, TexasRed, Cy5, Cy5.5 and Quasar670, and the fluorescent quencher group is selected from any one of TAMRA, BHQ1, BHQ2, BHQ3, MGB and QSY.

[0027] Secondly, the present invention also provides the application of primer-probe combination in the preparation of PCR detection products for African swine fever virus, wherein the PCR detection products are reagents, kits, chips or detectors.

[0028] In a preferred embodiment of the present invention, the procedure for PCR detection of African swine fever virus includes: 37℃, 5min; 95℃, 5min; 95℃, 15s; 52.1℃, 30s; repeat 30-48 times.

[0029] In a preferred embodiment of the present invention, the PCR detection procedure for African swine fever virus in the above application includes: 37°C for 5 min; 95°C for 5 min; 95°C for 15 s, 52.1°C for 30 s, repeated 45 times. Through screening, the inventors found that the above amplification procedure resulted in a smaller Ct value, stronger fluorescence signal, and higher amplification efficiency.

[0030] The specific procedure information is as follows:

[0031] In a preferred embodiment of the present invention, the system for PCR detection of African swine fever virus in the above application includes primers at the following final concentrations: The final concentrations of the upstream and downstream primers in the first primer-probe set are 280–1000 nM and 280–1000 nM, respectively; the final concentrations of the upstream and downstream primers in the second primer-probe set are 280–1000 nM and 280–1000 nM, respectively; the final concentrations of the upstream and downstream primers in the third primer-probe set are 280–1000 nM and 280–1000 nM, respectively; and the PCR detection system includes probes with a final concentration of 100–600 nM.

[0032] For the PCR detection system, the final concentrations of the upstream and downstream primers in the first primer and probe set are 280, 300, 320, 340, 350, 500, 600, 700, 800, 900, or 1000 nM and 280, 300, 320, 340, 350, 500, 600, 700, 800, 900, or 1000 nM, respectively. The final concentrations of the upstream and downstream primers in the second primer and probe set are 280, 300, 320, 340, 350, 500, 600, 700, 800, 900, or 1000 nM and 280, 300, 320, 340, 350, 500, 600, 700, 800, 900, or 1000 nM, respectively. The final concentrations of the upstream and downstream primers in the third primer-probe set are 280, 300, 320, 340, 350, 500, 600, 700, 800, 900, or 1000 nM and 280, 300, 320, 340, 350, 500, 600, 700, 800, 900, or 1000 nM, respectively. The PCR detection system includes probes with final concentrations of 100, 120, 150, 200, 300, 400, 500, or 600 nM.

[0033] Thirdly, the present invention also provides a PCR detection product for African swine fever virus, which includes the above-mentioned primer and probe combination, and the PCR detection product is a reagent, kit, chip or detector.

[0034] In one embodiment, the kit includes a solid-phase carrier such as a test strip or a microplate. The chip is selected from microfluidic chips, and primers and probes are pre-embedded in the detection area of ​​the chip as embedding materials.

[0035] In a preferred embodiment of the present invention, the PCR detection product for African swine fever virus further includes: qPCRMix, a positive control, and a negative control.

[0036] Positive controls can be, for example, plasmids or gene fragments containing the full-length or partial gene of the African swine fever virus MGF505 gene. Negative controls can be, for example, empty vectors that do not contain the MGF505 gene.

[0037] The qPCR Mix includes buffer system reagents, including but not limited to PB series, Tris series, etc. The qPCR Mix also includes lyophilization protectants, such as protecting against at least one of mannitol, trehalose, dextran, gelatin, hydrogenated maltose, and sucrose.

[0038] The qPCR Mix also includes enzyme reagents such as DNA polymerases, preferably hot-start DNA polymerases such as Tth DNA polymerase and Taq DNA polymerase.

[0039] The detection products (such as kits) provided by the present invention may optionally include any reagents and / or consumables acceptable in the art for PCR reactions or for preparing PCR reaction systems. Specific embodiments may include, but are not limited to, one or more of dNTPs, salts or salt solutions, blank controls, calibrators, and PCR reaction containers.

[0040] Blank control standards are, for example, buffer solutions.

[0041] Fourthly, the present invention also provides a method for detecting African swine fever virus, which is not intended for the diagnosis of the disease, and includes the following steps: mixing the nucleic acid sample to be tested with the above-mentioned primer and probe combination in a PCR system, performing PCR amplification, and detecting the fluorescence signal of the amplification product.

[0042] The nucleic acid samples to be tested originated from pigs or their environmental samples.

[0043] Environmental samples include, but are not limited to: soil samples, pigsty samples, water samples, and mixed soil-water samples.

[0044] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0045] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0046] Example 1 This embodiment provides primer combinations for detecting the African swine fever virus MGF505 gene, and the primer design method is as follows: Primers and probes were designed based on the reference sequence (GenBank: MH766894.3) containing MGF505-2R, MGF505-7R, and MGF505-10R. Figure 1 The red box marks the probe binding site, and corresponding primers are designed upstream and downstream of it, including two upstream primers and three downstream primers. All primers and probes are synthesized by Sangon Biotech (Shanghai) Co., Ltd. Detailed primer and probe sequence information is shown in Table 1.

[0047] Table 1 Primer and probe sequence information

[0048] In Table 1, Y refers to pyrimidine, C or T.

[0049] Example 2 This embodiment provides a PCR detection kit for African swine fever virus, comprising: the primer and probe combination shown in SEQ ID NO: 1-6 of Example 1, and a qPCR Master Mix. The Hieff Unicon® C55P1 TaqManMultiplex qPCR Master Mix (UDG plus) was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. The MagaBioplus Viral DNA / RNA Purification Kit III and the LineGene 9600 Real-Time PCR Instrument were purchased from Hangzhou Borui Technology Co., Ltd.

[0050] This embodiment provides a method for detecting African swine fever virus, which includes the following steps: mixing the nucleic acid sample to be tested with the above-mentioned primer and probe combination in a PCR system, performing PCR amplification, and detecting the fluorescence signal of the amplification product. Specifically: The PCR system includes:

[0051] The PCR amplification procedure includes:

[0052] The PCR amplification procedure described above was followed, and the fluorescence signal of the amplified product was detected using a real-time PCR instrument.

[0053] Experimental Example 1 In this experiment, the primer-probe combinations in Table 1 were arranged in single-target, double-target, and triple-target configurations, specifically into the following 7 groups: 1: MGF505-2R, MGF505-7R, MGF505-10R; 2: MGF505-2R, MGF505-7R; 3: MGF505-7R, MGF505-10R; 4: MGF505-2R, MGF505-10R; 5: MGF505-7R; 6: MGF505-2R; 7: MGF505-10R.

[0054] Following the instructions for the Hieff Unicon® C55P1 TaqMan Multiplex qPCR Master Mix, the reaction system shown in Example 2 was prepared using different primer sets. Real-time PCR was then performed using the complete genome nucleic acid of African swine fever virus (1.5 × 10⁻⁶ mcg) as the template. 3 The number of primer / probe sets was determined to be related to the number of cycles (Ct value) and fluorescence intensity.

[0055] Figure 2The results showed that, with the same amount of template added, the Ct value decreased as the number of target sites in the primer combination increased, while the fluorescence intensity increased accordingly. This indicates that the reaction system with three target sites amplified all three target sites of the gene. Therefore, the primer-probe combination for detecting three target sites was used to establish the detection method.

[0056] Figure 2 In this context, 1 represents MGF505-2R, MGF505-7R, and MGF505-10R; 2 represents MGF505-2R and MGF505-7R; 3 represents MGF505-7R and MGF505-10R; 4 represents MGF505-2R and MGF505-10R; 5 represents MGF505-7R; 6 represents MGF505-2R; 7 represents MGF505-10R; and 8 represents the negative control.

[0057] Experiment Example 2 This experimental example optimizes the reaction procedure.

[0058] To determine the optimal annealing temperature for the reaction system, quantitative real-time PCR reactions were performed at temperatures of 46.0℃, 48.0℃, 50.6℃, 52.1℃, 54.2℃, and 55.8℃ based on the Tm values ​​of the primers and probes. The template was the complete genome nucleic acid of African swine fever virus (1.5 × 10⁻⁶ m³). 3 (copies / μL), the other detection steps are the same as in Example 2.

[0059] Figure 3 The results showed that effective amplification could be achieved within the temperature range of 46.0℃ to 55.8℃. The lowest Ct value (earliest amplification) and strongest fluorescence signal were observed at 52.1℃. Therefore, 52.1℃ was determined as the optimal annealing temperature and set as the preferred annealing temperature for the detection method of this invention.

[0060] Figure 3 1 was 46.0℃; 2 was 48.0℃; 3 was 50.6℃; 4 was 52.1℃; 5 was 54.2℃; 6 was 55.8℃; 7 was the negative control.

[0061] Experimental Example 3 This experimental example demonstrates the sensitivity analysis and standard curve establishment of the detection kit and established detection method provided in Example 2.

[0062] For concentrations of 1.5 × 10⁻⁶, respectively 4 ~1.5×10 -1 The whole genome nucleic acid of African swine fever virus copies / μL was detected according to the detection method provided in Example 2.

[0063] Figure 4The results showed that the detection limit of this method was 1.5 copies / μL. Figure 4 The 1 in the figure is 1.5 × 10 4 copies / μL; 2 is 1.5×10 3 copies / μL; 3 is 1.5×10 2 copies / μL; 4 is 1.5×10 1 copies / μL; 5 is 1.5×10 0 copies / μL; 6 is 1.5×10 -1 copies / μL.

[0064] A standard curve was plotted with Ct value on the ordinate and the logarithm of template concentration (log10 copies / μL) on the abscissa. Amplification was performed according to the optimized reaction procedure, and the standard curve was obtained. Figure 5 The standard curve equation is y = -3.63x +36.12, with R² = 0.998, indicating a good linear relationship.

[0065] Experiment Example 4 This experimental example performs a specificity analysis on the detection kit and the established detection method provided in Example 2.

[0066] Specificity tests were performed on the viral nucleic acids of ASFV, PRRSV, PCV, PRV, PPV2, PEDV, PDCoV, and CSFV according to the detection method provided in Example 2. Porcine pseudorabies virus (PRV) live vaccine (Bartha-K61 strain), porcine parvovirus (PPV) inactivated vaccine (WH-1 strain), porcine circovirus (PCV) type 2 inactivated vaccine (WH strain), and porcine streptococcal (SS) disease live vaccine (SS2-RD strain) were all purchased from Wuhan Keqian Biotechnology Co., Ltd.; inactivated porcine reproductive and respiratory syndrome virus (PRRSV) NADC30 and porcine epidemic diarrhea virus sample (PEDV-GX4-2021 isolate) were provided by the College of Veterinary Medicine, Yangzhou University; African swine fever virus nucleic acid (concentration: 1.5 × 10⁻⁶) was also tested. 4 The viral nucleic acid concentrations (copies / μL) of the samples were provided by the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences. The viral nucleic acid concentrations of all samples tested were less than 1.5 × 10⁻⁶. 4 copies / μL.

[0067] Figure 6 The results showed that specific fluorescent signals were collected only when ASFV was detected, while no amplification was observed in other viral nucleic acids and negative controls, indicating that the established method has good specificity and can specifically identify the target pathogen.

[0068] Figure 6In the table, 1 represents ASFV; 2 represents PRRSV; 3 represents PCV; 4 represents PRV; 5 represents PPV2; 6 represents PEDV; 7 represents PDCoV; 8 represents CSFV; and 9 represents the negative control.

[0069] Experimental Example 5 This experimental example demonstrates the repeatability of the detection kit and detection method provided in Example 2.

[0070] With a concentration of 1.5 × 10 3 copies / μL, 1.5×10 2 copies / μL and 1.5×10 0 Using ASFV viral genome nucleic acid copies / μL as a template, five replicates were set for each concentration, and each concentration was considered a batch for three independent experiments. The Ct values ​​of the detection results were statistically analyzed. Results are referenced... Figure 7 As shown in Table 2, the coefficients of variation (CV) for intra-batch and inter-batch repeatability tests are both less than 2%, indicating that the method has good repeatability.

[0071] Figure 7 The left image in the diagram represents independent experiment 1, the middle image represents independent experiment 2, and the right image represents independent experiment 3. Figure 7 The 1 in the figure is 1.5 × 10 3 copies / μL; 2 is 1.5×10 2 copies / μL; 3 is 1.5×10 0 copies / μL.

[0072] Table 2. Repeatability test results of the ASF MGF505 multi-target TaqMan real-time PCR detection method.

[0073] In summary, this invention designed a specific fluorescent probe and five primers based on the repetitive sequences in the African swine fever virus (ASFV) MGF505 gene to establish a multi-target TaqMan quantitative PCR detection method for ASFV MGF505. The sensitivity, specificity, and repeatability of this method were tested. Results showed that the detection limit of the established multi-target TaqMan quantitative PCR method for ASFV MGF505 reached 1.5 copies / μL. It showed no cross-reactivity with porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), pseudorabies virus (PRV), porcine parvovirus (PCV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDVCV), and classical swine fever virus (CSFV). The intra-assay and inter-assay coefficients of variation (CV) were both less than 2%. In conclusion, the multi-target TaqMan quantitative PCR detection method for ASFV MGF505 established in this study has the characteristics of high specificity, high sensitivity, and good repeatability, providing technical support for the detection of ASFV and the prevention and control of ASF.

[0074] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A primer-probe combination for detecting African swine fever virus, characterized in that, It includes: The first primer and probe set, the second primer and probe set, and the third primer and probe set are for the MGF505 gene. The first primer and probe set includes the probe shown in SEQ ID NO: 1 and the upstream primer and downstream primer shown in SEQ ID NO: 2-3 in sequence. The second primer and probe set includes the probe shown in SEQ ID NO: 1 and the upstream primer and downstream primer shown in SEQ ID NO: 4-5 in sequence. The third primer and probe set includes the probe shown in SEQ ID NO: 1, the upstream primer shown in SEQ ID NO: 2, and the downstream primer shown in SEQ ID NO:

6.

2. The primer-probe combination for detecting African swine fever virus according to claim 1, characterized in that, The probe is equipped with a fluorescent reporter group and a fluorescent quencher group.

3. The primer-probe combination for detecting African swine fever virus according to claim 2, characterized in that, The fluorescent reporter group is selected from any one of 5-FAM, 6-FAM, HEX, TET, VIC, JOE, Cy3, Cy3.5, NED, TAMRA, ROX, TexasRed, Cy5, Cy5.5 and Quasar670, and the fluorescent quencher group is selected from any one of TAMRA, BHQ1, BHQ2, BHQ3, MGB and QSY.

4. The application of the primer-probe combination as described in any one of claims 1-3 in the preparation of a PCR detection product for African swine fever virus, characterized in that, The PCR detection products are reagents, kits, chips, or detectors.

5. The application according to claim 4, characterized in that, In this application, the procedure for PCR detection of African swine fever virus includes: 37℃, 5min; 95℃, 5min; 95℃, 15s; 52.1℃, 30s; repeat 30-48 times.

6. The application according to claim 5, characterized in that, In the application described, the procedure for PCR detection of African swine fever virus includes: 37℃ for 5 min; 95℃ for 5 min; 95℃ for 15 s, 52.1℃ for 30 s, for 45 cycles.

7. The application according to claim 4, characterized in that, In the aforementioned application, the system for PCR detection of African swine fever virus includes primers at the following final concentrations: The final concentrations of the upstream and downstream primers in the first primer-probe set are 280~1000 nM and 280~1000 nM, respectively; the final concentrations of the upstream and downstream primers in the second primer-probe set are 280~1000 nM and 280~1000 nM, respectively. The final concentrations of the upstream and downstream primers in the third primer-probe set are 280-1000 nM and 280-1000 nM, respectively; the PCR detection system includes probes with a final concentration of 100-600 nM.

8. A PCR detection product for African swine fever virus, characterized in that, It includes the primer-probe combination as described in any one of claims 1-3, and the PCR detection product is a reagent, kit, chip, or detector.

9. The PCR detection product for African swine fever virus according to claim 8, characterized in that, The PCR detection products for African swine fever virus also include: qPCR Mix, positive control, and negative control.

10. A method for detecting African swine fever virus, characterized in that, The detection method is not intended for the diagnosis of disease, and includes the following steps: mixing the nucleic acid sample to be tested with the primer and probe combination according to any one of claims 1-3 in a PCR system, performing PCR amplification, and detecting the fluorescence signal of the amplification product.

Citation Information

Patent Citations

  • African swine fever virus wild virus infection and gene deletion virus strain dual fluorescence quantitative PCR detection composition, method and kit

    CN111676327A

  • Quadruple quantitative fluorescent primer probe composition, kit and identification method for identifying African swine fever virus

    CN116656874A